In Silico Born Designed Anti-EGFR Aptamer Gol1 Has Anti-Proliferative Potential for Patient Glioblastoma Cells
Abstract
1. Introduction
2. Results
2.1. Computational Modeling and Synthesis of the Gol1 Aptamer
2.2. Human Glioblastoma Cell Cultures with EGFRwt/EGFRvIII Expression
2.3. Analysis of the Effect of Aptamers on the Proliferative Potential of Human Glioblastoma Cells
2.4. Analysis of Transcriptomic Data of Human Glioblastoma G01 Cells After Gol1 Aptamer Treatment
3. Discussion
4. Materials and Methods
4.1. Aptamers
4.2. Modeling
4.3. Cell Cultures
4.4. Cell Cultivation with Aptamers
4.5. MTS Assay
4.6. Transcriptome Analysis
- The reference genome assembly GRCh38.p14 (NCBI RefSeq GCF_000001405.40) was indexed, and RNA-seq data were aligned using STAR (v. 2.7.11). Gene expression levels were obtained using HTSeq (v. 2.0.5).
- Differential expression analysis was performed using DESEQ2 (v. 1.44.0). For further analysis, only genes with adjusted significance level p < 0.05 and |log2FoldChange| > 1 were selected.
4.7. RT-qPCR
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Thakkar, J.P.; Dolecek, T.A.; Horbinski, C.; Ostrom, Q.T.; Lightner, D.D.; Barnholtz-Sloan, J.S.; Villano, J.L. Epidemiologic and Molecular Prognostic Review of Glioblastoma. Cancer Epidemiol. Biomark. Prev. 2014, 23, 1985–1996. [Google Scholar] [CrossRef] [PubMed]
- Louis, D.N.; Perry, A.; Wesseling, P.; Brat, D.J.; Cree, I.A.; Figarella-Branger, D.; Hawkins, C.; Ng, H.K.; Pfister, S.M.; Reifenberger, G.; et al. The 2021 WHO Classification of Tumors of the Central Nervous System: A summary. Neuro-Oncology 2021, 23, 1231–1251. [Google Scholar] [CrossRef] [PubMed]
- Ostrom, Q.T.; Cioffi, G.; Gittleman, H.; Patil, N.; Waite, K.; Kruchko, C.; Barnholtz-Sloan, J.S. CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2012–2016. Neuro-Oncology 2019, 21, v1–v100. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.; Chen, C.; Zhang, Y.; Xu, J. Recent incidence trend of elderly patients with glioblastoma in the United States, 2000–2017. BMC Cancer 2021, 21, 54. [Google Scholar] [CrossRef]
- Shukla, G.; Alexander, G.S.; Bakas, S.; Nikam, R.; Talekar, K.; Palmer, J.D.; Shi, W. Advanced magnetic resonance imaging in glioblastoma: A review. Chin. Clin. Oncol. 2017, 6, 40. [Google Scholar] [CrossRef]
- Stupp, R.; Stupp, R.; Mason, W.P.; van den Bent, M.J.; Weller, M.; Fisher, B.; Taphoorn, M.J.B.; Belanger, K.; Brandes, A.A.; Marosi, C.; et al. Radiotherapy plus Concomitant and Adjuvant Temozolomide for Glioblastoma. N. Engl. J. Med. 2005, 352, 987–996. [Google Scholar] [CrossRef]
- Stupp, R.; Hegi, M.E.; Mason, W.P.; van den Bent, M.J.; Taphoorn, M.J.; Janzer, R.C.; Ludwin, S.K.; Allgeier, A.; Fisher, B.; Belanger, K.; et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol. 2009, 10, 459–466. [Google Scholar] [CrossRef]
- Rapp, M.; Baernreuther, J.; Turowski, B.; Steiger, H.-J.; Sabel, M.; Kamp, M.A. Recurrence Pattern Analysis of Primary Glioblastoma. World Neurosurg. 2017, 103, 733–740. [Google Scholar] [CrossRef]
- Jiang, H.; Yu, K.; Li, M.; Cui, Y.; Ren, X.; Yang, C.; Zhao, X.; Lin, S. Classification of Progression Patterns in Glioblastoma: Analysis of Predictive Factors and Clinical Implications. Front. Oncol. 2020, 10, 590648. [Google Scholar] [CrossRef]
- Johnson, B.E.; Mazor, T.; Hong, C.; Barnes, M.; Aihara, K.; McLean, C.Y.; Fouse, S.D.; Yamamoto, S.; Ueda, H.; Tatsuno, K.; et al. Mutational Analysis Reveals the Origin and Therapy-Driven Evolution of Recurrent Glioma. Science 2014, 343, 189–193. [Google Scholar] [CrossRef]
