Next Article in Journal
Constructing a Prognostic Model for Clear Cell Renal Cell Carcinoma Based on Glycosyltransferase Gene and Verification of Key Gene Identification
Previous Article in Journal
Navigating the Effects of Anti-Atherosclerotic Supplements and Acknowledging Associated Bleeding Risks
Previous Article in Special Issue
C. elegans Cytoplasmic Isocitrate Dehydrogenase Neomorphic G98N and R133H Mutants Produce the Oncometabolite 2-Hydroxyglutarate
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 20
10.3390/ijms262010185
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Caenorhabditis elegans sdhb-1(R244H) Model Shows Characteristics of Human PPGL Tumor Cells

by
Fanni Ősz
1,†,
Mahmood Akbar
2,3,†,
Balázs Zoltán Zsidó
4,
Csaba Hetényi
4,5,
Tamás I. Orbán
6,7,
Ábel Fóthi
6,8,
Gábor M. Kovács
9,
Alexandra Pintye
9,10,
Attila Boda
11,
Aamir Nazir
2,3,
Zsolt Farkas
1,‡ and
Krisztina Takács-Vellai
1,*,‡
1
Department of Biological Anthropology, Eötvös Lorand University, H-1117 Budapest, Hungary
2
Academy of Scientific and Innovative Research (AcSIR), Ghaziabad 201002, India
3
Division of Toxicology and Experimental Medicine, CSIR-Central Drug Research Institute, Lucknow 226031, India
4
Pharmacoinformatics Unit, Department of Pharmacology and Pharmacotherapy, Medical School, University of Pécs, H-7624 Pécs, Hungary
5
National Laboratory for Drug Research and Development, H-1117 Budapest, Hungary
6
Gene Regulation Research Group, Institute of Molecular Life Sciences, HUN-REN Research Centre for Natural Sciences, H-1117 Budapest, Hungary
7
Department of Genetics, Cell- and Immunobiology, Semmelweis University, H-1089 Budapest, Hungary
8
Department of Molecular Biology, Semmelweis University, H-1085 Budapest, Hungary
9
Department of Plant Anatomy, Eötvös Lorand University, H-1117 Budapest, Hungary
10
Centre for Agricultural Research, Plant Protection Institute, HUN-REN, H-1116 Budapest, Hungary
11
Department of Anatomy, Cell and Developmental Biology, Eötvös Lorand University, H-1117 Budapest, Hungary
 
add Show full affiliation list
 
remove Hide full affiliation list
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to the work.
‡
These authors contributed equally to the work.
Int. J. Mol. Sci. 2025, 26(20), 10185; https://doi.org/10.3390/ijms262010185
Submission received: 18 August 2025 / Revised: 30 September 2025 / Accepted: 9 October 2025 / Published: 20 October 2025
(This article belongs to the Special Issue C. elegans as a Disease Model: Molecular Perspectives: 2nd Edition)
Browse Figures
Versions Notes

Abstract

Pheochromocytomas and paragangliomas (PPGL) are classified as rare cancers but can be highly metastatic, particularly in individuals with inherited succinate dehydrogenase B (SDHB) mutations. As current therapies and the availability of SDHB-deficient animal models are both limited, we have previously constructed a nematode PPGL model, a transgenic worm carrying the R244H missense mutation equivalent to human R230H in the sdhb-1 gene. In this study, we show that R244H mutants display characteristics of PPGL tumors, such as pseudohypoxia activation and the accumulation of reactive oxygen species. The latter can be the result of compromised antioxidant machinery, as R244H mutants have reduced levels of cytosolic and mitochondrial superoxide dismutase enzymes. In addition, the expression of mitophagy markers pink-1 (PTEN-induced putative kinase) and pdr-1 (E3 ubiquitin-protein ligase parkin) were downregulated in R244H mutants, suggesting impaired mitophagy and reflecting the crucial role of mitochondrial health in PPGL pathology. Treatments by the SDH inhibitor fluopyram revealed that the SDH complex carrying the R244H mutation in subunit B displayed residual SDH activity, which was also confirmed by our structural analyses. We also observed a link between dopaminergic neuronal health and SDHB-1.

1. Introduction

Pheochromocytomas (PHEO) and paragangliomas (PGL) are rare neuroendocrine tumors, which often have a delay in diagnosis [1]. PHEOs arising from the chromaffin cells of the adrenal medulla and PGLs derived from sympathetic and parasympathetic ganglia are now grouped together as PPGLs based on their similar genetic background and histological representation [2]. Although PPGLs are considered as rare cancers [3], they are also reported to have one of the highest degree of heritability out of all malignancies [4]. For example, significant numbers of PPGL patients harbor germ line succinate dehydrogenase subunit B (SDHB) mutations and suffer from a particularly aggressive form of malignant PPGL, for which there is no targeted therapy [5,6]. Furthermore, the absence of SDHB-mutant animal models [7] led us to create a novel Caenorhabditis elegans model carrying the equivalent of the clinically relevant R230H mutation of SDHB (R244H in the worm) [8]. Unlike sdhb-1(-) null mutant worms that display early larval arrest at the L2 stage, R244H worms reach adulthood but display slower development, sterility, and a shorter lifespan. R244H missense mutation results in a number of phenotypes including succinate accumulation, aberrant (Warburg’-like) glycolysis with increased expression of lactate dehydrogenase, decreased oxygen consumption, reduction in ATP production, and reduced mitochondrial number. Interestingly, both the Warburg effect [9] and increased lactate-dehydrogenase A (LDHA) expression have also been found in SDHB-deficient PPGL patients [10]. Our model not only recapitulates metabolic defects, but it is also drug-responsive, as treatment with the lactate-dehydrogenase inhibitor GSK2837808A [8] led to an increased L2/L3 larval arrest resembling the phenotypic appearance of sdhb-1(-) null mutant animals.
Herein we expand our studies, focusing on three areas: Firstly, we investigate the activation of pseudohypoxia and ROS accumulation, which are important hallmarks of PPGL tumors [11,12]. Secondly, with respect to some clinically relevant SDHB point mutants, structural predictions from crystallographic data suggest that the active site of the SDH enzyme is deformed but potentially still active [13]. However, there is no such data available about the human R230H SDHB mutation. Thus, we ask if the complex carrying the R244H mutant B subunit is assembled and if it is, does it retain SDH activity? Lastly, although a mutant copy of the ubiquitous SDHB gene is present in all cells of PPGL patients, it is observed that they develop tumors only in neuroendocrine tissues. This implies some unique functions of SDHB in these tissues. In order to obtain insight into this phenomenon we examined the function of SDHB-1 in the nervous system of the worm, focusing on dopaminergic neurons.

2. Results

2.1. Pseudohypoxia Is Activated Under Normoxic Conditions in sdhb-1(R244H) Mutants

It is believed that in many cancer-linked SDH mutations mitochondrial succinate accumulates in the cytoplasm and activates HIF-1α (hypoxia-inducible factor alpha), which favors pseudohypoxia-driven tumorigenesis through mal-activation of the target genes [11]. Hence, we first analyzed pseudohypoxia in sdhb-1(R244H) mutants. Caenorhabditis elegans displays an evolutionarily conserved hypoxia-responsive system, the HIF-1α homolog hypoxia–inducible factor is encoded by the hif-1 gene [14]. C. elegans HIF-1 is the single functional homolog of mammalian HIFα proteins, serving as the alpha subunit of the heterodimeric hypoxia–inducible factor (HIF) complex in the nematode. The N-terminus of HIF-1 containing the conserved bHLH and PAS domains shows high sequence similarity to the corresponding domains of human HIF-1α and HIF-2α [15]. Under normoxic conditions, C. elegans HIF-1 is regulated in a similar way to its human counterpart HIF-α: HIF-1 is hydroxylated by the prolyl hydroxylase EGL-9 and ubiquitinated by the VHL (von Hippel Lindau) homolog VHL-1, which leads to the proteasomal degradation of HIF-1. In contrast, if hypoxia occurs, HIF-1 remains stable and induces the transcription of the target genes [16]. Our previous transcriptomic and metabolic analyses showed that the HIF-1 target lactate-dehydrogenase ldh-1 gene is only overexpressed in point mutants but not in sdhb-1(gk165) deletional mutants [8]. The null mutants were not examined further because we could not directly compare the point mutant adults with the L2 null mutant. Therefore, we concentrated on the R244H point mutants and measured the expression of several HIF-1 target genes by semi-quantitative RT-PCR in sdhb-1(R244H) mutant background compared with N2 adults (WT). VEGFA (vascular endothelial growth factor A), LDHA (lactate-dehydrogenase A) and NDRG1 (N-myc downstream regulated 1) genes showed elevated expression in human cell line studies in response to HIF-1α activation [17]. We examined the expression of the worm homologs of the above HIF-1α targets and detected elevated mRNA levels of the LDHA homolog ldh-1 (thus, confirming earlier data), the VEGFA homolog pvf-1, and the NDRG1 homolog Y48G10A.3 in sdhb-1(R244H) mutants compared with WT (N2) worms by semi-quantitative PCR (Figure 1A,B). Next, we performed real-time PCR (SYBR Green assay) using the same primers, and egl-9(sa307) mutants as a positive control. The deletion of EGL-9, a negative regulator of HIF-1, results in the constitutive activation of HIF-1, as described above. qPCR experiments confirmed the upregulation of ldh-1 and pvf-1, in both egl-9(sa307) and sdhb-1(R244H) mutants as expected (Figure 1C).
In order to confirm the above qPCR data, we assayed HIF-1 activity by crossing the reporter Pcysl-2::GFP into the sdhb-1(R244H) mutant background. The cysl-2 (cysteine synthase-like) gene is one of the strongest regulated direct targets of HIF-1 [18]. As a positive control, we used egl-9(sa307) and cysl-2::GFP mutants, which are defective in prolyl hydroxylase function; thus, HIF-1 is constitutively active in these mutants and induces strong cysl-2::GFP expression (Figure 2A). We found that cysl-2::GFP is also activated in sdhb-1(R244H) mutants, similar to egl-9(sa307) mutants (Figure 2B).
Together, these results indicate that pseudohypoxia is activated under normoxic conditions in the R244H point mutant SDHB model due to succinate accumulation, just like in PPGL tumor cells.

