LCAT in Cancer Biology: Embracing Epigenetic Regulation, Immune Interactions, and Therapeutic Implications
Abstract
1. Introduction
2. Results
2.1. LCAT Expression Analysis in Normal and Tumor Tissues
2.2. Prognostic Analysis of LCAT in Tumors
2.3. CNV and SNV Genetic Analysis of LCAT in Tumors
2.4. LCAT Methylation Analysis
2.5. Correlation Analysis of LCAT with m6A Modification
2.6. LCAT Expression and Immune Correlation Analysis
2.7. TMB and MSI Analysis Related to LCAT
2.8. Correlation Analysis of LCAT Expression and Drug Sensitivity
2.9. Molecular Mechanisms by Which LCAT Affects Tumor Progression
3. Discussion
4. Materials and Methods
4.1. LCAT Expression Profile Data Analysis
4.2. Human Protein Atlas (HPA)
4.3. Survival Analysis
4.4. CNV Mutation Analysis
4.5. SNV Mutation Analysis
4.6. MMR Mutation Analysis
4.7. Methylation Analysis
4.8. M6A Modification Analysis
4.9. Immune-Related Analysis
4.10. Drug Sensitivity Analysis
4.11. Functional Enrichment Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Seguret-Mace, S.; Latta-Mahieu, M.; Castro, G.; Luc, G.; Fruchart, J.C.; Rubin, E.; Denefle, P.; Duverger, N. Potential gene therapy for lecithin-cholesterol acyltransferase (LCAT)-deficient and hypoalphalipoproteinemic patients with adenovirus-mediated transfer of human LCAT gene. Circulation 1996, 94, 2177–2184. [Google Scholar] [CrossRef] [PubMed]
- Corn, K.C.; Windham, M.A.; Rafat, M. Lipids in the tumor microenvironment: From cancer progression to treatment. Prog. Lipid Res. 2020, 80, 101055. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.M.; Kim, J.H.; Park, J.S.; Baik, S.J.; Chun, J.; Youn, Y.H.; Park, H. Association between triglyceride-glucose index and gastric car-cinogenesis: A health checkup cohort study. Gastric Cancer 2022, 25, 33–41. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Wang, M.; Zhang, X.; Wang, Y.; Zhao, D.; Li, W.; Lei, F.; Peng, M.; Zhang, Z.; Yuan, Y.; et al. Estrogen Induces LCAT to Maintain Cholesterol Homeostasis and Suppress Hepatocellular Carcinoma Development. Cancer Res. 2024, 84, 2417–2431. [Google Scholar] [CrossRef]
- Park, H.-M.; Kim, H.; Kim, D.W.; Yoon, J.-H.; Kim, B.-G.; Cho, J.-Y. Common plasma protein marker LCAT in aggressive human breast cancer and canine mammary tumor. BMB Rep. 2020, 53, 664–669. [Google Scholar] [CrossRef]
- Mazzuferi, G.; Bacchetti, T.; Islam, O.; Ferretti, G. High density lipoproteins and oxidative stress in breast cancer. Lipids Health Dis. 2021, 20, 143. [Google Scholar] [CrossRef]
- Von Eckardstein, A.; Nordestgaard, B.G.; Remaley, A.T.; Catapano, A.L. High-density lipoprotein revisited: Biological functions and clinical relevance. Eur. Hear. J. 2022, 44, 1394–1407. [Google Scholar] [CrossRef]
- Feicht, J.; Jansen, R.-P. The high-density lipoprotein binding protein HDLBP is an unusual RNA-binding protein with multiple roles in cancer and disease. RNA Biol. 2024, 21, 312–321. [Google Scholar] [CrossRef]