- Darmanis, S.; Sloan, S.A.; Croote, D.; Mignardi, M.; Chernikova, S.; Samghababi, P.; Zhang, Y.; Neff, N.; Kowarsky, M.; Caneda, C.; et al. Single-Cell RNA-Seq Analysis of Infiltrating Neoplastic Cells at the Migrating Front of Human Glioblastoma. Cell Rep. 2017, 21, 1399–1410. [Google Scholar] [CrossRef] [PubMed]
- Mehta, M.; Wen, P.; Nishikawa, R.; Reardon, D.; Peters, K. Critical review of the addition of tumor treating fields (TTFields) to the existing standard of care for newly diagnosed glioblastoma patients. Crit. Rev. Oncol. Hematol. 2017, 111, 60–65. [Google Scholar] [CrossRef] [PubMed]
- Burri, S.H.; Gondi, V.; Brown, P.D.; Mehta, M.P. The Evolving Role of Tumor Treating Fields in Managing Glioblastoma. Am. J. Clin. Oncol. 2018, 41, 191–196. [Google Scholar] [CrossRef] [PubMed]
- Pandey, M.; Xiu, J.; Mittal, S.; Zeng, J.; Saul, M.; Kesari, S.; Azadi, A.; Newton, H.; Deniz, K.; Ladner, K.; et al. Molecular alterations associated with improved outcome in patients with glioblastoma treated with Tumor-Treating Fields. Neuro-Oncol. Adv. 2022, 4, vdac096. [Google Scholar] [CrossRef]
- Binder, D.C.; Davis, A.A.; Wainwright, D.A. Immunotherapy for cancer in the central nervous system: Current and future directions. Oncoimmunology 2016, 5, e1082027. [Google Scholar] [CrossRef]
- Xiong, Z.; Raphael, I.; Olin, M.; Okada, H.; Li, X.; Kohanbash, G. Glioblastoma vaccines: Past, present, and opportunities. EBioMedicine 2024, 100, 104963. [Google Scholar] [CrossRef]
- Le Rhun, E.; Preusser, M.; Roth, P.; Reardon, D.A.; van den Bent, M.; Wen, P.; Reifenberger, G.; Weller, M. Molecular targeted therapy of glioblastoma. Cancer Treat. Rev. 2019, 80, 101896. [Google Scholar] [CrossRef]
- Davis, M. Glioblastoma: Overview of Disease and Treatment. Clin. J. Oncol. Nurs. 2016, 20, S2–S8. [Google Scholar] [CrossRef]
- Mayer, G. The Chemical Biology of Aptamers. Angew. Chem. Int. Ed. 2009, 48, 2672–2689. [Google Scholar] [CrossRef]
- Gelinas, A.D.; Davies, D.R.; Janjic, N. Embracing proteins: Structural themes in aptamer–protein complexes. Curr. Opin. Struct. Biol. 2016, 36, 122–132. [Google Scholar] [CrossRef]
- Gold, L. Oligonucleotides as Research, Diagnostic, and Therapeutic Agents. J. Biol. Chem. 1995, 270, 13581–13584. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Rossi, J. Aptamers as targeted therapeutics: Current potential and challenges. Nat. Rev. Drug Discov. 2017, 16, 181–202. [Google Scholar] [CrossRef] [PubMed]
- Tan, S.Y.; Acquah, C.; Sidhu, A.; Ongkudon, C.M.; Yon, L.S.; Danquah, M.K. SELEX Modifications and Bioanalytical Techniques for Aptamer–Target Binding Characterization. Crit. Rev. Anal. Chem. 2016, 46, 521–537. [Google Scholar] [CrossRef] [PubMed]
- Kuwahara, M.; Sugimoto, N. Molecular Evolution of Functional Nucleic Acids with Chemical Modifications. Molecules 2010, 15, 5423–5444. [Google Scholar] [CrossRef]
- Lin, Y.; Qiu, Q.; Gill, S.C.; Jayasena, S.D. Modified RNA sequence pools for in vitro selection. Nucleic Acids Res. 1994, 22, 5229–5234. [Google Scholar] [CrossRef]
- Burmeister, P.E.; Lewis, S.D.; Silva, R.F.; Preiss, J.R.; Horwitz, L.R.; Pendergrast, P.S.; McCauley, T.G.; Kurz, J.C.; Epstein, D.M.; Wilson, C.; et al. Direct In Vitro Selection of a 2′-O-Methyl Aptamer to VEGF. Chem. Biol. 2005, 12, 25–33. [Google Scholar] [CrossRef]
