Dual Roles of Canagliflozin on Cholangiocarcinoma Cell Growth and Enhanced Growth Suppression in Combination with FK866
Abstract
1. Introduction
2. Results
2.1. Gene Expression of SGLT1 and SGLT2 in CCA Cells
2.2. CANA Affects the Growth and Survival of CCA Cell Lines
2.3. CANA Arrests the Cell Cycle of CCA Cells
2.4. Effect of CANA on Apoptosis Is Limited in CCA Cells
2.5. CANA Suppresses EMT in CCA
2.6. Effects of CANA on Gene Expression of Its Target Proteins
2.7. CANA Acts on the NAD+ Salvage Pathway and Promotes Cell Growth
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Reagents
4.2. Cell Viability
4.3. Gene Expression
4.4. Database Analysis
4.5. Wound-Healing Assay
4.6. Cell Cycle Assay
4.7. Apoptosis Assay
4.8. NAD+/NADH Assay
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
CANA | canagliflozin |
CCA | cholangiocarcinoma |
EMT | epithelial–mesenchymal transition |
GLP | glucagon-like peptide |
HCC | hepatocellular carcinoma |
HDAC6 | histone deacetylase 6 |
NAD | nicotinamide adenine dinucleotide |
NAMPT | nicotinamide phosphoribosyltransferase |
SGLT | sodium glucose cotransporter |
SIRT1 | sirtuin 1 |
TCGA | the Cancer Genome Atlas |
References
- Banales, J.M.; Marin, J.J.G.; Lamarca, A.; Rodrigues, P.M.; Khan, S.A.; Roberts, L.R.; Cardinale, V.; Carpino, G.; Andersen, J.B.; Braconi, C.; et al. Cholangiocarcinoma 2020: The next horizon in mechanisms and management. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 557–588. [Google Scholar] [CrossRef]
- Vogel, A.; Bridgewater, J.; Edeline, J.; Kelley, R.K.; Klumpen, H.J.; Malka, D.; Primrose, J.N.; Rimassa, L.; Stenzinger, A.; Valle, J.W.; et al. Biliary tract cancer: ESMO Clinical Practice Guideline for diagnosis, treatment and follow-up. Ann. Oncol. 2023, 34, 127–140. [Google Scholar] [CrossRef] [PubMed]
- Valle, J.; Wasan, H.; Palmer, D.H.; Cunningham, D.; Anthoney, A.; Maraveyas, A.; Madhusudan, S.; Iveson, T.; Hughes, S.; Pereira, S.P.; et al. Cisplatin plus gemcitabine versus gemcitabine for biliary tract cancer. N. Engl. J. Med. 2010, 362, 1273–1281. [Google Scholar] [CrossRef]
- Okusaka, T.; Nakachi, K.; Fukutomi, A.; Mizuno, N.; Ohkawa, S.; Funakoshi, A.; Nagino, M.; Kondo, S.; Nagaoka, S.; Funai, J.; et al. Gemcitabine alone or in combination with cisplatin in patients with biliary tract cancer: A comparative multicentre study in Japan. Br. J. Cancer 2010, 103, 469–474. [Google Scholar] [CrossRef] [PubMed]
- Morizane, C.; Okusaka, T.; Mizusawa, J.; Katayama, H.; Ueno, M.; Ikeda, M.; Ozaka, M.; Okano, N.; Sugimori, K.; Fukutomi, A.; et al. Combination gemcitabine plus S-1 versus gemcitabine plus cisplatin for advanced/recurrent biliary tract cancer: The FUGA-BT (JCOG1113) randomized phase III clinical trial. Ann. Oncol. 2019, 30, 1950–1958. [Google Scholar] [CrossRef] [PubMed]
- Goyal, L.; Meric-Bernstam, F.; Hollebecque, A.; Valle, J.W.; Morizane, C.; Karasic, T.B.; Abrams, T.A.; Furuse, J.; Kelley, R.K.; Cassier, P.A.; et al. Futibatinib for FGFR2-Rearranged Intrahepatic Cholangiocarcinoma. N. Engl. J. Med. 2023, 388, 228–239. [Google Scholar] [CrossRef] [PubMed]