- Chen, X.; Burton, C.; Song, X.; Mcnamara, L.; Langella, A.; Cianetti, S.; Chang, C.H.; Wang, J. An apoA-I mimetic peptide increases LCAT activity in mice through increasing HDL concentration. Int. J. Biol. Sci. 2009, 5, 489–499. [Google Scholar] [CrossRef]
- Qahremani, R.; Rabizadeh, S.; Mirmiranpoor, H.; Yadegar, A.; Mohammadi, F.; Sahebi, L.; Heidari, F.; Esteghamati, A.; Nakhjavani, M. Lipid profile, ox-LDL, and LCAT activity in patients with endometrial carcinoma and type 2 diabetes: The effect of concurrent disease based on a case-control study. Health Sci. Rep. 2023, 6, e1537. [Google Scholar] [CrossRef]
- Mihajlovic, M.; Gojkovic, T.; Vladimirov, S.; Miljkovic, M.; Stefanovic, A.; Vekic, J.; Zeljkovic, D.; Trifunovic, B.; Kotur-Stevuljevic, J.; Spasojevic-Kalimanovska, V.; et al. Changes in lecithin: Cholesterol acyltransferase, cholesteryl ester transfer protein and paraoxonase-1 activities in patients with colorectal cancer. Clin. Biochem. 2018, 63, 32–38. [Google Scholar] [CrossRef] [PubMed]
- Jiang, C.H.; Yuan, X.; Li, J.F.; Xie, Y.F.; Zhang, A.Z.; Wang, X.L.; Yang, L.; Liu, C.X.; Liang, W.H.; Pang, L.J.; et al. Bioinformatics-based screening of key genes for transformation of liver cirrhosis to hepatocellular carcinoma. J. Transl. Med. 2020, 18, 40. [Google Scholar] [CrossRef] [PubMed]
- Zeljkovic, A.; Vekic, J.; Mihajlovic, M.; Gojkovic, T.; Vladimirov, S.; Zeljkovic, D.; Spasojevic-Kalimanovska, V.; Trifunovic, B. Revealing the Role of High-Density Lipo-protein in Colorectal Cancer. Int. J. Mol. Sci. 2021, 22, 3352. [Google Scholar] [CrossRef] [PubMed]
- Gu, X.; Jiang, C.; Zhao, J.; Qiao, Q.; Wu, M.; Cai, B. Identification of lipid metabolism-associated genes as prognostic biomarkers based on the immune microenvironment in hepatocellular carcinoma. Front. Cell Dev. Biol. 2022, 10, 883059. [Google Scholar] [CrossRef]
- Liu, P.; Yuan, B.; Carvalho, C.M.; Wuster, A.; Walter, K.; Zhang, L.; Gambin, T.; Chong, Z.; Campbell, I.M.; Akdemir, Z.C.; et al. An Organismal CNV Mutator Phenotype Restricted to Early Human Development. Cell 2017, 168, 830–842.e7. [Google Scholar] [CrossRef]
- Li, Y.R.; Glessner, J.T.; Coe, B.P.; Li, J.; Mohebnasab, M.; Chang, X.; Connolly, J.; Kao, C.; Wei, Z.; Bradfield, J.; et al. Rare copy number variants in over 100,000 European ancestry subjects reveal multiple disease associations. Nat. Commun. 2020, 11, 255. [Google Scholar] [CrossRef]
- Mamlouk, S.; Childs, L.H.; Aust, D.; Heim, D.; Melching, F.; Oliveira, C.; Wolf, T.; Durek, P.; Schumacher, D.; Bläker, H.; et al. DNA copy number changes define spatial patterns of heterogeneity in colorectal cancer. Nat. Commun. 2017, 8, 14093. [Google Scholar] [CrossRef]
- Azad, N.S.; Gray, R.J.; Overman, M.J.; Schoenfeld, J.D.; Mitchell, E.P.; Zwiebel, J.A.; Sharon, E.; Streicher, H.; Li, S.; McShane, L.M.; et al. Nivolumab Is Effective in Mismatch Re-pair-Deficient Noncolorectal Cancers: Results From Arm Z1D-A Subprotocol of the NCI-MATCH (EAY131) Study. J. Clin. Oncol. 2020, 38, 214–222. [Google Scholar] [CrossRef]