- Lan, J.; Li, L.; Liu, Y.; Yan, L.; Li, C.; Chen, J.; Chen, X. Upconversion luminescence assay for the detection of the vascular endothelial growth factor, a biomarker for breast cancer. Microchim. Acta 2016, 183, 3201–3208. [Google Scholar] [CrossRef]
- Sett, A.; Borthakur, B.B.; Sharma, J.D.; Kataki, A.C.; Bora, U. DNA aptamer probes for detection of estrogen receptor α positive carcinomas. Transl. Res. 2017, 183, 104–120. [Google Scholar] [CrossRef]
- Wu, J.; Wang, C.; Li, X.; Song, Y.; Wang, W.; Li, C.; Hu, J.; Zhu, Z.; Li, J.; Zhang, W.; et al. Identification, Characterization and Application of a G-Quadruplex Structured DNA Aptamer against Cancer Biomarker Protein Anterior Gradient Homolog 2. PLoS ONE 2012, 7, e46393. [Google Scholar] [CrossRef]
- Dougherty, C.; Cai, W.; Hong, H. Applications of Aptamers in Targeted Imaging: State of the Art. Curr. Top. Med. Chem. 2015, 15, 1138–1152. [Google Scholar] [CrossRef]
- He, J.; Duan, Q.; Ran, C.; Fu, T.; Liu, Y.; Tan, W. Recent progress of aptamer‒drug conjugates in cancer therapy. Acta Pharm. Sin. B 2023, 13, 1358–1370. [Google Scholar] [CrossRef] [PubMed]
- Mahmoudian, F.; Ahmari, A.; Shabani, S.; Sadeghi, B.; Fahimirad, S.; Fattahi, F. Aptamers as an approach to targeted cancer therapy. Cancer Cell Int. 2024, 24, 108. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Lin, J.S. The application of aptamer in apoptosis. Biochimie 2017, 132, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Liang, H.; Tan, Y.; Yuan, C.; Li, S.; Li, X.; Li, G.; Shi, Y.; Zhang, X. Cell-SELEX Aptamer for Highly Specific Radionuclide Molecular Imaging of Glioblastoma In Vivo. PLoS ONE 2014, 9, e90752. [Google Scholar] [CrossRef]
- Tzahar, E.; Waterman, H.; Chen, X.; Levkowitz, G.; Karunagaran, D.; Lavi, S.; Ratzkin, B.J.; Yarden, Y. A Hierarchical Network of Interreceptor Interactions Determines Signal Transduction by Neu Differentiation Factor/Neuregulin and Epidermal Growth Factor. Mol. Cell. Biol. 1996, 16, 5276–5287. [Google Scholar] [CrossRef]
- Weingaertner, I.R.; Koutnik, S.; Ammer, H. Chronic Morphine Treatment Attenuates Cell Growth of Human BT474 Breast Cancer Cells by Rearrangement of the ErbB Signalling Network. PLoS ONE 2013, 8, e53510. [Google Scholar] [CrossRef]
- Brennan, C.W.; Verhaak, R.G.W.; McKenna, A.; Campos, B.; Noushmehr, H.; Salama, S.R.; Zheng, S.; Chakravarty, D.; Sanborn, J.Z.; Berman, S.H.; et al. The Somatic Genomic Landscape of Glioblastoma. Cell 2013, 155, 462–477. [Google Scholar] [CrossRef]
- Gan, H.K.; Cvrljevic, A.N.; Johns, T.G. The epidermal growth factor receptor variant III (EGFR v III): Where wild things are altered. FEBS J. 2013, 280, 5350–5370. [Google Scholar] [CrossRef]
- Emlet, D.R.; Gupta, P.; Holgado-Madruga, M.; Del Vecchio, C.A.; Mitra, S.S.; Han, S.-Y.; Li, G.; Jensen, K.C.; Vogel, H.; Xu, L.W.; et al. Targeting a Glioblastoma Cancer Stem-Cell Population Defined by EGF Receptor Variant III. Cancer Res. 2014, 74, 1238–1249. [Google Scholar] [CrossRef]
- Moscatello, D.K.; Holgado-Madruga, M.; Godwin, A.K.; Ramirez, G.; Gunn, G.; Zoltick, P.W.; Biegel, J.A.; Hayes, R.L.; Wong, A.J. Frequent expression of a mutant epidermal growth factor receptor in multiple human tumors. Cancer Res. 1995, 55, 5536–5539. [Google Scholar]
- Zhang, X.; Peng, L.; Liang, Z.; Kou, Z.; Chen, Y.; Shi, G.; Li, X.; Liang, Y.; Wang, F.; Shi, Y. Effects of Aptamer to U87-EGFRvIII Cells on the Proliferation, Radiosensitivity, and Radiotherapy of Glioblastoma Cells. Mol. Ther. Nucleic Acids 2018, 10, 438–449. [Google Scholar] [CrossRef] [PubMed]