2.2. Impact of sdhb-1 Null Mutation and R244H Point Mutation on Overall Oxidative Status

Loss-of-function mutations of the SDH complex not only disrupt the proper function of the TCA cycle but also impair the oxidative function of the mitochondrion by damaging the function of the electron transport chain (ETC). Defects of the ETC elevate reactive oxygen species (ROS), a classic byproduct in SDH deficiency, creating carcinogenic effects [19,20] because an excess of ROS damages the structure of macromolecules, e.g., DNA, proteins, and lipids of the cell membrane. Importantly, experiments conducted on model animals and cell cultures also show that mutations in SDH result in increased cellular ROS levels [21,22,23,24,25].
As the sdhb-1 deletion and R244H point mutants have already been reported to show reduced mitochondrial and ATP content [8], in order to delineate the cause of this mitochondrial dysfunction, we examined the level of ROS by employing dihydroethidium (DHE) staining. This dye specifically stains superoxide ions, which are relatively short-lived. Its reaction with superoxide anions results in the formation of ethidium (E+) which binds to DNA and produces enhanced fluorescence [26,27]. The sdhb-1 mutants (both null and point) and wild-type rescued (WTR, please see [8]) worms had no effect on the basal ROS level. However, the level of induced ROS in response to H2O2 treatment was found to be elevated in the cases of both sdhb-1 null and R244H point mutants. In comparison with the wild type, R244H point mutants showed an increment by 0.8773 ± 0.3998 whereas in sdhb-1 null mutants the level of induced ROS was increased by 1.790 ± 0.7266 (Figure 3).
The CellROX method uses a fluorogenic probe for measuring oxidative stress in live cells. This cell-permeant dye exhibits fluorescence upon oxidation by ROS and subsequent binding to mitochondrial DNA. As CellROX is able to detect different types of reactive oxygen species [28], not only superoxide anions, we decided to test R244H mutants by this method. As a result, similar to the data obtained in the PPGL cells, CellROX Green staining on R244H mutant worms also showed significantly increased ROS levels at the basal state (Figure 4).

2.3. Impact of sdhb-1 Null Mutation and R244H Point Mutation on Levels of Antioxidant Enzymes, Mitophagy and Apoptosis Markers

Antioxidant enzymes such as superoxide dismutases (SODs) compensate for excess ROS in healthy cells. To further investigate the inability of point and null mutants in subjugating oxidative insults, we examined the expression levels of sod-1, sod-2, and sod-3 in mutant backgrounds. sod-1 is a cytosolic SOD enzyme, whereas sod-2 and sod-3 are mitochondrial SOD enzymes [29]. In comparison with stage specific wild-type controls, the expression of sod-2 and sod-3 in sdhb-1 null mutant was found to be insignificantly altered, but the expression of sod-1 was significantly downregulated (1.64-fold). Moreover, in R244H point mutants, only sod-1 and sod-2 levels were found to be downregulated (1.87 and 2.07-fold, respectively), which was also observed in rescued worms (Figure 5A). Such downregulation of antioxidant enzymes might be responsible for the reduced tolerance of sdhb-1 mutants against oxidative stress. As defects in the mitophagic process can contribute to the accumulation of dysfunctional mitochondria and oxidative imbalance, we also examined the expression levels of mitophagy markers, PTEN-induced putative kinase (PINK1/PINK-1), and the E3 ubiquitin-protein ligase parkin (PDR-1) under different mutant backgrounds. In order to induce mitophagy, PINK1/PINK-1 accumulates on the outer membrane of defective mitochondria and recruits parkin/PDR-1, which in turn forms polyubiquitin chains and promotes engulfment by autophagosomes [30]. The expression of both pink-1 and pdr-1 was found to be downregulated only in R244H point mutants (2.92 and 2.86 fold, respectively), suggesting impediment of mitophagic process and thereby accumulation of dysfunctional mitochondria and oxidative imbalance (Figure 5B). Since mitochondrial dysfunction leads to apoptosis induction, we also examined the expression of apoptosis markers ced-1 and ced-2, which were not significantly altered under mutant backgrounds (Figure 5C).

2.4. Fluopyram Treatment Selectively Affects the Development of sdhb-1(R244H) Mutants

In our earlier work [8], we showed that the human SDHB R230H mutation causes a conformational change in the B subunit of the SDH complex, which also damages the A–B interface. These structural studies led to the conclusion that the complex carrying the R230H mutation was either inactive or had an altered SDH activity.
To see if the R230H equivalent of the R244H mutation in the worm results in residual SDH activity, we applied SDHB-inhibitor treatment on sdhb-1 mutants. Fluopyram is a worm-selective fungicide, which blocks the ubiquinone binding pocket of SDH at the interface of SDHB and C and D subunits [31]. We treated wild-type and sdhb-1 null and point mutant worms with fluopyram, which caused complete and partial embryonic lethality of all the strains examined at 2.5 μM and 250 nM concentrations, respectively, (also observed in [31]); 25 nM fluopyram treatment did not affect the viability and development of N2 animals and sdhb-1(gk165) null mutants. However, R244H mutants, which normally reach adulthood, showed L2 larval lethality, e.g., null mutant phenotype, in response to 25 nM fluopyram (Figure 6). These data suggest that R244H mutants display a residual SDH activity.

2.5. Binding Mode of Fluopyram to the Wild-Type and Mutant SDH Complex

As experimental validation, the re-docking of flutolanil to the Sus scrofa heart mitochondrial complex II (SDH complex) was successful, the RMSD of the docked binding mode compared with the experimental binding mode was 1.6 Å (Figure 7A). The same methodology was applied for docking fluopyram to the Caenorhabditis elegans mitochondrial complex II.
Fluopyram binds similarly to the Caenorhabditis elegans mitochondrial complex II as flutolanil does to the Sus scrofa heart mitochondrial complex II, to the interface of the B and C chains. Both the proteins and the ligands are structurally similar, which explains the similar binding mode. The R244H mutation at the A/B chain interface did not affect ligand binding at the B/C chain significantly. The binding mode of fluopyram to the wild type and mutant proteins are almost identical. The difference in the binding free energy of flutolanil binding to Sus scrofa heart mitochondrial complex II and fluopyram binding to the wild type and mutant Caenorhabditis elegans mitochondrial complex II is smaller than 0.2 kcal/mol, which is not a significant difference. The amide N of fluopyram interacts with the hydroxyl group of Y1222 (Figure 7B), the pyridine ring interacts with the rings of W1011, and the fluor atoms form hydrophobic interactions with M1012. Thus, the R244H mutant Caenorhabditis elegans mitochondrial complex II can bind to fluopyram, explaining its experimental inhibitory effect, consistent with our proposed residual enzyme activity.

2.6. Expression Pattern of SDHB-1 and DAT-1 Throughout Different Stages of Worm Development

Some patients with SDHB-related PPGL tumors have an excess level of catecholamine secretion; however, the exact role of this excess secretion in tumor progression is not entirely known. In Caenorhabditis elegans four biogenic amines are present: dopamine, serotonin, octopamine, and tyramine. Dopamine—whose receptors and downstream signaling pathways are highly similar to their mammalian counterparts—is an important neurotransmitter responsible for changes in locomotion, behavior, and learning upon changes in the environment [32]. As a first approach to examine the link between dopamine production/secretion and SDHB-1 function in the worm, we attempted to identify dopaminergic neurons, which express SDHB-1 as well. To achieve this goal, we first generated a transgenic strain carrying a psdhb-1::SDHB-1::mCherry construct and crossed this strain with a DAT-1::GFP reporter, which labels dopaminergic neurons specifically (DAT-1 possess dopamine–sodium symporter activity; [33]). We studied the expression of SDHB-1::mCherry and DAT-1::GFP throughout different stages of worm development, i.e., embryos, 48 h, and day 13, by employing confocal microscopy. In comparison with N2, the expression of both DAT-1 and SDHB-1 was distinctly visible and persisted throughout all the studied developmental stages. The expression of DAT-1 remained confined in the dopaminergic neurons, whereas SDHB-1 expression was mainly observed in pharynx, hypodermis, and intestine (Figure 8). At day 13, both N2 and dat-1::gfp x sdhb-1::mCherry strains show intense green signals in the intestine due to accumulation of “age-pigment” or lipofuscin. However, the expression of DAT-1 is distinctly visible in the cephalic region of double transgenic worms.

2.7. Correlating Mitochondrial Dysfunction and Dopaminergic Neurodegeneration in the Context of B Subunit of Succinate Dehydrogenase (SDHB)

In order to study the effect of dopaminergic neuronal damage on SDHB-1 expression, we subjected dat-1::gfp x sdhb-1::mCherry worms to 6-hydroxydopamine (6-OHDA) damage during the early larval stage. 6-OHDA is a neurotoxin that selectively targets dopaminergic neurons by inducing mitochondrial dysfunction and oxidative damage [34]. The exposure to 100 mM 6-OHDA was given at the L3 larval stage, transiently, and was sufficient to cause substantial dopaminergic neuronal damage till the young adult stage (Figure 9A,B). The loss of dopaminergic neurons at the young adult stage was found to significantly lower the expression of SDHB-1 (0.8115 ± 0.2848) as compared with the vehicle control. SDHB-1 has been reported to play an important role in mitochondrial electron transport chain and tricarboxylic acid cycle. Its downregulation upon selective oxidative damage to dopaminergic neurons supports a mechanistic link between mitochondrial dysfunction and dopaminergic neuronal dysfunction.
To further explore the functional consequences, we examined the status of dopamine related neuro-behaviors in sdhb-1 mutants—both null and point mutants (Figure 9C,D). In these mutants, we performed thrashing and a 1-nonanol aversion assay to assess the effect on established dopamine-associated endpoints including locomotion and olfaction, respectively, [35]. The null mutant exhibited significantly impaired dopaminergic functions, evident by a slower thrashing rate and delayed response to the repellent, 1-nonanol. In comparison with age-specific wild-type control, the thrashing rate of sdhb-1 null mutant declined by 8.250 ± 0.8678 thrashes, and the response time was increased by 4.062 ± 0.6190 s. The R244H point mutant only showed olfactory impairment as the response time was slightly increased by 1.345 ± 0.4042 s in comparison with the control, indicating partial retention of SDH activity.