- Mandal, R.; Chan, T.A. Personalized Oncology Meets Immunology: The Path toward Precision Immunotherapy. Cancer Discov. 2016, 6, 703–713. [Google Scholar] [CrossRef]
- Madsen, A.; Höppner, G.; Krause, J.; Hirt, M.N.; Laufer, S.D.; Schweizer, M.; Tan, W.L.W.; Mosqueira, D.; Anene-Nzelu, C.G.; Lim, I.; et al. An Important Role for DNMT3A-Mediated DNA Methylation in Cardiomyocyte Metabolism and Contractility. Circulation 2020, 142, 1562–1578. [Google Scholar] [CrossRef]
- Wang, L.; Ozark, P.A.; Smith, E.R.; Zhao, Z.; Marshall, S.A.; Rendleman, E.J.; Piunti, A.; Ryan, C.; Whelan, A.L.; Helmin, K.A.; et al. TET2 coactivates gene expression through de-methylation of enhancers. Sci. Adv. 2018, 4, eaau6986. [Google Scholar] [CrossRef] [PubMed]
- Lienhard, M.; Grasse, S.; Rolff, J.; Frese, S.; Schirmer, U.; Becker, M.; Börno, S.; Timmermann, B.; Chavez, L.; Sültmann, H.; et al. QSEA—Modelling of genome-wide DNA methylation from sequencing enrichment experiments. Nucleic Acids Res. 2016, 45, e44. [Google Scholar] [CrossRef] [PubMed]
- Ni, W.; A Perez, A.; Schreiner, S.; Nicolet, C.M.; Farnham, P.J. Characterization of the ZFX family of transcription factors that bind downstream of the start site of CpG island promoters. Nucleic Acids Res. 2020, 48, 5986–6000. [Google Scholar] [CrossRef] [PubMed]
- Jovanska, L.; Lin, I.C.; Yao, J.S.; Chen, C.L.; Liu, H.C.; Li, W.C.; Chuang, Y.C.; Chuang, C.N.; Yu, A.C.; Lin, H.N.; et al. DNA cytosine methyltransferases differentially regulate ge-nome-wide hypermutation and interhomolog recombination in Trichoderma reesei meiosis. Nucleic Acids Res. 2024, 52, 9551–9573. [Google Scholar] [CrossRef]
- Yamada, Y.; Venkadakrishnan, V.B.; Mizuno, K.; Bakht, M.; Ku, S.-Y.; Garcia, M.M.; Beltran, H. Targeting DNA methylation and B7-H3 in RB1-deficient and neuroendocrine prostate cancer. Sci. Transl. Med. 2023, 15, eadf6732. [Google Scholar] [CrossRef]
- Traynor, S.; Terp, M.G.; Nielsen, A.Y.; Guldberg, P.; Jakobsen, M.; Pedersen, P.G.; Jakobsen, M.; Pedersen, P.G.; Gammelgaard, O.L.; Pedersen, C.B.; et al. DNA methyltransferase inhibition promotes recruitment of myeloid-derived suppressor cells to the tumor microenvironment through induction of tumor cell-intrinsic interleu-kin-1. Cancer Lett. 2023, 552, 215982. [Google Scholar] [CrossRef]
- He, L.; Li, H.; Wu, A.; Peng, Y.; Shu, G.; Yin, G. Functions of N6-methyladenosine and its role in cancer. Mol. Cancer 2019, 18, 176. [Google Scholar] [CrossRef]
- Yin, H.; Zhang, X.; Yang, P.; Zhang, X.; Peng, Y.; Li, D.; Yu, Y.; Wu, Y.; Wang, Y.; Zhang, J.; et al. RNA m6A methylation orchestrates cancer growth and metastasis via macrophage reprogramming. Nat. Commun. 2021, 12, 1394. [Google Scholar] [CrossRef]
- Xiong, J.; He, J.; Zhu, J.; Pan, J.; Liao, W.; Ye, H.; Wang, H.; Song, Y.; Du, Y.; Cui, B.; et al. Lactylation-driven METTL3-mediated RNA m6A modification promotes immunosuppression of tumor-infiltrating myeloid cells. Mol. Cell 2022, 82, 1660–1677. [Google Scholar] [CrossRef]