- Lorenz, R.; Bernhart, S.H.; Höner zu Siederdissen, C.; Tafer, H.; Flamm, C.; Stadler, P.F.; Hofacker, I.L. ViennaRNA Package 2.0. Algorithms Mol. Biol. 2011, 6, 26. [Google Scholar] [CrossRef] [PubMed]
- Mathews, D.H.; Disney, M.D.; Childs, J.L.; Schroeder, S.J.; Zuker, M.; Turner, D.H. Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proc. Natl. Acad. Sci. USA 2004, 101, 7287–7292. [Google Scholar] [CrossRef] [PubMed]
- Kluyver, T.; Ragan-Kelley, B.; Pérez, F.; Granger, B.; Bussonnier, M. Jupyter Notebooks—A publishing format for reproducible computational workflows. In Positioning and Power in Academic Publishing: Players, Agents and Agendas; IOS Press: Amsterdam, The Netherlands, 2016; pp. 87–90. [Google Scholar]
- Hofacker, I.L.; Fontana, W.; Stadler, P.F.; Bonhoeffer, L.S.; Tacker, M.; Schuster, P. Fast folding and comparison of RNA secondary structures. Monatshefte Chem. 1994, 125, 167–188. [Google Scholar] [CrossRef]
- Ivani, I.; Dans, P.D.; Noy, A.; Pérez, A.; Faustino, I.; Hospital, A.; Walther, J.; Andrio, P.; Goñi, R.; Balaceanu, A.; et al. Parmbsc1: A refined force field for DNA simulations. Nat. Methods 2016, 13, 55–58. [Google Scholar] [CrossRef]
- Oda, K.; Matsuoka, Y.; Funahashi, A.; Kitano, H. A comprehensive pathway map of epidermal growth factor receptor signaling. Mol. Syst. Biol. 2005, 1, 2005.0010. [Google Scholar] [CrossRef]
- Amero, P.; Khatua, S.; Rodriguez-Aguayo, C.; Lopez-Berestein, G. Aptamers: Novel Therapeutics and Potential Role in Neuro-Oncology. Cancers 2020, 12, 2889. [Google Scholar] [CrossRef]
- Yalamarty, S.S.K.; Filipczak, N.; Li, X.; Subhan, M.A.; Parveen, F.; Ataide, J.A.; Rajmalani, B.A.; Torchilin, V.P. Mechanisms of Resistance and Current Treatment Options for Glioblastoma Multiforme (GBM). Cancers 2023, 15, 2116. [Google Scholar] [CrossRef]
- Choi, J.-W.; Seo, M.; Kim, K.; Kim, A.-R.; Lee, H.; Kim, H.-S.; Park, C.G.; Cho, S.W.; Kang, J.H.; Joo, J.; et al. Aptamer Nanoconstructs Crossing Human Blood–Brain Barrier Discovered via Microphysiological System-Based SELEX Technology. ACS Nano 2023, 17, 8153–8166. [Google Scholar] [CrossRef]
- Stepina, N.G.; Kravchenko, A.S.; Onishchenko, T.E.; Shlifer, R.N.; Cheaureli, E.P. Clinical characteristics of reactions of children to measles vaccination and course of measles in vaccinated children. Tr. Leningr. Nauchnoissled. Inst. Epidemiol. Mikrobiol. 1965, 28, 230–234. [Google Scholar]
- Heimberger, A.B.; Suki, D.; Yang, D.; Shi, W.; Aldape, K. The natural history of EGFR and EGFRvIII in glioblastoma patients. J. Transl. Med. 2005, 3, 38. [Google Scholar] [CrossRef] [PubMed]
- Dzarieva, F.M.; Shamadykova, D.V.; Sluchanko, O.V.; Pavlova, S.A.; Fab, L.V.; Ryabova, A.V.; Panteleev, D.Y.; Kopylov, A.M.; Usachev, D.Y.; Golovin, A.V.; et al. Specificity of Aptamers U2 and Gol1 to EGFR-Positive Human Glioblastoma Cells in Vitro. Neurosci. Behav. Physiol. 2024, 54, 912–922. [Google Scholar] [CrossRef]
- Xiong, Y.; Hannon, G.J.; Zhang, H.; Casso, D.; Kobayashi, R.; Beach, D. p21 is a universal inhibitor of cyclin kinases. Nature 1993, 366, 701–704. [Google Scholar] [CrossRef] [PubMed]
- Abbas, T.; Dutta, A. p21 in cancer: Intricate networks and multiple activities. Nat. Rev. Cancer 2009, 9, 400–414. [Google Scholar] [CrossRef]