3. Discussion

As there is no definitive therapy for PPGL, model systems are important in both understanding the pathophysiology of the disease and the screening of drug candidates. Since availability of SDHB-deficient animal models is limited, we have previously constructed a transgenic worm carrying the R244H missense mutation in the sdhb-1 gene, which is equivalent to human R230H [8]. In this study, we performed an extensive characterization of the model, firstly by focusing on several hallmarks of PPGL tumor cells, such as the activation of pseudohypoxia and ROS accumulation.
Caenorhabditis elegans displays an evolutionarily conserved hypoxia-responsive system. We examined the expression of several conserved HIF-1 target genes in R244H mutants by semi-quantitative and quantitative PCR and found elevated expressions of the VEGFA homolog pvf-1 and the LDHA homolog ldh-1 with both methods, while the NDRG1 homolog Y48G10A.3 gene showed elevated mRNA level by semi-quantitative PCR. A seminal paper has recently been published about identifying conserved HIF-1 target genes in C. elegans [36]. Some HIF-1 targets described by Vora et al. such as ldh-1, mdh-1 (malate dehydrogenase), and PEP carboxykinase pck-1 were also selectively activated in the R244H mutants ([8] and this study). We also confirmed pseudohypoxia activation by crossing a reporter, cysl-2::GFP, into R244H mutants. cysl-2 is one of the strongest regulated direct targets of HIF-1 [18]. We found that cysl-2::GFP expression was induced in the sdhb-1(R244H) background, similar to the cysl-2::GFP and egl-9(sa307) mutants, which lack prolyl hydroxylase function. cysl-2::GFP and sdhb-1(R244H) double mutants could be used as a tool to screen HIF inhibitors [37].
Furthermore, our results show that SDHB mutations can significantly influence the overall oxidative status in C. elegans. We measured ROS levels in sdhb-1(-) null and R244H point mutants by two different methods. DHE staining, which primarily stains superoxide anions, resulted in no increase in the basal ROS state in any sdhb-1 mutant background. However, when R244H point mutants were tested by the CellROX Green method, which detects different types of reactive oxygen species, we found an increase in the basal ROS state, similar to data obtained in PPGL cells. Upon oxidative insult, both R244H point mutants and sdhb-1 null mutants presented a successive increment in ROS content, pointing towards their inability to tolerate oxidative stress as compared with the control. Upon investigation, this inability to subjugate oxidative insults was found to be a result of compromised antioxidant machinery. Both mutants showed marked reduction in the level of sod-1 enzyme, which is a cytosolic SOD enzyme. However, only R244H point mutants had a reduced level of a mitochondrial SOD enzyme, i.e., sod-2, reflecting imbalance in oxidative homeostasis at both cytosolic and mitochondrial levels. Additionally, based on our gene expression data, the point mutant also had compromised mitophagy, which further explained their susceptibility towards oxidative insults. Our previous assessment of mitochondrial health in null mutants has also revealed compromised mitochondrial function and bioenergetics [8]. These findings also suggest that both SDHB mutations alter the overall oxidative homeostasis and have defective mitochondrial physiology that contributes towards PPGL pathophysiology.
The near-ubiquitous use of fungicides with succinate dehydrogenase inhibitor (SDHi) activity in agriculture raises serious concerns, as SDHi can inhibit SDH activity in non-target species [38], for example in worms as well. In our work, the fungicide fluopyram is a worm-selective SDHi that inhibited R244H mutants selectively at 25 nM concentration, suggesting that these mutants display a residual SDH activity. Binding of fluopyram to the wild-type and R244H mutant C. elegans SDH complexes were also simulated in silico. We found that the binding mode of fluopyram to the wild-type and R244H mutant complexes were almost identical, consistent with the notion that the mutant SDH complex is assembled and explaining the experimental inhibitory effect of fluopyram on the residual enzymatic activity of R244H mutants.
Our investigations have also generated key insights into the behavior of SDHB and DAT-1 across various developmental stages, including the impact of dopaminergic neuronal damage on SDHB-1 expression, and the effects of sdhb-1 mutations on overall dopaminergic functioning. The link observed between dopaminergic neuronal damage and SDHB-1 suggests an interesting connection between mitochondrial function and decline in neurotransmitter efficiency.
Co-existence of Parkinson’s disease (PD) with pheochromocytoma is rare as only five such cases have been described till date [39]. This concurrence of Parkinson’s disease and the medications used by its patients is known to interfere with the standard biochemical tests of pheochromocytoma, thus necessitating caution while diagnosis [40]. In pheochromocytoma, activation of the HIF-signaling pathway is deemed responsible, whereas in Parkinson’s disease and other neurodegenerative diseases it is considered as protective [41]. Intriguingly, in one of the reported cases of this co-existence, the levels of HIF-1α in the tumor were markedly diminished, which are found to be elevated in pheochromocytoma patients without Parkinson’s disease [39]. This signifies that the role of pseudohypoxia in the etiology of both the diseases warrants further attention. However, the mitochondrial dysfunction and oxidative imbalance observed in both diseases can explain such rare events more conclusively. Such cases provide opportunities to understand the different pathological outcomes of the same underlying cellular and molecular events. In our study, we have also examined such correlations between the two diseases in the context of mitochondrial dysfunction and oxidative imbalance. The subtle damage of dopaminergic neurons by oxidative assaults, exerted by 6-OHDA, and its systemic manifestations on SDHB-1 levels, suggest the existence of a yet unidentified mechanism that can transmit oxidative insults to and from in such cases. The existence of such a bidirectional mechanism is also substantiated by the compromised dopamine-related neuro-behaviors observed in the sdhb-1 null mutant. Moreover, mutations in succinate dehydrogenase have been implicated in the onset of neurodegenerative disorders including Parkinson’s disease, by its virtue to regulate oxidative stress, lipid homeostasis and neuronal excitotoxicity [42]. This implies the existence of shared molecular underpinnings by both diseases, which are more comprehensible in the context of oxidative imbalance and mitochondrial dysfunction than the pseudohypoxia pathway. Our model provides an opportunity to study such concurrences and delineate the molecular events, which we will be carrying out in our future work.
The nematode is gaining momentum as a screening tool in drug discovery, as it combines genetic amenability, low cost, and culture conditions compatible with high throughput screening [43]. The FDA considers the worm as an alternative model in toxicity testing (https://www.fda.gov/food/toxicology-research/c-elegans-model-toxicity-testing (accessed on 30 September 2022)). This study shows that our C. elegans model can serve as a pharmacological model of succinate dehydrogenase loss disorders, as it is druggable and shows several characteristics of PPGL tumors. Our data also point to a potential problem with SDH-directed fungicides should our findings in sdhb-1 mutant worms translate into humans with inherited SDHB variants. Such individuals may be uniquely susceptible to low concentrations of fungicides targeting SDHB, whereas their wild-type compatriots remain unaffected.

4. Materials and Methods

4.1. Caenorhabditis elegans Strains

C aenorhabditis elegans strains were maintained under standard conditions [44]. The following strains were used: wild type (WT), Bristol N2; VC294, {sdhb-1(gk165)/ mIn1 (mIs14 [myo-2::gfp; pes-10::gfp]) dpy-10(e128)] II.}; R244H, sdhb-1(gk165)/ mIn1 [mIs14 [myo-2::gfp; pes-10::gfp] dpy-10(e128)] II.; unc-119(ed3) III.(?); pNU636 (Psdhb-1_sdhb-1(G731A)_UTRsdhb-1; unc-119(+)) X.; WTR, sdhb-1(gk165)/ sdhb-1(gk165) II.; unc-119(ed3) III.(?); pNU637 (Psdhb-1_sdhb-1(genomic wt)_UTRsdhb-1; unc-119(+)) X.; TBV03, sdhb-1::mCherry, and the strain obtained from crossing TBV03 with TG2401, {dat-1(ok157) III; vtIs1 V; tsp-17(gt1681) X}.

4.2. Oxidative Stress Measurement

For ROS estimation by dihydroethidium (DHE) dye, Invitrogen D1168, worms were harvested and washed to remove adherent bacteria. The worms were then incubated in 5 μM DHE dye solution for 45 min on a rotor shaker (iRoll PR35, Accumax, New Delhi, India). For positive control group, 20 mM H2O2 was added along with DHE. After incubation, worms were washed with 1X PBS followed by M9 buffer (3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 mL 1 M MgSO4 in 1 L H2O) [45]. Slide preparation for fluorescence image acquisition and statistical analysis of the obtained data was performed as mentioned earlier. CellROX Green was performed as described in [46].

4.3. Image Acquisition

For imaging, synchronous population of worms or embryos was first harvested and then washed thrice by M9 buffer to remove adhering bacteria. In the case of worms, immobilization was performed by using 100 mM sodium azide solution (Sigma, Cat. No. 71289 St. Louis, MO, USA). Immobilized worms were mounted on a clean glass slide, and a coverslip was placed over it. Fluorescence images were acquired by using Carl Zeiss Axio Imager M2 or M3 (Oberkochen, Baden-Württemberg, Germany) fluorescence microscope and for confocal microscopy, we used Leica SP8 confocal microscope, (Wetzlar, Hesse, Germany). The fluorescence intensity was quantified using ImageJ v.1.53t software (ImageJ, National Institute of Health, Bethesda, MD, USA).

4.4. Thrashing Assay

To evaluate the functional integrity of dopaminergic neural circuitry, a thrashing assay was conducted in C. elegans with appropriate age-specific controls. Briefly, a drop of M9 buffer was placed over NGM plate containing the worms. After a period of acclimatization (30 s), a video was recorded for another 30 s using Leica LAS EZ software (Version 3.4.0). The thrashing rate of each worm was manually counted for 10 s by snipping and slowing down the video file. For each group, 10 worms were evaluated, and the experiment was conducted in two separate biological repeats.

4.5. 1-Nonanol Aversion Assay

1-nonanol aversion assay is a chemotactic assay used to assess the olfactory response of C. elegans against a known repellent 1-nonanol [35]. This is used as a functional read-out for the health of dopaminergic neurons. Briefly, a metallic wire dipped in 1-nonanol is brought near to the anterior end of worm, and the time taken by each worm to respond is noted. For each group, 10 worms were evaluated, and the experiment was conducted in two separate biological repeats.