- Sun, L.; Zhang, Y.; Yang, B.; Sun, S.; Zhang, P.; Luo, Z.; Feng, T.; Cui, Z.; Zhu, T.; Li, Y.; et al. Lactylation of METTL16 promotes cuproptosis via m6A-modification on FDX1 mRNA in gastric cancer. Nat. Commun. 2023, 14, 6523. [Google Scholar] [CrossRef]
- Ye, Z.; Li, G.; Lei, J. Influencing immunity: Role of extracellular vesicles in tumor immune checkpoint dynamics. Exp. Mol. Med. 2024, 56, 2365–2381. [Google Scholar] [CrossRef] [PubMed]
- Wisdom, A.J.; Mowery, Y.M.; Hong, C.S.; Himes, J.E.; Nabet, B.Y.; Qin, X.; Zhang, D.; Chen, L.; Fradin, H.; Patel, R.; et al. Single cell analysis reveals distinct immune landscapes in transplant and primary sarcomas that determine response or resistance to immunotherapy. Nat. Commun. 2020, 11, 6410. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Ju, Z.; Zhao, W.; Wang, L.; Peng, Y.; Ge, Z.; Nagel, Z.D.; Zou, J.; Wang, C.; Kapoor, P.; et al. ARID1A deficiency promotes mutability and potentiates therapeutic an-titumor immunity unleashed by immune checkpoint blockade. Nat. Med. 2018, 24, 556–562. [Google Scholar] [CrossRef] [PubMed]
- Rahmani, S.; Galipeau, H.J.; Clarizio, A.V.; Wang, X.; Hann, A.; Rueda, G.H.; Kirtikar, U.N.; Constante, M.; Wulczynski, M.; Su, H.-M.; et al. Gluten-Dependent Activation of CD4+ T Cells by MHC Class II–Expressing Epithelium. Gastroenterology 2024, 167, 1113–1128. [Google Scholar] [CrossRef]
- Tomczyk, M.; Kraszewska, I.; Szade, K.; Bukowska-Strakova, K.; Meloni, M.; Jozkowicz, A.; Dulak, J.; Jazwa, A. Splenic Ly6C(hi) monocytes con-tribute to adverse late post-ischemic left ventricular remodeling in heme oxygenase-1 deficient mice. Basic. Res. Cardiol. 2017, 112, 39. [Google Scholar] [CrossRef]
- Liu, L.; Chen, Q.; Ruan, C.; Chen, X.; Zhang, Y.; He, X.; Zhang, Y.; Lu, Y.; Guo, Q.; Sun, T.; et al. Platinum-Based Nanovectors Engineered with Immuno-Modulating Adjuvant for Inhibiting Tumor growth and Promoting Immunity. Theranostics 2018, 8, 2974–2987. [Google Scholar] [CrossRef]
- Khwaja, F.W.; Reed, M.S.; Olson, J.J.; Schmotzer, B.J.; Gillespie, G.Y.; Guha, A.; Groves, M.D.; Kesari, S.; Pohl, J.; Van Meir, E.G. Proteomic Identification of Biomarkers in the Cerebrospinal Fluid (CSF) of Astrocytoma Patients. J. Proteome Res. 2007, 6, 559–570. [Google Scholar] [CrossRef]
- Axelrod, M.L.; Cook, R.S.; Johnson, D.B.; Balko, J.M. Biological Consequences of MHC-II Expression by Tumor Cells in Cancer. Clin. Cancer Res. 2019, 25, 2392–2402. [Google Scholar] [CrossRef]
- Kwon, J.; Bakhoum, S.F. The Cytosolic DNA-Sensing cGAS-STING Pathway in Cancer. Cancer Discov. 2020, 10, 26–39. [Google Scholar] [CrossRef]
- Marusyk, A.; Janiszewska, M.; Polyak, K. Intratumor Heterogeneity: The Rosetta Stone of Therapy Resistance. Cancer 2020, 37, 471–484. [Google Scholar] [CrossRef]