- Kreis, N.-N.; Louwen, F.; Yuan, J. Less understood issues: p21Cip1 in mitosis and its therapeutic potential. Oncogene 2015, 34, 1758–1767. [Google Scholar] [CrossRef]
- Kreis, N.-N.; Friemel, A.; Zimmer, B.; Roth, S.; Rieger, M.A.; Rolle, U.; Louwen, F.; Yuan, J. Mitotic p21Cip1/CDKN1A is regulated by cyclin-dependent kinase 1 phosphorylation. Oncotarget 2016, 7, 50215–50228. [Google Scholar] [CrossRef]
- Engeland, K. Cell cycle arrest through indirect transcriptional repression by p53: I have a DREAM. Cell Death Differ. 2018, 25, 114–132. [Google Scholar] [CrossRef]
- Ferrándiz, N.; Caraballo, J.M.; García-Gutierrez, L.; Devgan, V.; Rodriguez-Paredes, M.; Lafita, M.C.; Bretones, G.; Quintanilla, A.; Muñoz-Alonso, M.J.; Blanco, R.; et al. p21 as a Transcriptional Co-Repressor of S-Phase and Mitotic Control Genes. PLoS ONE 2012, 7, e37759. [Google Scholar] [CrossRef]
- Wade Harper, J. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 1993, 75, 805–816. [Google Scholar] [CrossRef]
- Waga, S.; Hannon, G.J.; Beach, D.; Stillman, B. The p21 inhibitor of cyclin-dependent kinases controls DNA replication by interaction with PCNA. Nature 1994, 369, 574–578. [Google Scholar] [CrossRef]
- Wilson, E.M.; Rotwein, P. Selective Control of Skeletal Muscle Differentiation by Akt1. J. Biol. Chem. 2007, 282, 5106–5110. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.-J.; Hwang, J.; Jeong, H.-J.; Yoo, M.; Go, G.-Y.; Lee, J.-R.; Leem, Y.-E.; Park, J.W.; Seo, D.-W.; Kim, Y.K.; et al. PKN2 and Cdo interact to activate AKT and promote myoblast differentiation. Cell Death Dis. 2016, 7, e2431. [Google Scholar] [CrossRef] [PubMed]
- Koh, H.; Lee, K.H.; Kim, D.; Kim, S.; Kim, J.W.; Chung, J. Inhibition of Akt and Its Anti-apoptotic Activities by Tumor Necrosis Factor-induced Protein Kinase C-related Kinase 2 (PRK2) Cleavage. J. Biol. Chem. 2000, 275, 34451–34458. [Google Scholar] [CrossRef] [PubMed]
- Eisele, G.; Weller, M. Targeting apoptosis pathways in glioblastoma. Cancer Lett. 2013, 332, 335–345. [Google Scholar] [CrossRef] [PubMed]
- Kouri, F.M.; Jensen, S.A.; Stegh, A.H. The Role of Bcl-2 Family Proteins in Therapy Responses of Malignant Astrocytic Gliomas: Bcl2L12 and Beyond. Sci. World J. 2012, 2012, 838916. [Google Scholar] [CrossRef]
- Nasir, O.; Wang, K.; Föller, M.; Gu, S.; Bhandaru, M.; Ackermann, T.F.; Boini, K.M.; Mack, A.; Klingel, K.; Amato, R.; et al. Relative resistance of SGK1 knockout mice against chemical carcinogenesis. IUBMB Life 2009, 61, 768–776. [Google Scholar] [CrossRef]
- Sun, T.; Xu, Y.; Jiang, S.; Xu, Z.; Cao, B.; Sethi, G.; Zeng, Y.; Kong, Y.; Mao, X. Suppression of the USP10/CCND1 axis induces glioblastoma cell apoptosis. Acta Pharmacol. Sin. 2021, 42, 1338–1346. [Google Scholar] [CrossRef]
- Kulkarni, S.; Goel-Bhattacharya, S.; Sengupta, S.; Cochran, B.H. A Large-Scale RNAi Screen Identifies SGK1 as a Key Survival Kinase for GBM Stem Cells. Mol. Cancer Res. 2018, 16, 103–114. [Google Scholar] [CrossRef]
- Chen, W.; Zebaze, L.N.; Dong, J.; Chézeau, L.; Inquimbert, P.; Hugel, S.; Niu, S.; Bihel, F.; Boutant, E.; Réal, E.; et al. WNK1 kinase and its partners Akt, SGK1 and NBC-family Na+/HCO3− cotransporters are potential therapeutic targets for glioblastoma stem-like cells linked to Bisacodyl signaling. Oncotarget 2018, 9, 27197–27219. [Google Scholar] [CrossRef]
- Lei, X.; Ma, N.; Du, L.; Liang, Y.; Zhang, P.; Han, Y.; Qu, B. PP2A and tumor radiotherapy. Hereditas 2020, 157, 36. [Google Scholar] [CrossRef]