- Oh, D.Y.; Ruth He, A.; Qin, S.; Chen, L.T.; Okusaka, T.; Vogel, A.; Kim, J.W.; Suksombooncharoen, T.; Ah Lee, M.; Kitano, M.; et al. Durvalumab plus Gemcitabine and Cisplatin in Advanced Biliary Tract Cancer. NEJM Evid. 2022, 1, EVIDoa2200015. [Google Scholar] [CrossRef]
- Heumann, P.; Albert, A.; Gulow, K.; Tumen, D.; Muller, M.; Kandulski, A. Current and Future Therapeutic Targets for Directed Molecular Therapies in Cholangiocarcinoma. Cancers 2024, 16, 1690. [Google Scholar] [CrossRef] [PubMed]
- Scheen, A.J. Pharmacodynamics, efficacy and safety of sodium-glucose co-transporter type 2 (SGLT2) inhibitors for the treatment of type 2 diabetes mellitus. Drugs 2015, 75, 33–59. [Google Scholar] [CrossRef]
- Kaji, K.; Nishimura, N.; Seki, K.; Sato, S.; Saikawa, S.; Nakanishi, K.; Furukawa, M.; Kawaratani, H.; Kitade, M.; Moriya, K.; et al. Sodium glucose cotransporter 2 inhibitor canagliflozin attenuates liver cancer cell growth and angiogenic activity by inhibiting glucose uptake. Int. J. Cancer 2018, 142, 1712–1722. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; Zhou, Y.; Xie, X.; He, L.; Ding, J.; Pang, S.; Shen, B.; Zhou, C. Inhibitory effects of canagliflozin on pancreatic cancer are mediated via the downregulation of glucose transporter-1 and lactate dehydrogenase A. Int. J. Oncol. 2020, 57, 1223–1233. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Zhu, J.; Yu, S.J.; Ma, H.L.; Chen, J.; Ding, X.F.; Chen, G.; Liang, Y.; Zhang, Q. Sodium-glucose co-transporter-2 (SGLT-2) inhibition reduces glucose uptake to induce breast cancer cell growth arrest through AMPK/mTOR pathway. Biomed. Pharmacother. 2020, 132, 110821. [Google Scholar] [CrossRef] [PubMed]
- Papadopoli, D.; Uchenunu, O.; Palia, R.; Chekkal, N.; Hulea, L.; Topisirovic, I.; Pollak, M.; St-Pierre, J. Perturbations of cancer cell metabolism by the antidiabetic drug canagliflozin. Neoplasia 2021, 23, 391–399. [Google Scholar] [CrossRef]
- Sabaa, M.; Sharawy, M.H.; El-Sherbiny, M.; Said, E.; Salem, H.A.; Ibrahim, T.M. Canagliflozin interrupts mTOR-mediated inflammatory signaling and attenuates DMBA-induced mammary cell carcinoma in rats. Biomed. Pharmacother. 2022, 155, 113675. [Google Scholar] [CrossRef]
- Wang, Y.; Yang, L.; Mao, L.; Zhang, L.; Zhu, Y.; Xu, Y.; Cheng, Y.; Sun, R.; Zhang, Y.; Ke, J.; et al. SGLT2 inhibition restrains thyroid cancer growth via G1/S phase transition arrest and apoptosis mediated by DNA damage response signaling pathways. Cancer Cell Int. 2022, 22, 74. [Google Scholar] [CrossRef]
- Ding, L.; Chen, X.; Zhang, W.; Dai, X.; Guo, H.; Pan, X.; Xu, Y.; Feng, J.; Yuan, M.; Gao, X.; et al. Canagliflozin primes antitumor immunity by triggering PD-L1 degradation in endocytic recycling. J. Clin. Investig. 2023, 133, e154754. [Google Scholar] [CrossRef] [PubMed]
- Coperchini, F.; Greco, A.; Croce, L.; Pignatti, P.; Muzza, M.; Petrosino, E.; Teliti, M.; Magri, F.; Rotondi, M. Canagliflozin reduces thyroid cancer cells migration in vitro by inhibiting CXCL8 and CCL2: An additional anti-tumor effect of the drug. Biomed. Pharmacother. 2024, 170, 115974. [Google Scholar] [CrossRef] [PubMed]