- Cristescu, R.; Mogg, R.; Ayers, M.; Albright, A.; Murphy, E.; Yearley, J.; Sher, X.; Liu, X.Q.; Lu, H.; Nebozhyn, M.; et al. Pan-tumor genomic biomarkers for PD-1 checkpoint blockade–based immunotherapy. Science 2018, 362, eaar3593. [Google Scholar] [CrossRef] [PubMed]
- Hao, Q.; Li, R.; Li, H.; Rui, S.; You, L.; Zhang, L.; Zhao, Y.; Li, P.; Li, Y.; Kong, X.; et al. Dynamics of The Gammadeltatcr Repertoires During The Dedifferentiation Process and Pilot Implications for Immunotherapy of Thyroid Cancer. Adv. Sci. 2024, 11, e2306364. [Google Scholar] [CrossRef] [PubMed]
- Williams, C.J.; Peddle, A.M.; Kasi, P.M.; Seligmann, J.F.; Roxburgh, C.S.; Middleton, G.W.; Tejpar, S. Neoadjuvant immunotherapy for dMMR and pMMR colorectal cancers: Therapeutic strategies and putative biomarkers of response. Nat. Rev. Clin. Oncol. 2024, 21, 839–851. [Google Scholar] [CrossRef]
- Gonzalez, F.J.; Xia, Y. Adipose triglyceride lipase as a target for treatment of metabolic dysfunction-associated steatohepatitis: The role of hepatic and intestinal PPARalpha. J. Hepatol. 2024. S0168-8278(24)02703-X. [Google Scholar] [CrossRef]
- Kuai, R.; Li, D.; Chen, Y.E.; Moon, J.J.; Schwendeman, A. High-Density Lipoproteins: Nature’s Multifunctional Nanoparticles. ACS Nano 2016, 10, 3015–3041. [Google Scholar] [CrossRef]
- Dekker, J.; Heard, E. Structural and functional diversity of Topologically Associating Domains. FEBS Lett. 2015, 589, 2877–2884. [Google Scholar] [CrossRef]
- Yankova, E.; Blackaby, W.; Albertella, M.; Rak, J.; De Braekeleer, E.; Tsagkogeorga, G.; Pilka, E.S.; Aspris, D.; Leggate, D.; Hendrick, A.G.; et al. Small-molecule inhibition of METTL3 as a strategy against myeloid leukaemia. Nature 2021, 593, 597–601. [Google Scholar] [CrossRef]
- Yue, S.-W.; Liu, H.-L.; Su, H.-F.; Luo, C.; Liang, H.-F.; Zhang, B.-X.; Zhang, W. m6A-regulated tumor glycolysis: New advances in epigenetics and metabolism. Mol. Cancer 2023, 22, 137. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, Y.; Patel, H.; Chen, J.; Wang, J.; Chen, Z.-S.; Wang, H. Epigenetic modification of m6A regulator proteins in cancer. Mol. Cancer 2023, 22, 102. [Google Scholar] [CrossRef]
- Liu, T.; Wei, Q.; Jin, J.; Luo, Q.; Liu, Y.; Yang, Y.; Cheng, C.; Li, L.; Pi, J.; Si, Y.; et al. The m6A reader YTHDF1 promotes ovarian cancer progression via augmenting EIF3C translation. Nucleic Acids Res. 2020, 48, 3816–3831. [Google Scholar] [CrossRef]
- Yang, F.; Jin, H.; Que, B.; Chao, Y.; Zhang, H.; Ying, X.; Zhou, Z.; Yuan, Z.; Su, J.; Wu, B.; et al. Dynamic m6A mRNA methylation reveals the role of METTL3-m6A-CDCP1 signaling axis in chemical carcinogenesis. Oncogene 2019, 38, 4755–4772. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Kong, S.; Tao, M.; Ju, S. The potential role of RNA N6-methyladenosine in Cancer progression. Mol. Cancer 2020, 19, 88. [Google Scholar] [CrossRef]
- Mempel, T.R.; Lill, J.K.; Altenburger, L.M. How chemokines organize the tumour microenvironment. Nat. Rev. Cancer 2023, 24, 28–50. [Google Scholar] [CrossRef]