- Tomiyama, A.; Kobayashi, T.; Mori, K.; Ichimura, K. Protein Phosphatases—A Touchy Enemy in the Battle Against Glioblastomas: A Review. Cancers 2019, 11, 241. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Xiao, A.; Floyd, D.; Olmez, I.; Lee, J.; Godlewski, J.; Bronisz, A.; Bhat, K.P.L.; Sulman, E.P.; Nakano, I.; et al. CDK4/6 inhibition is more active against the glioblastoma proneural subtype. Oncotarget 2017, 8, 55319–55331. [Google Scholar] [CrossRef] [PubMed]
- Taylor-Harding, B.; Aspuria, P.-J.; Agadjanian, H.; Cheon, D.-J.; Mizuno, T.; Greenberg, D.; Allen, J.R.; Spurka, L.; Funari, V.; Spiteri, E.; et al. Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS. Oncotarget 2015, 6, 696–714. [Google Scholar] [CrossRef] [PubMed]
- Mahzouni, P.; Taheri, F. An Immunohistochemical Study of Cyclin D1 Expression in Astrocytic Tumors and its Correlation with Tumor Grade. Iran. J. Pathol. 2019, 14, 252–257. [Google Scholar] [CrossRef]
- Zhang, D.; Dai, D.; Zhou, M.; Li, Z.; Wang, C.; Lu, Y.; Li, Y.; Wang, J. Inhibition of Cyclin D1 Expression in Human Glioblastoma Cells is Associated with Increased Temozolomide Chemosensitivity. Cell. Physiol. Biochem. 2018, 51, 2496–2508. [Google Scholar] [CrossRef]
- Richardson, H.E.; O’Keefe, L.V.; Reed, S.I.; Saint, R. A Drosophila G1-specific cyclin E homolog exhibits different modes of expression during embryogenesis. Development 1993, 119, 673–690. [Google Scholar] [CrossRef]
- Keck, J.M.; Summers, M.K.; Tedesco, D.; Ekholm-Reed, S.; Chuang, L.-C.; Jackson, P.K.; Reed, S.I. Cyclin E overexpression impairs progression through mitosis by inhibiting APCCdh1. J. Cell Biol. 2007, 178, 371–385. [Google Scholar] [CrossRef]
- Park, E.A.; MacAlpine, D.M.; Orr-Weaver, T.L. Drosophila follicle cell amplicons as models for metazoan DNA replication: A cyclinE mutant exhibits increased replication fork elongation. Proc. Natl. Acad. Sci. USA 2007, 104, 16739–16746. [Google Scholar] [CrossRef]
- Alexandrow, M.G.; Hamlin, J.L. Chromatin decondensation in S-phase involves recruitment of Cdk2 by Cdc45 and histone H1 phosphorylation. J. Cell Biol. 2005, 168, 875–886. [Google Scholar] [CrossRef]
- Biedermann, B.; Wright, J.; Senften, M.; Kalchhauser, I.; Sarathy, G.; Lee, M.-H.; Ciosk, R. Translational Repression of Cyclin E Prevents Precocious Mitosis and Embryonic Gene Activation during C. elegans Meiosis. Dev. Cell 2009, 17, 355–364. [Google Scholar] [CrossRef]
- Pereira, B.J.A.; Santana Júnior, P.A.d.; de Almeida, A.N.; Cavalcante, S.G.; de Melo, K.C.M.; de Aguiar, P.H.P.; Paiva, W. da S.; Oba-Shinjo, S.M.; Marie, S.K.N. Cyclin E1 expression and malignancy in meningiomas. Clin. Neurol. Neurosurg. 2020, 190, 105647. [Google Scholar] [CrossRef] [PubMed]
- Liang, H.; Chen, Z.; Sun, L. Inhibition of cyclin E1 overcomes temozolomide resistance in glioblastoma by Mcl-1 degradation. Mol. Carcinog. 2019, 58, 1502–1511. [Google Scholar] [CrossRef] [PubMed]
- Frenzel, A.; Grespi, F.; Chmelewskij, W.; Villunger, A. Bcl2 family proteins in carcinogenesis and the treatment of cancer. Apoptosis 2009, 14, 584–596. [Google Scholar] [CrossRef] [PubMed]
- McDonald, F.E.; Ironside, J.W.; Gregor, A.; Wyatt, B.; Stewart, M.; Rye, R.; Adams, J.; Potts, H.W.W. The prognostic influence of bcl-2 in malignant glioma. Br. J. Cancer 2002, 86, 1899–1904. [Google Scholar] [CrossRef]
- Scheffold, A.; Jebaraj, B.M.C.; Stilgenbauer, S. Venetoclax: Targeting BCL2 in Hematological Cancers. In Small Molecules in Hematology. Recent Results in Cancer Research; Springer: Cham, Switzerland, 2018; pp. 215–242. [Google Scholar]