- Jiang, D.; Ma, P. Canagliflozin, characterized as a HDAC6 inhibitor, inhibits gastric cancer metastasis. Front. Oncol. 2022, 12, 1057455. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Liu, Q.; Li, Y.; Tang, Q.; Wu, T.; Chen, L.; Pu, S.; Zhao, Y.; Zhang, G.; Huang, C.; et al. The diabetes medication canagliflozin promotes mitochondrial remodelling of adipocyte via the AMPK-Sirt1-Pgc-1alpha signalling pathway. Adipocyte 2020, 9, 484–494. [Google Scholar] [CrossRef]
- He, L.; Ma, S.; Zuo, Q.; Zhang, G.; Wang, Z.; Zhang, T.; Zhai, J.; Guo, Y. An Effective Sodium-Dependent Glucose Transporter 2 Inhibition, Canagliflozin, Prevents Development of Hypertensive Heart Failure in Dahl Salt-Sensitive Rats. Front. Pharmacol. 2022, 13, 856386. [Google Scholar] [CrossRef]
- Althagafy, H.S.; Ali, F.E.M.; Hassanein, E.H.M.; Mohammedsaleh, Z.M.; Kotb El-Sayed, M.I.; Atwa, A.M.; Sayed, A.M.; Soubh, A.A. Canagliflozin ameliorates ulcerative colitis via regulation of TLR4/MAPK/NF-kappaB and Nrf2/PPAR-gamma/SIRT1 signaling pathways. Eur. J. Pharmacol. 2023, 960, 176166. [Google Scholar] [CrossRef] [PubMed]
- DiNicolantonio, J.J.; McCarty, M.F.; O’Keefe, J.H. Nutraceutical activation of Sirt1: A review. Open Heart 2022, 9, e002171. [Google Scholar] [CrossRef]
- Yi, J.; Luo, J. SIRT1 and p53, effect on cancer, senescence and beyond. Biochim. Biophys. Acta 2010, 1804, 1684–1689. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.J.; Guo, X.Z.; Li, C.; Chong, Y.; Song, T.N.; Pang, J.F.; Shao, M. SIRT1-ZEB1-positive feedback promotes epithelial-mesenchymal transition process and metastasis of osteosarcoma. J. Cell. Biochem. 2019, 120, 3727–3735. [Google Scholar] [CrossRef]
- Lee, Y.H.; Kim, S.J.; Fang, X.; Song, N.Y.; Kim, D.H.; Suh, J.; Na, H.K.; Kim, K.O.; Baek, J.H.; Surh, Y.J. JNK-mediated Ser27 phosphorylation and stabilization of SIRT1 promote growth and progression of colon cancer through deacetylation-dependent activation of Snail. Mol. Oncol. 2022, 16, 1555–1571. [Google Scholar] [CrossRef]
- Obara, K.; Shirakami, Y.; Maruta, A.; Ideta, T.; Miyazaki, T.; Kochi, T.; Sakai, H.; Tanaka, T.; Seishima, M.; Shimizu, M. Preventive effects of the sodium glucose cotransporter 2 inhibitor tofogliflozin on diethylnitrosamine-induced liver tumorigenesis in obese and diabetic mice. Oncotarget 2017, 8, 58353–58363. [Google Scholar] [CrossRef]
- Pant, K.; Richard, S.; Gradilone, S.A. Short-Chain Fatty Acid Butyrate Induces Cilia Formation and Potentiates the Effects of HDAC6 Inhibitors in Cholangiocarcinoma Cells. Front. Cell Dev. Biol. 2021, 9, 809382. [Google Scholar] [CrossRef]
- Scafoglio, C.; Hirayama, B.A.; Kepe, V.; Liu, J.; Ghezzi, C.; Satyamurthy, N.; Moatamed, N.A.; Huang, J.; Koepsell, H.; Barrio, J.R.; et al. Functional expression of sodium-glucose transporters in cancer. Proc. Natl. Acad. Sci. USA 2015, 112, E4111–E4119. [Google Scholar] [CrossRef] [PubMed]
- Fareed, A.; Hussain, A. The Expanding Role of GLP-1: From Diabetes Management to Cancer Treatment. Clin. Med. Insights Endocrinol. Diabetes 2023, 16, 11795514231213566. [Google Scholar] [CrossRef]