4.6. qRT-PCR and Semi-qPCR Experiments

The expression patterns of hif-1 target genes were determined using semi-quantitative and quantitative real-time PCR (qRT-PCR) by relative quantification. Total mRNA content was extracted from 2000 animals per strain with MACHEREY-NAGEL NucleoSpin® RNA RNA Isolation kit (Düren, North Rhine-Westphalia, Germany). For both semi-quantitative and quantitative real-time PCR (qRT-PCR) experiments, 500 ng of total RNA was reverse-transcribed using a High-Capacity RNA-to-cDNA kit (Applied Biosystems High-Capacity cDNA Reverse Transcription Kit (#2705108), Waltham, MA, USA) according to the manufacturer’s instructions. cDNA was diluted 10x. All measurements were performed in triplicate. Relative expression levels were calculated by the deltadeltaCT (ddCT) method using cdc-42 as endogenous control [47]. Fold-change values were calculated from 2−ddCT.
The following primer pairs have been used: cdc-42: 5′-GACAATTACGCCGTCACAGTAATG-3′, 5′-TGAAGCTGGAGCAACCACG-3′ pvf-1: 5′-GATTCCACAACTGTCCGACG-3′, 5′-GCAATCAAAGCACGAACACG-3′ ldh-1: 5′-AGTCTTCGCGGAAATTGCAG-3′, 5′-GCCAGCGGTGATAGAGTAGT-3′ NDRG1: 5′-TTTACACGTGACATGCAGCC-3′, 5′-GTCCCGGAGCATTCACATTG-3′
SYBR Green-based (Applied Biosystems™ Power SYBR™ Green Master Mix (#2012607)
RT-qPCR reactions were set up in QuantStudio™ 3 Real-Time PCR System (Applied Biosystems).
Amplification data were analyzed using QuantStudio Design and Analysis Online Software (ThermoFisher Scientific, Waltham, MA, USA).
Semi-qPCR fluorescence intensities were calculated by the use of ImageJ v. 1.54g software.

4.7. Single Worm qRT-PCR Experiments

For RNA isolation from a single worm of N2, WTR, and R244H strains, a young adult worm was picked and washed in DEPC-treated water. After washing, the worm was suspended in 1 μL of lysis buffer (Tris 5 mM pH 8.6; EDTA 0.25 mM; 0.5% Triton X-100; 0.5% Tween 20 and 1 mg/mL of proteinase K) placed on the cap of a PCR tube. For the sdhb-1 null mutant strain, L2 stage worms were subjected to RNA isolation with N2 L2 stage worms as reference. The PCR tube was briefly centrifuged to settle the worm suspension down and then incubated at 65 °C for 11 min on Sure Cycler 8800 PCR (Agilent Technologies, Santa Clara, CA, USA). To inactivate proteinase K, the tube was heated at 85 °C for 1 min and then immediately stored at 4 °C. For longer storage, isolated RNA was kept at −80° C [48]. Synthesis of cDNA was performed in accordance with the Verso cDNA synthesis kit (Thermo Scientic, Cat. No. AB-1453/B), and the cDNA synthesis protocol was run on Sure Cycler 8800 PCR (Agilent Technologies).
The genes of interest were quantitatively assessed using a TB Green® Premix Ex TaqTM (TaKaRa, Cat. No. RR420A, Bio, Otsu, Japan). As per the manufacturer’s instructions, the amount of cDNA in each well of 96 well Hi-Plate for Real Time (TaKaRa, Cat. No. NJ400, Bio, Otsu, Japan) was calculated to be 100 ng. Each sample was amplified in duplicates by using CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Berkley, CA, USA). Each PCR cycle consisted of (i) 1 cycle of pre-incubation: 95 °C for 30 s and (ii) 40 cycles for amplification: 95 °C for 5 s, 55 °C for 30 s, and 60 °C for 35 s. The Ct values obtained were analyzed to calculate the relative fold change for each gene, with respect to actin as an internal reference. The primers used for different genes are listed in Table 1.

4.8. 6-OHDA Treatment

Stock solutions of 6-hydroxydopamine (500 mM) and ascorbic acid (200 mM) were prepared in double distilled water. For treatment, L3 larval stage worms of the dat-1:gfp x sdhb-1:mCherry strain were suspended in 200 μL of M9 buffer, which contained 100 mM 6-OHDA and 20 mM ascorbic acid. After treatment for 1 h at 24 °C with regular shaking, 6OHDA was rendered inactive by the addition of the M9 buffer, and the worms were washed and added to the OP50 seeded NGM plates to allow their growth till the young adult stage. Treatment with 20 mM ascorbic acid alone was considered as the vehicle control.

4.9. Residual SDH Activity

Fluopyram was added to NGM plates; animals were incubated on drug-containing and control plates for 7 days at 16 °C. Next, developmental stages reached by treated and non-treated worms were scored.

4.10. Modeling Studies

4.10.1. Ligand Preparation

Fluopyram (N-[2-[3-chloro-5-(trifluoromethyl)pyridin-2-yl]ethyl]-2-(trifluoromethyl)benzamide) was built and energy minimized in Maestro [49].
Flutolanil (N-[(4-tert-butylphenyl)methyl]-2-(trifluoromethyl)benzamide) was acquired from the Protein Data Bank (PDB, [50]) under the code PDB:4ytp [51]. The ligands were equipped with partial charges and converted to pdbqt format in AutoDock Tools 4.2.6 [52].

4.10.2. Target Preparation

The atomic coordinates of the Sus scrofa heart mitochondrial complex II in complex with flutonalil was obtained from the Protein Data Bank [50] with PDB code 4ytp [51]. The amino acid sequence of the Caenorhabditis elegans mitochondrial complex II subunit A (Q09508), B (Q09545), C (P41956), and D (O62215) were obtained from UniProt [53]. The atomic coordinates of the Caenorhabditis elegans mitochondrial complex II were built with AlphaFold 3 on the AlphaFold Server [54]. Atomic coordinates of the heme and FeS clusters were superimposed from PDB:4ytp. The partial charges of the heme were used from [55] as described in [56]. Partial charges of the FeS cluster close to the ligand binding site were calculated with MOPAC [57] with a PM7 parametrization [58]. The R244H mutant of the Caenorhabditis elegans mitochondrial complex II was built in PyMol 3.1 [59] and energy minimized with a steepest descent and conjugate gradient protocol in GROMACS 2020.1-1 [60]. Briefly, the protein was placed into a box filled with TIP3P [61] water molecules, and counter-ions were added to the system to neutralize charges. The AMBER [62] force field was used to build the topology of the protein. During the minimizations, exit tolerance levels were set to 500 and 200 kJ × mol–1 × nm–1, and the maximum step sizes were set to 0.5 and 0.75 nm for the steepest descent and conjugate gradient steps, respectively. Gasteiger-Marsili [63] partial charges were added to proteins in AutoDock Tools [52] to prepare for docking.

4.10.3. Docking

The docking calculations were performed in AutoDock [52]. First, re-docking of flutonalil to PDB:4ytp was performed, then docking of fluopyram to the homology model of the wild type and mutant Caenorhabditis elegans mitochondrial complex II were performed with the same methodology. That is, the grid box was set to coordinates −20.33, −23.77, and 62.04 (the average coordinates of the bound flutonalil), with 30 × 30 × 30 grid points and 0.375 grid spacing. A Lamarckian genetic algorithm was applied with pseudo-Solis and Wets local search and a population size of 250 for 10 docking runs [64,65,66]. The generated ligand-binding modes were clustered and ranked according to their calculated free energy of binding; a lower rank corresponds to a more favorable binding energy. In the re-docking, a root mean square deviation (RMSD) was calculated between the heavy atoms of the experimental and the docked binding modes.

5. Conclusions

Our results in this paper show that several evolutionarily conserved HIF-1(hypoxia-inducible factor-1) target genes are induced in sdhb-1(R244H) mutants, moreover a reporter carrying the promoter of cysteine synthase like 2 (cysl-2), which is a strongly regulated HIF-1 target gene, is also activated in sdhb-1 point mutants, indicating activation of hypoxia under normoxic conditions. Upon oxidative insult, reactive oxygen species (ROS) are accumulated in the sdhb-1(R244H) mutants. We found a decreased expression of cytosolic and mitochondrial superoxide dismutases, SOD-1 and SOD-2, respectively, in R244H mutants, which explains the imbalance in oxidative homeostasis. Expression levels of pink-1 (PTEN-induced putative kinase) and pdr-1 (E3 ubiquitin-protein ligase parkin) are downregulated in R244H mutants, suggesting impaired mitophagy. Our experimental results using the SDH inhibitor fluopyram and structural analyses show that the SDH complex carrying the R244H mutation in the B subunit displays residual SDH activity. In addition, our studies revealed a link between SDHB-1 and dopaminergic neuronal health.
Together, we propose our C. elegans model as a pharmacological model of succinate dehydrogenase loss disorders, as it is druggable and shows several characteristics of PPGL tumors.

Author Contributions

Conceptualization, A.N. and K.T.-V.; methodology, F.Ő., M.A. and Z.F.; formal analysis, F.Ő. and M.A.; investigation, F.Ő., M.A., B.Z.Z., C.H., T.I.O., Á.F., G.M.K., A.P., A.B. and Z.F.; writing—original draft, B.Z.Z., C.H., A.N. and K.T.-V.; writing—review and editing, A.N. and K.T.-V.; visualization, F.Ő., M.A., T.I.O., Á.F., G.M.K., A.P., A.B. and Z.F.; Supervision, A.N. and K.T.-V.; funding acquisition, A.N. and K.T.-V. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Research Fund (National Research, Development and Innovation Office) grants K134285 to K.T.-V., PD142943 to A.B., and FK142971 to A.P. and the PC-II-12/2022 grant to T.I.O. from the Hungarian Academy of Sciences. This work is also supported by the EKÖP-25 university research scholarship program of the ministry for culture and innovation from the source of the national research, development, and innovation fund EKÖP-25-3-II-ELTE-616 to F.Ő., and EKÖP-25-4-II-ELTE-46 to Z.F. This paper was supported by the János Bolyai Research Scholarship of the Hungarian Academy of Sciences. The work was supported by the National Research, Development, and Innovation Office (PharmaLab, RRF-2.3.1-21-2022-00015). A.N. and M.A. were supported by Council of Scientific and Industrial Research (CSIR) and CSIR-Central Drug Research Institute. This study was supported by the Pheo Para Cancer Charity.