- Zhang, Y.; Ishida, C.T.; Shu, C.; Kleiner, G.; Sanchez-Quintero, M.J.; Bianchetti, E.; Quinzii, C.M.; Westhoff, M.-A.; Karpel-Massler, G.; Siegelin, M.D. Inhibition of Bcl-2/Bcl-xL and c-MET causes synthetic lethality in model systems of glioblastoma. Sci. Rep. 2018, 8, 7373. [Google Scholar] [CrossRef]
- Sahoo, S.; Brickley, D.R.; Kocherginsky, M.; Conzen, S.D. Coordinate expression of the PI3-kinase downstream effectors serum and glucocorticoid-induced kinase (SGK-1) and Akt-1 in human breast cancer. Eur. J. Cancer 2005, 41, 2754–2759. [Google Scholar] [CrossRef]
- Lang, F.; Böhmer, C.; Palmada, M.; Seebohm, G.; Strutz-Seebohm, N.; Vallon, V. (Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms. Physiol. Rev. 2006, 86, 1151–1178. [Google Scholar] [CrossRef]
- Talarico, C.; Dattilo, V.; D’Antona, L.; Menniti, M.; Bianco, C.; Ortuso, F.; Alcaro, S.; Schenone, S.; Perrotti, N.; Amato, R. SGK1, the New Player in the Game of Resistance: Chemo-Radio Molecular Target and Strategy for Inhibition. Cell. Physiol. Biochem. 2016, 39, 1863–1876. [Google Scholar] [CrossRef]
- Zhu, R.; Yang, G.; Cao, Z.; Shen, K.; Zheng, L.; Xiao, J.; You, L.; Zhang, T. The prospect of serum and glucocorticoid-inducible kinase 1 (SGK1) in cancer therapy: A rising star. Ther. Adv. Med. Oncol. 2020, 12, 1758835920940946. [Google Scholar] [CrossRef]
- Zhou, C.; Xiao, W.; Jiang, T.; Guo, Z.; Li, M.; Chang, H.; Wu, Y.; Chen, M.; Shi, M.; Xu, W.; et al. Targeting SGK1 enhances the efficacy of radiotherapy in locally advanced rectal cancer. Biomed. Pharmacother. 2020, 125, 109954. [Google Scholar] [CrossRef]
- Bai, J.A.; Xu, G.F.; Yan, L.J.; Zeng, W.W.; Ji, Q.Q.; Wu, J.D.; Tang, Q.Y. SGK1 inhibits cellular apoptosis and promotes proliferation via the MEK/ERK/p53 pathway in colitis. World J. Gastroenterol. 2015, 21, 6180. [Google Scholar] [CrossRef] [PubMed]
- Abbruzzese, C.; Catalogna, G.; Gallo, E.; di Martino, S.; Mileo, A.M.; Carosi, M.; Dattilo, V.; Schenone, S.; Musumeci, F.; Lavia, P.; et al. The small molecule SI113 synergizes with mitotic spindle poisons in arresting the growth of human glioblastoma multiforme. Oncotarget 2017, 8, 110743–110755. [Google Scholar] [CrossRef] [PubMed]
- Hwang, J.-H.; Joo, J.C.; Kim, D.J.; Jo, E.; Yoo, H.-S.; Lee, K.-B.; Park, S.J.; Jang, I.-S. Cordycepin promotes apoptosis by modulating the ERK-JNK signaling pathway via DUSP5 in renal cancer cells. Am. J. Cancer Res. 2016, 6, 1758–1771. [Google Scholar] [PubMed]
- Wang, R.; Bao, H.; Du, W.; Chen, X.; Liu, H.; Han, D.; Wang, L.; Wu, J.; Wang, C.; Yang, M.; et al. P68 RNA helicase promotes invasion of glioma cells through negatively regulating DUSP5. Cancer Sci. 2019, 110, 107–117. [Google Scholar] [CrossRef]
- Tsai, S.-F.; Tao, M.; Ho, L.-I.; Chiou, T.-W.; Lin, S.-Z.; Su, H.-L.; Harn, H.-J. Isochaihulactone-induced DDIT3 causes ER stress-PERK independent apoptosis in glioblastoma multiforme cells. Oncotarget 2017, 8, 4051–4061. [Google Scholar] [CrossRef]
- Graham, S.M.; Oldham, S.M.; Martin, C.B.; Drugan, J.K.; Zohn, I.E.; Campbell, S.; Der, C.J. TC21 and Ras share indistinguishable transforming and differentiating activities. Oncogene 1999, 18, 2107–2116. [Google Scholar] [CrossRef]
- Huang, Y.; Saez, R.; Chao, L.; Santos, E.; Aaronson, S.A.; Chan, A.M. A novel insertional mutation in the TC21 gene activates its transforming activity in a human leiomyosarcoma cell line. Oncogene 1995, 11, 1255–1260. [Google Scholar]