- Asplund, A.; Edqvist, P.D.; Schwenk, J.M.; Pontén, F. Antibodies for profiling the human proteome—The Human Protein Atlas as a resource for cancer research. Proteomics 2012, 12, 2067–2077. [Google Scholar] [CrossRef]
- Liu, C.-J.; Hu, F.-F.; Xie, G.-Y.; Miao, Y.-R.; Li, X.-W.; Zeng, Y.; Guo, A.-Y. GSCA: An integrated platform for gene set cancer analysis at genomic, pharmacogenomic and immunogenomic levels. Briefings Bioinform. 2022, 24, bbac558. [Google Scholar] [CrossRef]
- Li, T.; Fu, J.; Zeng, Z.; Cohen, D.; Li, J.; Chen, Q.; Li, B.; Liu, X.S. TIMER2.0 for analysis of tumor-infiltrating immune cells. Nucleic Acids Res. 2020, 48, W509–W514. [Google Scholar] [CrossRef]
- Zhou, Y.; Zeng, P.; Li, Y.H.; Zhang, Z.; Cui, Q. SRAMP: Prediction of mammalian N6-methyladenosine (m6A) sites based on se-quence-derived features. Nucleic Acids Res. 2016, 44, e91. [Google Scholar] [CrossRef]
- Lin, A.; Qi, C.; Wei, T.; Li, M.; Cheng, Q.; Liu, Z.; Luo, P.; Zhang, J. CAMOIP: A web server for comprehensive analysis on multi-omics of im-munotherapy in pan-cancer. Brief. Bioinform. 2022, 23, bbac129. [Google Scholar] [CrossRef]
Position | Sequence Context | Score |
---|---|---|
1072 | CGCAGATGCTGCGGCAGATGAGA CTGACCAAGACTGAGCGGGAGC | 0.704 |
1212 | ATCCAGATGACGTGGACCAGGG ACAAGTACATGACTGAGACCTGG | 0.603 |
1223 | GTGGACCAGGGACAAGTACATG ACTGAGACCTGGGACCCCAGCCA | 0.582 |
1724 | TGGGACCCTGGGATGTTTGGGG ACTTTACTATCTAGCACCCCAGT | 0.903 |
1991 | GAGACAGCTGAGCTGAGGCCTG ACTTTTTCAATAAAACATTGTGT | 0.584 |
2205 | CCCACTCCCACACCAGATAAGG ACAGCCCAGTGCCGCTTTCTCTG | 0.579 |
2593 | TCCCTTCTCCCACCACACTGTGA CTCTCAGTTGTCTAACCCAGGG | 0.559 |
2694 | TGGTCAGTCACAGCCACACCAGA CTCTGGGCCAAGCCCCACCACT | 0.61 |
2743 | CCTTGGCCCCCACCCACCAAGGA CAAGATGCCCAGCCCAGGATCG | 0.641 |
2847 | GACCTATCTGTTCCCACCTTGGA CTTTGGCAATAAAGGAGCGCCA | 0.76 |
2871 | TTTGGCAATAAAGGAGCG CCAGACTGGG----------------- | 0.563 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, M.; Zhang, W.; Li, X.; Li, S.; Wang, W.; Han, P. LCAT in Cancer Biology: Embracing Epigenetic Regulation, Immune Interactions, and Therapeutic Implications. Int. J. Mol. Sci. 2025, 26, 1453. https://doi.org/10.3390/ijms26041453
Gao M, Zhang W, Li X, Li S, Wang W, Han P. LCAT in Cancer Biology: Embracing Epigenetic Regulation, Immune Interactions, and Therapeutic Implications. International Journal of Molecular Sciences. 2025; 26(4):1453. https://doi.org/10.3390/ijms26041453
Chicago/Turabian StyleGao, Manzhi, Wentian Zhang, Xinxin Li, Sumin Li, Wenlan Wang, and Peijun Han. 2025. "LCAT in Cancer Biology: Embracing Epigenetic Regulation, Immune Interactions, and Therapeutic Implications" International Journal of Molecular Sciences 26, no. 4: 1453. https://doi.org/10.3390/ijms26041453
APA StyleGao, M., Zhang, W., Li, X., Li, S., Wang, W., & Han, P. (2025). LCAT in Cancer Biology: Embracing Epigenetic Regulation, Immune Interactions, and Therapeutic Implications. International Journal of Molecular Sciences, 26(4), 1453. https://doi.org/10.3390/ijms26041453