Institutional Review Board Statement

No ethical approval is required for this study, as it includes research on C. elegans, which is considered compliant with the 3R rules of animal experimentation.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed at the corresponding author.

Acknowledgments

We thank Anil Mehta for suggestions and helpful discussions. We also thank the Pheo Para Cancer Charity for supporting our research. We acknowledge the Digital Government Development and Project Management Ltd. for awarding us access to the Komondor HPC facility based in Hungary.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
DAT-1dopamine transporter
DHEdihydroethidium
ETCelectron transport chain
HIFhypoxia-inducible factor
LDHlactate dehydrogenase
NDRG1N-myc downstream regulated 1
6-OHDA6-hydroxydopamine
PHEOpheochromocytoma
PGLparaganglioma
PINKPTEN-induced putative kinase
PPGLpheochromocytoma/paraganglioma
ROSreactive oxygen species
SDHBsuccinate dehydrogenase B subunit
SODsuperoxide dismutase
VEGFAvascular endothelial growth factor A

References

  1. Raphael, M.J.; Chan, D.L.; Law, C.; Singh, S. Principles of Diagnosis and Management of Neuroendocrine Tumours. CMAJ 2017, 189, E398–E404. [Google Scholar] [CrossRef] [PubMed]
  2. Juhlin, C.C. The Road Ahead: A Brief Guide to Navigating the 2022 WHO Classification of Endocrine and Neuroendocrine Tumours. J. Clin. Pathol. 2024, 78, 1–10. [Google Scholar] [CrossRef] [PubMed]
  3. Almeida, M.Q.; Bezerra-Neto, J.E.; Mendonça, B.B.; Latronico, A.C.; Fragoso, M.C.B. V Primary Malignant Tumors of the Adrenal Glands. Clinics 2018, 73, e756s. [Google Scholar] [CrossRef]
  4. Dahia, P.L.M. Pheochromocytoma and Paraganglioma Pathogenesis: Learning from Genetic Heterogeneity. Nat. Rev. Cancer 2014, 14, 108–119. [Google Scholar] [CrossRef]
  5. Amar, L.; Bertherat, J.; Baudin, E.; Ajzenberg, C.; Bressac-de Paillerets, B.; Chabre, O.; Chamontin, B.; Delemer, B.; Giraud, S.; Murat, A.; et al. Genetic Testing in Pheochromocytoma or Functional Paraganglioma. J. Clin. Oncol. 2005, 23, 8812–8818. [Google Scholar] [CrossRef]
  6. Timmers, H.J.L.M.; Kozupa, A.; Eisenhofer, G.; Raygada, M.; Adams, K.T.; Solis, D.; Lenders, J.W.M.; Pacak, K. Clinical Presentations, Biochemical Phenotypes, and Genotype-Phenotype Correlations in Patients with Succinate Dehydrogenase Subunit B-Associated Pheochromocytomas and Paragangliomas. J. Clin. Endocrinol. Metab. 2007, 92, 779–786. [Google Scholar] [CrossRef]
  7. Takács-Vellai, K.; Farkas, Z.; Ősz, F.; Stewart, G.W. Model Systems in SDHx-Related Pheochromocytoma/Paraganglioma. Cancer Metastasis Rev. 2021, 40, 1177–1201. [Google Scholar] [CrossRef]
  8. Saskői, É.; Hujber, Z.; Nyírő, G.; Likó, I.; Mátyási, B.; Petővári, G.; Mészáros, K.; Kovács, A.L.; Patthy, L.; Supekar, S.; et al. The SDHB Arg230His Mutation Causing Familial Paraganglioma Alters Glycolysis in a New Caenorhabditis Elegans Model. Dis. Model. Mech. 2020, 13, dmm044925. [Google Scholar] [CrossRef] [PubMed]
  9. van Berkel, A.; Rao, J.U.; Kusters, B.; Demir, T.; Visser, E.; Mensenkamp, A.R.; van der Laak, J.A.W.M.; Oosterwijk, E.; Lenders, J.W.M.; Sweep, F.C.G.J.; et al. Correlation Between In Vivo 18F-FDG PET and Immunohistochemical Markers of Glucose Uptake and Metabolism in Pheochromocytoma and Paraganglioma. J. Nucl. Med. 2014, 55, 1253–1259. [Google Scholar] [CrossRef]
  10. Fliedner, S.M.J.; Kaludercic, N.; Jiang, X.-S.; Hansikova, H.; Hajkova, Z.; Sladkova, J.; Limpuangthip, A.; Backlund, P.S.; Wesley, R.; Martiniova, L.; et al. Warburg Effect’s Manifestation in Aggressive Pheochromocytomas and Paragangliomas: Insights from a Mouse Cell Model Applied to Human Tumor Tissue. PLoS ONE 2012, 7, e40949. [Google Scholar] [CrossRef]
  11. Selak, M.A.; Armour, S.M.; MacKenzie, E.D.; Boulahbel, H.; Watson, D.G.; Mansfield, K.D.; Pan, Y.; Simon, M.C.; Thompson, C.B.; Gottlieb, E. Succinate Links TCA Cycle Dysfunction to Oncogenesis by Inhibiting HIF-Alpha Prolyl Hydroxylase. Cancer Cell 2005, 7, 77–85. [Google Scholar] [CrossRef]
  12. Bayley, J.-P.; Devilee, P. Hypothesis: Why Different Types of SDH Gene Variants Cause Divergent Tumor Phenotypes. Genes 2022, 13, 1025. [Google Scholar] [CrossRef] [PubMed]
  13. Kim, E.; Rath, E.M.; Tsang, V.H.M.; Duff, A.P.; Robinson, B.G.; Church, W.B.; Benn, D.E.; Dwight, T.; Clifton-Bligh, R.J. Structural and Functional Consequences of Succinate Dehydrogenase Subunit B Mutations. Endocr. Relat. Cancer 2015, 22, 387–397. [Google Scholar] [CrossRef]
  14. Shen, C.; Nettleton, D.; Jiang, M.; Kim, S.K.; Powell-Coffman, J.A. Roles of the HIF-1 Hypoxia-Inducible Factor During Hypoxia Response in Caenorhabditis Elegans. J. Biol. Chem. 2005, 280, 20580–20588. [Google Scholar] [CrossRef] [PubMed]
  15. Jiang, H.; Guo, R.; Powell-Coffman, J.A. The Caenorhabditis Elegans Hif-1 Gene Encodes a BHLH-PAS Protein That Is Required for Adaptation to Hypoxia. Proc. Natl. Acad. Sci. USA 2001, 98, 7916–7921. [Google Scholar] [CrossRef]
  16. Powell-Coffman, J.A. Hypoxia Signaling and Resistance in C. Elegans. Trends Endocrinol. Metab. 2010, 21, 435–440. [Google Scholar] [CrossRef] [PubMed]
  17. Cserepes, M.; Türk, D.; Tóth, S.; Pape, V.F.S.; Gaál, A.; Gera, M.; Szabó, J.E.; Kucsma, N.; Várady, G.; Vértessy, B.G.; et al. Unshielding Multidrug Resistant Cancer Through Selective Iron Depletion of P-Glycoprotein-Expressing Cells. Cancer Res. 2020, 80, 663–674. [Google Scholar] [CrossRef]
  18. Ma, D.K.; Vozdek, R.; Bhatla, N.; Horvitz, H.R. CYSL-1 Interacts with the O2-Sensing Hydroxylase EGL-9 to Promote H2S-Modulated Hypoxia-Induced Behavioral Plasticity in C. elegans. Neuron 2012, 73, 925–940. [Google Scholar] [CrossRef]
  19. Saikolappan, S.; Kumar, B.; Shishodia, G.; Koul, S.; Koul, H.K. Reactive Oxygen Species and Cancer: A Complex Interaction. Cancer Lett. 2019, 452, 132–143. [Google Scholar] [CrossRef]
  20. Ilanchezhian, M.; Jha, A.; Pacak, K.; Del Rivero, J. Emerging Treatments for Advanced/Metastatic Pheochromocytoma and Paraganglioma. Curr. Treat. Options Oncol. 2020, 21, 85. [Google Scholar] [CrossRef]
  21. Saito, Y.; Ishii, K.-A.; Aita, Y.; Ikeda, T.; Kawakami, Y.; Shimano, H.; Hara, H.; Takekoshi, K. Loss of SDHB Elevates Catecholamine Synthesis and Secretion Depending on ROS Production and HIF Stabilization. Neurochem. Res. 2016, 41, 696–706. [Google Scholar] [CrossRef]
  22. Ishii, T.; Yasuda, K.; Akatsuka, A.; Hino, O.; Hartman, P.S.; Ishii, N. A Mutation in the SDHC Gene of Complex II Increases Oxidative Stress, Resulting in Apoptosis and Tumorigenesis. Cancer Res. 2005, 65, 203–209. [Google Scholar] [CrossRef]
  23. Goffrini, P.; Ercolino, T.; Panizza, E.; Giachè, V.; Cavone, L.; Chiarugi, A.; Dima, V.; Ferrero, I.; Mannelli, M. Functional Study in a Yeast Model of a Novel Succinate Dehydrogenase Subunit B Gene Germline Missense Mutation (C191Y) Diagnosed in a Patient Affected by a Glomus Tumor. Hum. Mol. Genet. 2009, 18, 1860–1868. [Google Scholar] [CrossRef]
  24. Smith, E.H.; Janknecht, R.; Maher, L.J. Succinate Inhibition of Alpha-Ketoglutarate-Dependent Enzymes in a Yeast Model of Paraganglioma. Hum. Mol. Genet. 2007, 16, 3136–3148. [Google Scholar] [CrossRef] [PubMed]
  25. Slane, B.G.; Aykin-Burns, N.; Smith, B.J.; Kalen, A.L.; Goswami, P.C.; Domann, F.E.; Spitz, D.R. Mutation of Succinate Dehydrogenase Subunit C Results in Increased O2·−, Oxidative Stress, and Genomic Instability. Cancer Res. 2006, 66, 7615–7620. [Google Scholar] [CrossRef]
  26. Ha, N.M.; Tran, S.H.; Shim, Y.-H.; Kang, K. Caenorhabditis Elegans as a Powerful Tool in Natural Product Bioactivity Research. Appl. Biol. Chem. 2022, 65, 18. [Google Scholar] [CrossRef]
  27. Zhao, H.; Kalivendi, S.; Zhang, H.; Joseph, J.; Nithipatikom, K.; Vásquez-Vivar, J.; Kalyanaraman, B. Superoxide Reacts with Hydroethidine but Forms a Fluorescent Product That Is Distinctly Different from Ethidium: Potential Implications in Intracellular Fluorescence Detection of Superoxide. Free Radic. Biol. Med. 2003, 34, 1359–1368. [Google Scholar] [CrossRef]
  28. Min, H.; Youn, E.; Kim, J.; Son, S.Y.; Lee, C.H.; Shim, Y.-H. Effects of Phosphoethanolamine Supplementation on Mitochondrial Activity and Lipogenesis in a Caffeine Ingestion Caenorhabditis Elegans Model. Nutrients 2020, 12, 3348. [Google Scholar] [CrossRef] [PubMed]
  29. Sakamoto, T.; Imai, H. Hydrogen Peroxide Produced by Superoxide Dismutase SOD-2 Activates Sperm in Caenorhabditis Elegans. J. Biol. Chem. 2017, 292, 14804–14813. [Google Scholar] [CrossRef] [PubMed]
  30. Ahier, A.; Dai, C.-Y.; Kirmes, I.; Cummins, N.; Hung, G.C.C.; Götz, J.; Zuryn, S. PINK1 and Parkin Shape the Organism-Wide Distribution of a Deleterious Mitochondrial Genome. Cell Rep. 2021, 35, 109203. [Google Scholar] [CrossRef]
  31. Schleker, A.S.S.; Rist, M.; Matera, C.; Damijonaitis, A.; Collienne, U.; Matsuoka, K.; Habash, S.S.; Twelker, K.; Gutbrod, O.; Saalwächter, C.; et al. Mode of Action of Fluopyram in Plant-Parasitic Nematodes. Sci. Rep. 2022, 12, 11954. [Google Scholar] [CrossRef]
  32. Vidal-Gadea, A.G.; Pierce-Shimomura, J.T. Conserved Role of Dopamine in the Modulation of Behavior. Commun. Integr. Biol. 2012, 5, 440–447. [Google Scholar] [CrossRef]
  33. Jadiya, P.; Chatterjee, M.; Sammi, S.R.; Kaur, S.; Palit, G.; Nazir, A. Sir-2.1 Modulates “calorie-Restriction-Mediated” Prevention of Neurodegeneration in Caenorhabditis Elegans: Implications for Parkinson’s Disease. Biochem. Biophys. Res. Commun. 2011, 413, 306–310. [Google Scholar] [CrossRef] [PubMed]
  34. Latchoumycandane, C.; Anantharam, V.; Jin, H.; Kanthasamy, A.; Kanthasamy, A. Dopaminergic Neurotoxicant 6-OHDA Induces Oxidative Damage Through Proteolytic Activation of PKCδ in Cell Culture and Animal Models of Parkinson’s Disease. Toxicol. Appl. Pharmacol. 2011, 256, 314–323. [Google Scholar] [CrossRef]
  35. Hameed, R.; Naseer, A.; Saxena, A.; Akbar, M.; Toppo, P.; Sarkar, A.; Shukla, S.K.; Nazir, A. Functional Implications of NHR-210 Enrichment in C. Elegans Cephalic Sheath Glia: Insights into Metabolic and Mitochondrial Disruptions in Parkinson’s Disease Models. Cell. Mol. Life Sci. 2024, 81, 202. [Google Scholar] [CrossRef]
  36. Vora, M.; Pyonteck, S.M.; Popovitchenko, T.; Matlack, T.L.; Prashar, A.; Kane, N.S.; Favate, J.; Shah, P.; Rongo, C. The Hypoxia Response Pathway Promotes PEP Carboxykinase and Gluconeogenesis in C. elegans. Nat. Commun. 2022, 13, 6168. [Google Scholar] [CrossRef] [PubMed]
  37. Cowman, S.J.; Koh, M.Y. Revisiting the HIF Switch in the Tumor and Its Immune Microenvironment. Trends Cancer 2022, 8, 28–42. [Google Scholar] [CrossRef] [PubMed]