- Shilyansky, J.S.; Chan, C.J.; Xiao, S.; Gribovskaja-Rupp, I.; Quelle, D.E.; Howe, J.R.; Dillon, J.S.; Ear, P.H. GLP-1R agonist promotes proliferation of neuroendocrine neoplasm cells expressing GLP-1 receptors. Surgery 2024, 108943. [Google Scholar] [CrossRef]
- Sung, H.L.; Hung, C.Y.; Tung, Y.C.; Lin, C.C.; Tsai, T.H.; Huang, K.H. Comparison between sodium-glucose cotransporter 2 inhibitors and dipeptidyl peptidase 4 inhibitors on the risk of incident cancer in patients with diabetes mellitus: A real-world evidence study. Diabetes Metab. Res. Rev. 2024, 40, e3784. [Google Scholar] [CrossRef] [PubMed]
- Mohite, P.; Lokwani, D.K.; Sakle, N.S. Exploring the therapeutic potential of SGLT2 inhibitors in cancer treatment: Integrating in silico and in vitro investigations. Naunyn Schmiedebergs Arch. Pharmacol. 2024, 397, 6107–6119. [Google Scholar] [CrossRef]
- Wei, Y.; Xiang, H.; Zhang, W. Review of various NAMPT inhibitors for the treatment of cancer. Front. Pharmacol. 2022, 13, 970553. [Google Scholar] [CrossRef] [PubMed]
- Ceballos, M.P.; Angel, A.; Delprato, C.B.; Livore, V.I.; Ferretti, A.C.; Lucci, A.; Comanzo, C.G.; Alvarez, M.L.; Quiroga, A.D.; Mottino, A.D.; et al. Sirtuin 1 and 2 inhibitors enhance the inhibitory effect of sorafenib in hepatocellular carcinoma cells. Eur. J. Pharmacol. 2021, 892, 173736. [Google Scholar] [CrossRef] [PubMed]
- Luo, D.; Fan, H.; Ma, X.; Yang, C.; He, Y.; Ge, Y.; Jiang, M.; Xu, Z.; Yang, L. miR-1301-3p Promotes Cell Proliferation and Facilitates Cell Cycle Progression via Targeting SIRT1 in Gastric Cancer. Front. Oncol. 2021, 11, 664242. [Google Scholar] [CrossRef]
- Yang, N.; Sun, R.; Zhang, X.; Wang, J.; Wang, L.; Zhu, H.; Yuan, M.; Xu, Y.; Ge, C.; He, J.; et al. Alternative pathway of bile acid biosynthesis contributes to ameliorate NASH after induction of NAMPT/NAD(+)/SIRT1 axis. Biomed. Pharmacother. 2023, 164, 114987. [Google Scholar] [CrossRef]
- Korfhage, J.; Skinner, M.E.; Basu, J.; Greenson, J.K.; Miller, R.A.; Lombard, D.B. Canagliflozin Increases Intestinal Adenoma Burden in Female ApcMin/+ Mice. J. Gerontol. A Biol. Sci. Med. Sci. 2022, 77, 215–220. [Google Scholar] [CrossRef] [PubMed]
- Kawaguchi, T.; Fujishima, Y.; Wakasugi, D.; Io, F.; Sato, Y.; Uchida, S.; Kitajima, Y. Effects of SGLT2 inhibitors on the onset of esophageal varices and extrahepatic cancer in type 2 diabetic patients with suspected MASLD: A nationwide database study in Japan. J. Gastroenterol. 2024, 59, 1120–1132. [Google Scholar] [CrossRef] [PubMed]
- Chou, O.H.I.; Ning, J.; Chan, R.N.C.; Chung, C.T.; Huang, H.; Ng, K.; Dee, E.C.; Lee, S.; Kaewdech, A.; Chow, A.K.M.; et al. Lower Risks of New-Onset Hepatocellular Carcinoma in Patients with Type 2 Diabetes Mellitus Treated with SGLT2 Inhibitors Versus DPP4 Inhibitors. J. Natl. Compr. Canc. Netw. 2024, 22, e237118. [Google Scholar] [CrossRef] [PubMed]
- Taguchi, D.; Shirakami, Y.; Sakai, H.; Maeda, T.; Miwa, T.; Kubota, M.; Imai, K.; Ibuka, T.; Shimizu, M. High-Fat Diet Delays Liver Fibrosis Recovery and Promotes Hepatocarcinogenesis in Rat Liver Cirrhosis Model. Nutrients 2024, 16, 2506. [Google Scholar] [CrossRef] [PubMed]