- Gutierrez-Erlandsson, S.; Herrero-Vidal, P.; Fernandez-Alfara, M.; Hernandez-Garcia, S.; Gonzalo-Flores, S.; Mudarra-Rubio, A.; Fresno, M.; Cubelos, B. R-RAS2 overexpression in tumors of the human central nervous system. Mol. Cancer 2013, 12, 127. [Google Scholar] [CrossRef]
- Hammer, S.; Wang, W.; Will, S.; Ponty, Y. Fixed-parameter tractable sampling for RNA design with multiple target structures. BMC Bioinform. 2019, 20, 209. [Google Scholar] [CrossRef]
- Hammer, S.; Tschiatschek, B.; Flamm, C.; Hofacker, I.L.; Findeiß, S. RNAblueprint: Flexible multiple target nucleic acid sequence design. Bioinformatics 2017, 33, 2850–2858. [Google Scholar] [CrossRef]
- Darty, K.; Denise, A.; Ponty, Y. VARNA: Interactive drawing and editing of the RNA secondary structure. Bioinformatics 2009, 25, 1974–1975. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Feng, C.; Han, R.; Wang, Z.; Ye, L.; Du, Z.; Wei, H.; Zhang, F.; Peng, Z.; Yang, J. trRosettaRNA: Automated prediction of RNA 3D structure with transformer network. Nat. Commun. 2023, 14, 7266. [Google Scholar] [CrossRef] [PubMed]
- Bussi, G.; Donadio, D.; Parrinello, M. Canonical sampling through velocity rescaling. J. Chem. Phys. 2007, 126, 014101. [Google Scholar] [CrossRef] [PubMed]
- Berendsen, H.J.C.; Postma, J.P.M.; van Gunsteren, W.F.; DiNola, A.; Haak, J.R. Molecular dynamics with coupling to an external bath. J. Chem. Phys. 1984, 81, 3684–3690. [Google Scholar] [CrossRef]
- Darden, T.; York, D.; Pedersen, L. Particle mesh Ewald: An N·log(N) method for Ewald sums in large systems. J. Chem. Phys. 1993, 98, 10089–10092. [Google Scholar] [CrossRef]
- Jorgensen, W.L.; Chandrasekhar, J.; Madura, J.D.; Impey, R.W.; Klein, M.L. Comparison of simple potential functions for simulating liquid water. J. Chem. Phys. 1983, 79, 926–935. [Google Scholar] [CrossRef]
Gene | Forward Primer 5′-3′ | Reverse Primer 5′-3′ |
---|---|---|
EGFRwt | GCTCTGGAGGAAAAGAAAGTTTGC | TTCCCAAGGACCACCTCACA |
EGFRvIII | GCTCTGGAGGAAAAGAAAGGTAAT | TTCCGTTACACACTTTGCGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Golovin, A.; Dzarieva, F.; Rubetskaya, K.; Shamadykova, D.; Usachev, D.; Pavlova, G.; Kopylov, A. In Silico Born Designed Anti-EGFR Aptamer Gol1 Has Anti-Proliferative Potential for Patient Glioblastoma Cells. Int. J. Mol. Sci. 2025, 26, 1072. https://doi.org/10.3390/ijms26031072
Golovin A, Dzarieva F, Rubetskaya K, Shamadykova D, Usachev D, Pavlova G, Kopylov A. In Silico Born Designed Anti-EGFR Aptamer Gol1 Has Anti-Proliferative Potential for Patient Glioblastoma Cells. International Journal of Molecular Sciences. 2025; 26(3):1072. https://doi.org/10.3390/ijms26031072
Chicago/Turabian StyleGolovin, Andrey, Fatima Dzarieva, Ksenia Rubetskaya, Dzhirgala Shamadykova, Dmitry Usachev, Galina Pavlova, and Alexey Kopylov. 2025. "In Silico Born Designed Anti-EGFR Aptamer Gol1 Has Anti-Proliferative Potential for Patient Glioblastoma Cells" International Journal of Molecular Sciences 26, no. 3: 1072. https://doi.org/10.3390/ijms26031072
APA StyleGolovin, A., Dzarieva, F., Rubetskaya, K., Shamadykova, D., Usachev, D., Pavlova, G., & Kopylov, A. (2025). In Silico Born Designed Anti-EGFR Aptamer Gol1 Has Anti-Proliferative Potential for Patient Glioblastoma Cells. International Journal of Molecular Sciences, 26(3), 1072. https://doi.org/10.3390/ijms26031072