  38. Duarte Hospital, C.; Tête, A.; Debizet, K.; Imler, J.; Tomkiewicz-Raulet, C.; Blanc, E.B.; Barouki, R.; Coumoul, X.; Bortoli, S. SDHi Fungicides: An Example of Mitotoxic Pesticides Targeting the Succinate Dehydrogenase Complex. Environ. Int. 2023, 180, 108219. [Google Scholar] [CrossRef]
  39. Matsumura-Matsuda, E.; Sekiya, M.; Omoto-Inuzuka, M.; Santo, K.; Shikama, A.; Kuba, M.; Sugano, Y.; Iwasaki, H.; Yatoh, S.; Sato, T.; et al. A Rare Coexistence of Pheochromocytoma and Parkinson’s Disease with Diagnostic Challenges. Intern. Med. 2018, 57, 979–985. [Google Scholar] [CrossRef]
  40. Mehta, S.H.; Prakash, R.; Prisant, L.M.; Isales, C.M.; Morgan, J.C.; Williams, H.; Sethi, K.D. Diagnosis of Pheochromocytoma in the Setting of Parkinson Disease. Nat. Rev. Neurol. 2009, 5, 343–347. [Google Scholar] [CrossRef]
  41. Correia, S.C.; Moreira, P.I. Hypoxia-Inducible Factor 1: A New Hope to Counteract Neurodegeneration? J. Neurochem. 2010, 112, 1–12. [Google Scholar] [CrossRef] [PubMed]
  42. Jodeiri Farshbaf, M.; Kiani-Esfahani, A. Succinate Dehydrogenase: Prospect for Neurodegenerative Diseases. Mitochondrion 2018, 42, 77–83. [Google Scholar] [CrossRef] [PubMed]
  43. O’Reilly, L.P.; Luke, C.J.; Perlmutter, D.H.; Silverman, G.A.; Pak, S.C. C. elegans in High-Throughput Drug Discovery. Adv. Drug Deliv. Rev. 2014, 69–70, 247–253. [Google Scholar] [CrossRef]
  44. Brenner, S. The Genetics of Caenorhabditis Elegans. Genetics 1974, 77, 71–94. [Google Scholar] [CrossRef] [PubMed]
  45. Gusarov, I.; Shamovsky, I.; Pani, B.; Gautier, L.; Eremina, S.; Katkova-Zhukotskaya, O.; Mironov, A.; Makarov, A.A.; Nudler, E. Dietary Thiols Accelerate Aging of C. elegans. Nat. Commun. 2021, 12, 4336. [Google Scholar] [CrossRef]
  46. Min, H.; Lee, M.; Cho, K.S.; Lim, H.J.; Shim, Y.-H. Nicotinamide Supplementation Improves Oocyte Quality and Offspring Development by Modulating Mitochondrial Function in an Aged Caenorhabditis Elegans Model. Antioxidants 2021, 10, 519. [Google Scholar] [CrossRef]
  47. Hoogewijs, D.; Houthoofd, K.; Matthijssens, F.; Vandesompele, J.; Vanfleteren, J.R. Selection and Validation of a Set of Reliable Reference Genes for Quantitative Sod Gene Expression Analysis in C. Elegans. BMC Mol. Biol. 2008, 9, 9. [Google Scholar] [CrossRef]
  48. Ly, K.; Reid, S.J.; Snell, R.G. Rapid RNA Analysis of Individual Caenorhabditis Elegans. MethodsX 2015, 2, 59–63. [Google Scholar] [CrossRef]
  49. Schrödinger Schrödinger Release 2024-1: Maestro 2024. Available online: https://www.schrodinger.com/life-science/download/release-notes/release-2024-1/ (accessed on 8 January 2024).
  50. Berman, H.M.; Westbrook, J.; Feng, Z.; Gilliland, G.; Bhat, T.N.; Weissig, H.; Shindyalov, I.N.; Bourne, P.E. The Protein Data Bank. Nucleic Acids Res. 2000, 28, 235–242. [Google Scholar] [CrossRef]
  51. Inaoka, D.K.; Shiba, T.; Sato, D.; Balogun, E.O.; Sasaki, T.; Nagahama, M.; Oda, M.; Matsuoka, S.; Ohmori, J.; Honma, T.; et al. Structural Insights into the Molecular Design of Flutolanil Derivatives Targeted for Fumarate Respiration of Parasite Mitochondria. Int. J. Mol. Sci. 2015, 16, 15287–15308. [Google Scholar] [CrossRef]
  52. Morris, G.M.; Huey, R.; Lindstrom, W.; Sanner, M.F.; Belew, R.K.; Goodsell, D.S.; Olson, A.J. AutoDock4 and AutoDockTools4: Automated Docking with Selective Receptor Flexibility. J. Comput. Chem. 2009, 30, 2785–2791. [Google Scholar] [CrossRef] [PubMed]
  53. UniProt Consortium. UniProt: A Worldwide Hub of Protein Knowledge. Nucleic Acids Res. 2019, 47, D506–D515. [Google Scholar] [CrossRef] [PubMed]
  54. Abramson, J.; Adler, J.; Dunger, J.; Evans, R.; Green, T.; Pritzel, A.; Ronneberger, O.; Willmore, L.; Ballard, A.J.; Bambrick, J.; et al. Accurate Structure Prediction of Biomolecular Interactions with AlphaFold 3. Nature 2024, 630, 493–500. [Google Scholar] [CrossRef] [PubMed]
  55. Shahrokh, K.; Orendt, A.; Yost, G.S.; Cheatham, T.E. Quantum Mechanically Derived AMBER-Compatible Heme Parameters for Various States of the Cytochrome P450 Catalytic Cycle. J. Comput. Chem. 2012, 33, 119–133. [Google Scholar] [CrossRef]
  56. Zsidó, B.Z.; Balog, M.; Erős, N.; Poór, M.; Mohos, V.; Fliszár-Nyúl, E.; Hetényi, C.; Nagane, M.; Hideg, K.; Kálai, T.; et al. Synthesis of Spin-Labelled Bergamottin: A Potent CYP3A4 Inhibitor with Antiproliferative Activity. Int. J. Mol. Sci. 2020, 21, 508. [Google Scholar] [CrossRef] [PubMed]
  57. Stewart, J.J.P.; Klamt, A.; Thiel, W.; Danovich, D.; Rocha, G.B.; Gieseking, R.L.; Moussa, J.E.; Kurtz, H.A.; Korambath, P.; Merz, K.M.; et al. MOPAC (22.0.0) 2022; Molecular Sciences Software Institute (MolSSI): Blacksburg, VA, USA, 2022. [Google Scholar]
  58. Stewart, J.J.P. Optimization of Parameters for Semiempirical Methods VI: More Modifications to the NDDO Approximations and Re-Optimization of Parameters. J. Mol. Model. 2013, 19, 1–32. [Google Scholar] [CrossRef]
  59. DeLano, W.L. The PyMOL Molecular Graphics System. Version 2.0 2017. Schrödinger, LLC: New York, NY, USA.
  60. Van Der Spoel, D.; Lindahl, E.; Hess, B.; Groenhof, G.; Mark, A.E.; Berendsen, H.J.C. GROMACS: Fast, Flexible, and Free. J. Comput. Chem. 2005, 26, 1701–1718. [Google Scholar] [CrossRef]
  61. Jorgensen, W.L.; Chandrasekhar, J.; Madura, J.D.; Impey, R.W.; Klein, M.L. Comparison of Simple Potential Functions for Simulating Liquid Water. J. Chem. Phys. 1983, 79, 926–935. [Google Scholar] [CrossRef]
  62. Wang, J.; Wolf, R.M.; Caldwell, J.W.; Kollman, P.A.; Case, D.A. Development and Testing of a General Amber Force Field. J. Comput. Chem. 2004, 25, 1157–1174. [Google Scholar] [CrossRef]
  63. Gasteiger, J.; Marsili, M. Iterative Partial Equalization of Orbital Electronegativity—A Rapid Access to Atomic Charges. Tetrahedron 1980, 36, 3219–3228. [Google Scholar] [CrossRef]
  64. Zsidó, B.Z.; Börzsei, R.; Szél, V.; Hetényi, C. Determination of Ligand Binding Modes in Hydrated Viral Ion Channels to Foster Drug Design and Repositioning. J. Chem. Inf. Model. 2021, 61, 4011–4022. [Google Scholar] [CrossRef] [PubMed]
  65. Tyukodi, L.; Zsidó, B.Z.; Hetényi, C.; Kőszegi, T.; Huber, I.; Rozmer, Z. Serum Albumin Binding Studies on Antiproliferative Cyclic C5-Curcuminoid Derivatives Using Spectroscopic Methods and Molecular Modelling. J. Mol. Struct. 2023, 1287, 135761. [Google Scholar] [CrossRef]
  66. Lemli, B.; Vilmányi, P.; Fliszár-Nyúl, E.; Zsidó, B.Z.; Hetényi, C.; Szente, L.; Poór, M. Testing Serum Albumins and Cyclodextrins as Potential Binders of the Mycotoxin Metabolites Alternariol-3-Sulfate, Alternariol-9-Monomethylether and Alternariol-9-Monomethylether-3-Sulfate. Int. J. Mol. Sci. 2022, 23, 14353. [Google Scholar] [CrossRef] [PubMed]
Ijms 26 10185 g001
Figure 1. Analyzing pseudohypoxia in sdhb-1(R244H) mutants: analyzing the expression of HIF-1 target genes. (A,B) Semi-quantitative RT-PCR detected elevated mRNA levels of the LDHA homolog ldh-1, the VEGFA homolog pvf-1, and the NDRG1 homolog Y48G10A.3 in sdhb-1(R244H) mutants compared with WT worms (N2). (C) SYBR Green assay confirmed upregulation of ldh-1 and pvf-1 in sdhb-1(R244H) mutants. egl-9(sa307) mutants defective for prolyl hydroxylase function were used as a positive control. A representative measurement is shown; for the ASA reference gene, we used the ubiquitously expressed cdc42 in all assays. For statistical analysis, Student’s t-test was applied, *** p < 0.001, N.S.: not significant, n = 3. Error bars represent S.D.
Figure 1. Analyzing pseudohypoxia in sdhb-1(R244H) mutants: analyzing the expression of HIF-1 target genes. (A,B) Semi-quantitative RT-PCR detected elevated mRNA levels of the LDHA homolog ldh-1, the VEGFA homolog pvf-1, and the NDRG1 homolog Y48G10A.3 in sdhb-1(R244H) mutants compared with WT worms (N2). (C) SYBR Green assay confirmed upregulation of ldh-1 and pvf-1 in sdhb-1(R244H) mutants. egl-9(sa307) mutants defective for prolyl hydroxylase function were used as a positive control. A representative measurement is shown; for the ASA reference gene, we used the ubiquitously expressed cdc42 in all assays. For statistical analysis, Student’s t-test was applied, *** p < 0.001, N.S.: not significant, n = 3. Error bars represent S.D.
Ijms 26 10185 g001
Ijms 26 10185 g002
Figure 2. Pseudohypoxia is activated in sdhb-1(R244H) mutants. (A) cysteine synthase-like 2 (cysl-2) is a direct target of HIF-1; elevated cysl-2::GFP transgene expression is a marker of HIF-1 activity. HIF-1 becomes constitutively active in cysl-2::GFP; egl-9(sa307) mutants are defective for prolyl hydroxylase. cysl-2::GFP expression is also increased in sdhb-1(R244H) mutant background indicating activation of pseudohypoxia under normoxic conditions in these mutants. (B), Graphical representation of fluorescence intensity was quantified using Image J (for statistical analysis Mann–Whitney test was applied, *** p < 0.001).
Figure 2. Pseudohypoxia is activated in sdhb-1(R244H) mutants. (A) cysteine synthase-like 2 (cysl-2) is a direct target of HIF-1; elevated cysl-2::GFP transgene expression is a marker of HIF-1 activity. HIF-1 becomes constitutively active in cysl-2::GFP; egl-9(sa307) mutants are defective for prolyl hydroxylase. cysl-2::GFP expression is also increased in sdhb-1(R244H) mutant background indicating activation of pseudohypoxia under normoxic conditions in these mutants. (B), Graphical representation of fluorescence intensity was quantified using Image J (for statistical analysis Mann–Whitney test was applied, *** p < 0.001).
Ijms 26 10185 g002
Ijms 26 10185 g003
Figure 3. Effect of sdhb-1 null mutation and Arg244His point mutation on ROS content detected by DHE staining. (A) Representative photomicrographs showing the level of ROS in N2, WTR, and R244H strains of C. elegans at the young adult stage (scale bar 50 μm). (B) Graphical representation of fluorescence intensity quantified using Image J software (for statistical analysis one way ANOVA (Tukey’s post hoc test was applied; n = 10; * p < 0.05, *** p < 0.001, and ns—non-significant; a.u.—arbitrary unit). (C) Representative photomicrographs showing the level of ROS in N2 and sdhb-1(gk165) mutant strains of C. elegans at L2 larval stage (scale bar 50 μm). (D) Graphical representation of fluorescence intensity quantified using Image J software (for statistical analysis one way ANOVA (Tukey’s post hoc test was applied; n = 10; ** p < 0.01, *** p < 0.001, and ns—non-significant; a.u.—arbitrary unit).
