Mechanism of Transcription Factor ChbZIP1 Enhanced Alkaline Stress Tolerance in Chlamydomonas reinhardtii
Round 1
Reviewer 1 Report
Comments and Suggestions for AuthorsReviewer's Comments:
The manuscript "Mechanism of Transcription Factor ChbZIP1 Enhanced Alkaline Stress Tolerance in Chlamydomonas reinhardtii" presents a significant contribution to the field by elucidating the mechanisms through which ChbZIP1 improves alkaline tolerance in microalgae. It is well-designed, and the data are robust, supporting the conclusions drawn. Overall, I am impressed with the quality of the research and the significance of the findings. Here are the comments and suggestions for the minor revisions.
1. Some of the figures included in the manuscript have a relatively low resolution, which affects the clarity and quality of the visual information presented. Please provide high-quality images, especially Figure 1B and Figure 9, to ensure that all figures are of sufficient quality to be clearly understood without the need for magnification.
2. Please add the primers for the internal gene (Receptor of activated protein kinase C, Cre06.g278222) of real-time quantitative PCR to Table 1.
3. Formatting Issue: Spacing Between Numbers and Units. Please review the entire manuscript and ensure that there is a consistent thin space between all numbers and their corresponding units. For example, instead of writing "500bp", it should be formatted as "500 bp".
4. Please verify and standardize the units for tBOOH in the manuscript. The text currently contains both "50 μM tBOOH" and "50 μmol tBOOH," which need to be checked and unified throughout the manuscript.
Author Response
Comment 1: The manuscript "Mechanism of Transcription Factor ChbZIP1 Enhanced Alkaline Stress Tolerance in Chlamydomonas reinhardtii" presents a significant contribution to the field by elucidating the mechanisms through which ChbZIP1 improves alkaline tolerance in microalgae. It is well-designed, and the data are robust, supporting the conclusions drawn. Overall, I am impressed with the quality of the research and the significance of the findings. Here are the comments and suggestions for the minor revisions.
Response 1: Thank you very much for your insightful comments and appreciation of our manuscript! According to your suggestion, we have carefully revised the manuscript, and the details are as follows. The modifications have been highlighted in yellow.
Comment 2: Some of the figures included in the manuscript have a relatively low resolution, which affects the clarity and quality of the visual information presented. Please provide high-quality images, especially Figure 1B and Figure 9, to ensure that all figures are of sufficient quality to be clearly understood without the need for magnification.
Response 2: This issue may have been caused by the different versions of Word we used and the scaling ratio during writing, leading to a misjudgment. We are very grateful that you have pointed out this problem. In response, we have made the following improvements. First, we checked all the images to ensure that their resolution meets or exceeds 600 dpi, and updated the images that did not meet this requirement. For Figure 1, we have re-edited Figure 1B, bolded the font, and adjusted the length of the branches to enhance its visibility without altering the original information presented. Also, we have reformatted Figure 1 to further increase its aesthetic appeal. Regarding the heatmap in Figure 3, we have re-uploaded the image, increased its resolution, and enlarged the font. For the issues with Figure 9, we have adopted the following strategies for modification, including enlarging and bolding the font, optimizing the layout, and enlarging important information. All of these modifications should ensure that the quality of all images is sufficient, and they can be clearly understood without the need for magnification.
Comment 3: Please add the primers for the internal gene (Receptor of activated protein kinase C, Cre06.g278222) of real-time quantitative PCR to Table 1.
Response 3: Thanks for reminding us. We have added the corresponding primer sequences in Table S1 of the supplementary file, as follows:
CBLP- qPCR-F GACGACCTGCGCCCCGAGTT
CBLP- qPCR-R AGGCGCGGCTGGGCATTTAC
Comment 4: Formatting Issue: Spacing Between Numbers and Units. Please review the entire manuscript and ensure that there is a consistent thin space between all numbers and their corresponding units. For example, instead of writing "500bp", it should be formatted as "500 bp".
Response 4: We apologize for the errors and have carefully reviewed and made the necessary corrections throughout the manuscript. The changes include:
Line 124: Changed "10 μm";
Line 174-176: Changed "10 μL" and "250 μ mol photonsm-2s-1";
Line 355: Changed "12 h";
Line 506: Changed "120 rpm";
Line 510: Changed "500 bp";
Line 525: Changed "5 µL";
Lines 528: Changed "539-591 nm";
Line 537: Changed "2.5 mM";
Line 576: Changed "696 nm".
We have also conducted the aforementioned checks on the supplementary files and have made the corrections to any errors found.
Comment 5: Please verify and standardize the units for tBOOH in the manuscript. The text currently contains both "50 μM tBOOH" and "50 μmol tBOOH," which need to be checked and unified throughout the manuscript.
Response 5: Thanks for the suggestion. We have decided to standardize the unit of tBOOH usage to μmol and have checked and unified throughout the manuscript.
Author Response File: 
Author Response.pdf
Reviewer 2 Report
Comments and Suggestions for AuthorsDear Authors,
I have reviewed the manuscript.
The topic of the manuscript is to investigate the mechanisms underlying the alkalinity tolerance of microalgae and offers new insights and theoretical basis for the use of microalgae in alkaline environments, in particular with the transcription factor ChbZIP1.
The manuscript covers a good topic, for which there is not much research yet and fits the theme of the journal, so I think it is worth addressing.
The topic is novel as the genetic study of microalgae in pH tolerance is a very interesting and new topic.
My observations are as follows:
The manuscript is adequate, absolutely. I make one small suggestion: for the Discussion chapter, it would be worthwhile to break the results down into topics and create subchapters.
Tables and figures are appropriate.
Author Response
Comment: I have reviewed the manuscript. The topic of the manuscript is to investigate the mechanisms underlying the alkalinity tolerance of microalgae and offers new insights and theoretical basis for the use of microalgae in alkaline environments, in particular with the transcription factor ChbZIP1. The manuscript covers a good topic, for which there is not much research yet and fits the theme of the journal, so I think it is worth addressing. The topic is novel as the genetic study of microalgae in pH tolerance is a very interesting and new topic. My observations are as follows: The manuscript is adequate, absolutely. I make one small suggestion: for the Discussion chapter, it would be worthwhile to break the results down into topics and create subchapters. Tables and figures are appropriate.
Response: Thanks for the positive evaluation of our manuscript!
Regarding your suggestion, we have discussed it. The primary consideration for the previous manuscript's decision to present the results of the discussion section as a whole is that the various results are not isolated but rather interact with each other, revealing not just a single regulatory pathway but also the interplay between different pathways. However, this does sacrifice the intuitiveness of the viewpoints, making the discussion appear complex and lengthy. In order to reduce the reading difficulty for audience and prevent confusion, we have decided to follow your suggestion and make improvements accordingly.
We have chosen to divide the discussion section into four main discussion modules, each with the following subtitles:
Line 379-380: 3.1. ChbZIP1 improves the extensive stress resistance of C. reinhardtii, especially the alkali re-sistance;
Line 413-414: 3.2. ChbZIP1 enhanced photosynthesis, enhances carbon dioxide concentration, promotes organic matter synthesis and reduces ROS production;
Line 441-442: 3.3. ChbZIP1 alters carbon flow distribution to synthesize lipids and increases fatty acid unsatura-tion to repair cell membrane structure;
Line 475-476: 3.4. ChbZIP1 enhances the detoxification ability of ROS, maintains cell homeostasis and reduces cell structural damage;
The original text content remains unchanged; the added subtitles can help readers understand the shifts in the focus of the discussion. The modifications have been highlighted in yellow.
Author Response File: Author Response.pdf