- Chandrashekar, D.S.; Bashel, B.; Balasubramanya, S.A.H.; Creighton, C.J.; Ponce-Rodriguez, I.; Chakravarthi, B.; Varambally, S. UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses. Neoplasia 2017, 19, 649–658. [Google Scholar] [CrossRef] [PubMed]
- Chandrashekar, D.S.; Karthikeyan, S.K.; Korla, P.K.; Patel, H.; Shovon, A.R.; Athar, M.; Netto, G.J.; Qin, Z.S.; Kumar, S.; Manne, U.; et al. UALCAN: An update to the integrated cancer data analysis platform. Neoplasia 2022, 25, 18–27. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward | Reverse |
---|---|---|
BAX | CATCATGGGCTGGACATTG | GGGACATCAGTCGCTTCAGT |
BCL2 | AGTACCTGAACCGGCACCT | GCCGTACAGTTCCACAAAGG |
BCL2L1 | GCCACTTACCTGAATGACCAC | TGCTGCATTGTTCCCATAGA |
CCNB1 | CATGGTGCACTTTCCTCCTT | AGGTAATGTTGTAGAGTTGGTGTCC |
CCND1 | CCATCCAGTGGAGGTTTGTC | GTGGGACAGGTGGCCTTT |
CCNE1 | GGGACACCATGAAGGAGGA | TCTTCATCTGGATCCTGCAA |
CDH1 | TGGAGGAATTCTTGCTTTGC | CGCTCTCCTCCGAAGAAAC |
CDH2 | AGGCTTCTGGTGAAATCGCA | AGAGGCTGTCCTTCATGCAC |
CDK1 | TGGATCTGAAGAAATACTTGGATTCTA | CAATCCCCTGTAGGATTTGG |
CDK2 | AAAGCCAGAAACAAGTTGACG | GTACTGGGCACACCCTCAGT |
CDKN1A | TGGGTGGTACCCTCTGGA | TGAATTTCATAACCGCCTGTG |
GAPDH | AGCCACATCGCTCAGACAC | GCCCAATACGACCAAATCC |
HDAC6 | GTCGCGGGGAAAAGGTCG | CTCCACTCATTGGACGCAG |
MKI67 | AATTTGCTTGGAAAACAGTTTCA | TGCACTGAAGAACACATTTCCT |
NAMPT | CAAGTTGCTGCCACCTTATCT | TGTTTCATGCCTTCTACAATCTCT |
SIRT1 | GCCTCACATGCAAGCTCTAGT | TGTTCGAGGATCTGTGCCAA |
SLC5A1 | CTGGCAGGCCGAAGTATG | CCACTTCCAATGTTACTAGCAAAG |
SLC5A2 | GTTGCTGGATTCGAGTGGA | AGGTACACGGGTGCAAACA |
SNAI1 | GGATCTCCAGGCTCGAAAGG | TGGCTTCGGATGTGCATCTT |
TJP1 | ACACTGCTGAGTCCTTTGGT | ATCACAGTGTGGTAAGCGCA |
VIM | TGGTCTAACGGTTTCCCCTA | GACCTCGGAGCGAGAGTG |
ZEB1 | AGCTGTTTCAAGATGTTTCCTTCC | ACGAAAGCAGTGATTTTAATGATGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Taguchi, D.; Shirakami, Y.; Sakai, H.; Minowa, D.; Miwa, T.; Maeda, T.; Kubota, M.; Imai, K.; Ibuka, T.; Shimizu, M. Dual Roles of Canagliflozin on Cholangiocarcinoma Cell Growth and Enhanced Growth Suppression in Combination with FK866. Int. J. Mol. Sci. 2025, 26, 978. https://doi.org/10.3390/ijms26030978
Taguchi D, Shirakami Y, Sakai H, Minowa D, Miwa T, Maeda T, Kubota M, Imai K, Ibuka T, Shimizu M. Dual Roles of Canagliflozin on Cholangiocarcinoma Cell Growth and Enhanced Growth Suppression in Combination with FK866. International Journal of Molecular Sciences. 2025; 26(3):978. https://doi.org/10.3390/ijms26030978
Chicago/Turabian StyleTaguchi, Daisuke, Yohei Shirakami, Hiroyasu Sakai, Daisuke Minowa, Takao Miwa, Toshihide Maeda, Masaya Kubota, Kenji Imai, Takashi Ibuka, and Masahito Shimizu. 2025. "Dual Roles of Canagliflozin on Cholangiocarcinoma Cell Growth and Enhanced Growth Suppression in Combination with FK866" International Journal of Molecular Sciences 26, no. 3: 978. https://doi.org/10.3390/ijms26030978
APA StyleTaguchi, D., Shirakami, Y., Sakai, H., Minowa, D., Miwa, T., Maeda, T., Kubota, M., Imai, K., Ibuka, T., & Shimizu, M. (2025). Dual Roles of Canagliflozin on Cholangiocarcinoma Cell Growth and Enhanced Growth Suppression in Combination with FK866. International Journal of Molecular Sciences, 26(3), 978. https://doi.org/10.3390/ijms26030978