Figure 3. Effect of sdhb-1 null mutation and Arg244His point mutation on ROS content detected by DHE staining. (A) Representative photomicrographs showing the level of ROS in N2, WTR, and R244H strains of C. elegans at the young adult stage (scale bar 50 μm). (B) Graphical representation of fluorescence intensity quantified using Image J software (for statistical analysis one way ANOVA (Tukey’s post hoc test was applied; n = 10; * p < 0.05, *** p < 0.001, and ns—non-significant; a.u.—arbitrary unit). (C) Representative photomicrographs showing the level of ROS in N2 and sdhb-1(gk165) mutant strains of C. elegans at L2 larval stage (scale bar 50 μm). (D) Graphical representation of fluorescence intensity quantified using Image J software (for statistical analysis one way ANOVA (Tukey’s post hoc test was applied; n = 10; ** p < 0.01, *** p < 0.001, and ns—non-significant; a.u.—arbitrary unit).
Ijms 26 10185 g003
Ijms 26 10185 g004
Figure 4. CellROX Green staining shows increased ROS levels in sdhb-1(R244H) mutants at the basal state. (A) In total, 37 wild-type and 37 mutant young adult sdhb-1(R244H) mutants were stained by CellROX Green and analyzed by epifluorescent microscopy (n = 37). (B) The boxplot shows a significant increase in fluorescence in R244H mutants compared with WT worms. Two-sample t-test was used to compare wild-type and mutant animals (***: p < 0.001).
Figure 4. CellROX Green staining shows increased ROS levels in sdhb-1(R244H) mutants at the basal state. (A) In total, 37 wild-type and 37 mutant young adult sdhb-1(R244H) mutants were stained by CellROX Green and analyzed by epifluorescent microscopy (n = 37). (B) The boxplot shows a significant increase in fluorescence in R244H mutants compared with WT worms. Two-sample t-test was used to compare wild-type and mutant animals (***: p < 0.001).
Ijms 26 10185 g004
Ijms 26 10185 g005
Figure 5. Effect of sdhb-1 null mutation and Arg244His point mutation on antioxidant enzyme expression, mitophagy, and apoptosis markers. (A) Expression of sod-1, sod-2, and sod-3 in the L2 larval stage of sdhb-1(gk165) mutant and young adult stage of WTR and R244H strains in comparison with stage-specific wild-type controls (one way ANOVA (Tukey’s post hoc test) n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001, and ns—non-significant). (B) Expression of pink-1 and pdr-1 in the L2 larval stage of sdhb-1(gk165) mutant and young adult stage of WTR and R244H strains in comparison with stage-specific wild-type controls (** p < 0.01, *** p < 0.001, and ns—non-significant). (C) Expression of ced-1 and ced-2 in the L2 larval stage of sdhb-1(gk165) mutant and young adult stage of WTR and R244H strains in comparison with stage-specific wild-type controls (ns—non-significant). For statistical analysis, one way ANOVA (Tukey’s post hoc test) was applied; n = 3.
Figure 5. Effect of sdhb-1 null mutation and Arg244His point mutation on antioxidant enzyme expression, mitophagy, and apoptosis markers. (A) Expression of sod-1, sod-2, and sod-3 in the L2 larval stage of sdhb-1(gk165) mutant and young adult stage of WTR and R244H strains in comparison with stage-specific wild-type controls (one way ANOVA (Tukey’s post hoc test) n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001, and ns—non-significant). (B) Expression of pink-1 and pdr-1 in the L2 larval stage of sdhb-1(gk165) mutant and young adult stage of WTR and R244H strains in comparison with stage-specific wild-type controls (** p < 0.01, *** p < 0.001, and ns—non-significant). (C) Expression of ced-1 and ced-2 in the L2 larval stage of sdhb-1(gk165) mutant and young adult stage of WTR and R244H strains in comparison with stage-specific wild-type controls (ns—non-significant). For statistical analysis, one way ANOVA (Tukey’s post hoc test) was applied; n = 3.
Ijms 26 10185 g005
Ijms 26 10185 g006
Figure 6. The 25 nM fluopyram treatment selectively affects the development of sdhb-1(R244H) mutants. Development of wild-type (N2) animals (light green) and sdhb-1(gk165) null mutants (dark green) are not influenced by 25 nM fluopyram. R244H mutants (blue), which reach adult stage on the control plates, are arrested in the L2 larval stage (e.g., null mutant phenotype) in response to fluopyram treatment at day 7. Statistical analysis was performed by the Wilcoxon test, *** p < 0.001.
Figure 6. The 25 nM fluopyram treatment selectively affects the development of sdhb-1(R244H) mutants. Development of wild-type (N2) animals (light green) and sdhb-1(gk165) null mutants (dark green) are not influenced by 25 nM fluopyram. R244H mutants (blue), which reach adult stage on the control plates, are arrested in the L2 larval stage (e.g., null mutant phenotype) in response to fluopyram treatment at day 7. Statistical analysis was performed by the Wilcoxon test, *** p < 0.001.
Ijms 26 10185 g006
Ijms 26 10185 g007
Figure 7. (A) Re-docking of flutolanil to PDB:4ytp. The red molecule is the crystallographic and the blue is the docked binding mode. (B) The homology model of the Caenorhabditis elegans mitochondrial complex II in complex with fluopyram. On the left, the whole protein complex is shown with a gray cartoon, the heme is represented as green sticks, the FeS clusters as yellow and orange spheres, and the bound fluopyram as blue spheres. On the right, a close-up of the fluopyram binding site is shown, and the interacting amino acids are shown as gray sticks. The highlighted amino acids are identical to C chain W35, M41, and D chain Y91 in the PDB:4ytp structure. The binding mode of fluopyram to the wild-type protein is shown as teal sticks, and to the mutant protein as purple sticks.
Figure 7. (A) Re-docking of flutolanil to PDB:4ytp. The red molecule is the crystallographic and the blue is the docked binding mode. (B) The homology model of the Caenorhabditis elegans mitochondrial complex II in complex with fluopyram. On the left, the whole protein complex is shown with a gray cartoon, the heme is represented as green sticks, the FeS clusters as yellow and orange spheres, and the bound fluopyram as blue spheres. On the right, a close-up of the fluopyram binding site is shown, and the interacting amino acids are shown as gray sticks. The highlighted amino acids are identical to C chain W35, M41, and D chain Y91 in the PDB:4ytp structure. The binding mode of fluopyram to the wild-type protein is shown as teal sticks, and to the mutant protein as purple sticks.
Ijms 26 10185 g007
Ijms 26 10185 g008
Figure 8. SDHB-1 is ubiquitously expressed along with DAT-1 throughout worm development. (A) Confocal microscopy images of SDHB-1 and DAT-1 expression at the embryo stage of dat-1::gfp x sdhb-1::mCherry worm development. Scale bar: 25 µm. (B) Confocal microscopy images of SDHB-1 and DAT-1 expression at the 48 h stage of dat-1::gfp x sdhb-1::mCherry worm development. Scale bar: 50 µm. (C) Confocal microscopy images of SDHB-1 and DAT-1 expressions at the day 13 stage of dat-1::gfp x sdhb-1::mCherry worm development. n = 3.
Figure 8. SDHB-1 is ubiquitously expressed along with DAT-1 throughout worm development. (A) Confocal microscopy images of SDHB-1 and DAT-1 expression at the embryo stage of dat-1::gfp x sdhb-1::mCherry worm development. Scale bar: 25 µm. (B) Confocal microscopy images of SDHB-1 and DAT-1 expression at the 48 h stage of dat-1::gfp x sdhb-1::mCherry worm development. Scale bar: 50 µm. (C) Confocal microscopy images of SDHB-1 and DAT-1 expressions at the day 13 stage of dat-1::gfp x sdhb-1::mCherry worm development. n = 3.
Ijms 26 10185 g008
Ijms 26 10185 g009
Figure 9. Correlation between SDHB-1 activity and dopaminergic neuronal health. (A) Representative fluorescent images showing the expression of SDHB-1::mCherry and DAT-1::GFP in day 3 worms upon transient exposure to 6-OHDA (100 mM) during the early larval stage; the white box shows the digitally magnified image of the region under investigation; scale bar: 50 µm. (B) Quantification of fluorescence intensity pertaining to SDHB-1::mCherry expression (for statistical analysis two-tailed Student’s t-test was applied; n = 20 worms per condition; ns: non-significant and ** p < 0.01; a.u.—arbitrary unit). (C) Graphical representation of response time against 1-nonanol, a known repellent used to assess dopaminergic health (two-tailed Student’s t-test for statistical analysis; n = 10 worms per condition; ns: non-significant, * p < 0.05, and *** p < 0.001). (D) Graphical representation of the number of thrashes made by the worm in 10 s (one way ANOVA (Tukey’s post hoc test) n = 20 worms per condition; ns: non-significant and *** p < 0.001).
Figure 9. Correlation between SDHB-1 activity and dopaminergic neuronal health. (A) Representative fluorescent images showing the expression of SDHB-1::mCherry and DAT-1::GFP in day 3 worms upon transient exposure to 6-OHDA (100 mM) during the early larval stage; the white box shows the digitally magnified image of the region under investigation; scale bar: 50 µm. (B) Quantification of fluorescence intensity pertaining to SDHB-1::mCherry expression (for statistical analysis two-tailed Student’s t-test was applied; n = 20 worms per condition; ns: non-significant and ** p < 0.01; a.u.—arbitrary unit). (C) Graphical representation of response time against 1-nonanol, a known repellent used to assess dopaminergic health (two-tailed Student’s t-test for statistical analysis; n = 10 worms per condition; ns: non-significant, * p < 0.05, and *** p < 0.001). (D) Graphical representation of the number of thrashes made by the worm in 10 s (one way ANOVA (Tukey’s post hoc test) n = 20 worms per condition; ns: non-significant and *** p < 0.001).
Ijms 26 10185 g009
Table 1. Primers used for single worm qRT-PCR experiments.
Table 1. Primers used for single worm qRT-PCR experiments.
Gene NamePrimer Sequences
act-1Forward Primer: TTACTCTTTCACCACCACCGCTGA
Reverse Primer: TCGTTTCCGACGGTGATGACTTGT
od-1Forward Primer: CCAGGCAGTTATTGAAGGAGAA
Reverse Primer: TGTGGACCGGCAGAAATG
sod-2Forward Primer: GAGGCGGTCTCCAAAGGAAA
Reverse Primer: CCAGAGATCCGAAGTCGCTC
sod-3Forward Primer: CTCCAAGCACACTCTCCCAG
Reverse Primer: TCCCTTTCGAAACAGCCTCG
pink-1Forward Primer: AGTCGTCTGGACAAAGTGATG
Reverse Primer: TTGCTCGAAGTTGTCGTTCT
pdr-1Forward Primer: CAGACGTCGTACAGCGAATAC
Reverse Primer: TCATAGGGCTCCCAGAAGAA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ősz, F.; Akbar, M.; Zsidó, B.Z.; Hetényi, C.; Orbán, T.I.; Fóthi, Á.; Kovács, G.M.; Pintye, A.; Boda, A.; Nazir, A.; et al. The Caenorhabditis elegans sdhb-1(R244H) Model Shows Characteristics of Human PPGL Tumor Cells. Int. J. Mol. Sci. 2025, 26, 10185. https://doi.org/10.3390/ijms262010185

AMA Style

Ősz F, Akbar M, Zsidó BZ, Hetényi C, Orbán TI, Fóthi Á, Kovács GM, Pintye A, Boda A, Nazir A, et al. The Caenorhabditis elegans sdhb-1(R244H) Model Shows Characteristics of Human PPGL Tumor Cells. International Journal of Molecular Sciences. 2025; 26(20):10185. https://doi.org/10.3390/ijms262010185

Chicago/Turabian Style

Ősz, Fanni, Mahmood Akbar, Balázs Zoltán Zsidó, Csaba Hetényi, Tamás I. Orbán, Ábel Fóthi, Gábor M. Kovács, Alexandra Pintye, Attila Boda, Aamir Nazir, and et al. 2025. "The Caenorhabditis elegans sdhb-1(R244H) Model Shows Characteristics of Human PPGL Tumor Cells" International Journal of Molecular Sciences 26, no. 20: 10185. https://doi.org/10.3390/ijms262010185

APA Style

Ősz, F., Akbar, M., Zsidó, B. Z., Hetényi, C., Orbán, T. I., Fóthi, Á., Kovács, G. M., Pintye, A., Boda, A., Nazir, A., Farkas, Z., & Takács-Vellai, K. (2025). The Caenorhabditis elegans sdhb-1(R244H) Model Shows Characteristics of Human PPGL Tumor Cells. International Journal of Molecular Sciences, 26(20), 10185. https://doi.org/10.3390/ijms262010185

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop