Neuroprotective Effects of VEGF-B in a Murine Model of Aggressive Neuronal Loss with Childhood Onset
Abstract
1. Introduction
2. Results
2.1. Changes in Gene and Protein Expression of Neurotrophic Factors
2.2. Expression of IGF-1 and VEGF-B Receptors in PCD Mice
2.3. rhIGF-1 Treatment
2.3.1. The Treatment with rhIGF-1 Does Not Improve Memory Impairments of PCD Mice
2.3.2. rhIGF-1 Administration Does Not Normalize Social Behavior
2.3.3. Effect of Treatment on Motor Coordination
2.3.4. rhIGF-1 Treatment Does Not Prevent the Purkinje Cell Death in PCD Mice
2.4. rhVEGF-B Treatment
2.4.1. rhVEGF-B Treatment Normalizes Memory Impairment
2.4.2. Normal Social Behavior Is Maintained After rhVEGF-B Administration
2.4.3. Effect of Treatment on Motor Coordination
2.4.4. rhVEGF-B Administration Decreases Purkinje Cell Death
Analyses at P30
Analyses at P25
2.5. Treatment with rhVEGF-B Does Not Lead to Improvements in Skeletal Muscle
2.6. Chronic Administration of rhVEGF-B Did Not Prevent Purkinje Cell Death
3. Discussion
3.1. Searching for Neurotrophic Factors with Potential Therapeutic Use: Alterations in IGF-1 and VEGF-B Expression in the PCD Mutant Mouse
3.2. rhIGF-1 Treatment Does Not Provide a Neuroprotective Effect in PCD Mice
3.3. Treatment with rhVEGF-B Has a Neuroprotective Effect in PCD Mice
3.4. Overdosage of rhVEGF-B Has Adverse Effects in the PCD Mutant Mouse
4. Materials and Methods
4.1. Animals
4.2. Experimental Procedure
4.3. Molecular Analyses
4.3.1. Gene Analyses
4.3.2. Protein Analyses
4.4. Drug Administration
4.5. Behavioral Analyses
4.6. Histological and Cytological Analyses
4.6.1. Tissue Extraction and Processing
4.6.2. Microscopy Visualization and Quantifications
4.7. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Shashi, V.; Magiera, M.M.; Klein, D.; Zaki, M.; Schoch, K.; Rudnik-Schöneborn, S.; Norman, A.; Neto, O.L.A.; Dusl, M.; Yuan, X.; et al. Loss of tubulin deglutamylase CCP 1 causes infantile-onset neurodegeneration. EMBO J. 2018, 37, e100540. [Google Scholar] [CrossRef] [PubMed]
- Sheffer, R.; Gur, M.; Brooks, R.; Salah, S.; Daana, M.; Fraenkel, N.; Eisenstein, E.; Rabie, M.; Nevo, Y.; Jalas, C.; et al. Biallelic variants in AGTPBP1, involved in tubulin deglutamylation, are associated with cerebellar degeneration and motor neuropathy. Eur. J. Hum. Genet. 2019, 27, 1419–1426. [Google Scholar] [CrossRef] [PubMed]
- Karakaya, M.; Paketci, C.; Altmueller, J.; Thiele, H.; Hoelker, I.; Yis, U.; Wirth, B. Biallelic variant in AGTPBP1 causes infantile lower motor neuron degeneration and cerebellar atrophy. Am. J. Med. Genet. Part A 2019, 179, 1580–1584. [Google Scholar] [CrossRef] [PubMed]
- Baltanás, F.C.; Berciano, M.T.; Santos, E.; Lafarga, M. The Childhood-Onset Neurodegeneration with Cerebellar Atrophy (CONDCA) Disease Caused by AGTPBP1 Gene Mutations: The Purkinje Cell Degeneration Mouse as an Animal Model for the Study of this Human Disease. Biomedicines 2021, 9, 1157. [Google Scholar] [CrossRef]
- Berezniuk, I.; Vu, H.T.; Lyons, P.J.; Sironi, J.J.; Xiao, H.; Burd, B.; Setou, M.; Angeletti, R.H.; Ikegami, K.; Fricker, L.D. Cytosolic carboxypeptidase 1 is involved in processing alpha- and beta-tubulin. J. Biol. Chem. 2012, 287, 6503–6517. [Google Scholar] [CrossRef]
- Muñoz-Castañeda, R.; Díaz, D.; Peris, L.; Andrieux, A.; Bosc, C.; Muñoz-Castañeda, J.M.; Janke, C.; Alonso, J.R.; Moutin, M.-J.; Weruaga, E. Cytoskeleton stability is essential for the integrity of the cerebellum and its motor- and affective-related behaviors. Sci. Rep. 2018, 8, 3072. [Google Scholar] [CrossRef]
- Mullen, R.J.; Eicher, E.M.; Sidman, R.L. Purkinje cell degeneration, a new neurological mutation in the mouse. Proc. Natl. Acad. Sci. USA 1976, 73, 208–212. [Google Scholar] [CrossRef]
- Blanks, J.C.; Mullen, R.J.; LaVail, M.M. Retinal degeneration in the pcd cerebellar mutant mouse. II. Electron microscopic analysis. J. Comp. Neurol. 1982, 212, 231–246. [Google Scholar] [CrossRef]
- Greer, C.A.; Shepherd, G.M. Mitral cell degeneration and sensory function in the neurological mutant mouse Purkinje cell degeneration (PCD). Brain Res. 1982, 235, 156–161. [Google Scholar] [CrossRef]
- Fernandez-Gonzalez, A.; Spada, A.R.L.; Treadaway, J.; Higdon, J.C.; Harris, B.S.; Sidman, R.L.; Morgan, J.I.; Zuo, J. Purkinje cell degeneration (pcd) phenotypes caused by mutations in the axotomy-induced gene, Nna1. Science 2002, 295, 1904–1906. [Google Scholar] [CrossRef]
- Ford, G.D.; Ford, B.D.; Steele, E.C.; Gates, A.; Hood, D.; Matthews, M.A.; Mirza, S.; MacLeish, P.R. Analysis of transcriptional profiles and functional clustering of global cerebellar gene expression in PCD3J mice. Biochem. Biophys. Res. Commun. 2008, 377, 556–561. [Google Scholar] [CrossRef] [PubMed]
- Baltanás, F.C.; Casafont, I.; Weruaga, E.; Alonso, J.R.; Berciano, M.T.; Lafarga, M. Nucleolar disruption and cajal body disassembly are nuclear hallmarks of DNA damage-induced neurodegeneration in purkinje cells. Brain Pathol. 2010, 21, 374–388. [Google Scholar] [CrossRef] [PubMed]
- Baltanás, F.C.; Casafont, I.; Lafarga, V.; Weruaga, E.; Alonso, J.R.; Berciano, M.T.; Lafarga, M. Purkinje cell degeneration in pcd mice reveals large scale chromatin reorganization and gene silencing linked to defective DNA repair. J. Biol. Chem. 2011, 286, 28287–28302. [Google Scholar] [CrossRef] [PubMed]
- Baltanás, F.C.; Berciano, M.T.; Tapia, O.; Narcis, J.O.; Lafarga, V.; Díaz, D.; Weruaga, E.; Santos, E.; Lafarga, M. Nucleolin reorganization and nucleolar stress in Purkinje cells of mutant PCD mice. Neurobiol. Dis. 2019, 127, 312–322. [Google Scholar] [CrossRef]
- Landis, S.C.; Mullen, R.J. The development and degeneration of Purkinje cells in pcd mutant mice. J. Comp. Neurol. 1978, 177, 125–143. [Google Scholar] [CrossRef]
- Li, J.; Gu, X.; Ma, Y.; Calicchio, M.L.; Kong, D.; Teng, Y.D.; Yu, L.; Crain, A.M.; Vartanian, T.K.; Pasqualini, R.; et al. Nna1 mediates Purkinje cell dendritic development via lysyl oxidase propeptide and NF-kappaB signaling. Neuron 2010, 68, 45–60. [Google Scholar] [CrossRef]
- Zhou, L.; Hossain, M.I.; Yamazaki, M.; Abe, M.; Natsume, R.; Konno, K.; Kageyama, S.; Komatsu, M.; Watanabe, M.; Sakimura, K.; et al. Deletion of exons encoding carboxypeptidase domain of Nna1 results in Purkinje cell degeneration (pcd) phenotype. J. Neurochem. 2018, 147, 557–572. [Google Scholar] [CrossRef]
- Le Marec, N.; Lalonde, R. Sensorimotor learning and retention during equilibrium tests in Purkinje cell degeneration mutant mice. Brain Res. 1997, 768, 310–316. [Google Scholar] [CrossRef]
- Díaz, D.; Piquer-Gil, M.; Recio, J.S.; Martínez-Losa, M.M.; Alonso, J.R.; Weruaga, E.; Álvarez-Dolado, M. Bone marrow transplantation improves motor activity in a mouse model of ataxia. J. Tissue Eng. Regen. Med. 2018, 12, e1950–e1961. [Google Scholar] [CrossRef]
- Pérez-Martín, E.; Muñoz-Castañeda, R.; Moutin, M.-J.; Ávila-Zarza, C.A.; Muñoz-Castañeda, J.M.; Del Pilar, C.; Alonso, J.R.; Andrieux, A.; Díaz, D.; Weruaga, E. Oleoylethanolamide Delays the Dysfunction and Death of Purkinje Cells and Ameliorates Behavioral Defects in a Mouse Model of Cerebellar Neurodegeneration. Neurotherapeutics 2021, 18, 1748–1767. [Google Scholar] [CrossRef]
- Pérez-Martín, E.; Pérez-Revuelta, L.; Barahona-López, C.; Pérez-Boyero, D.; Alonso, J.R.; Díaz, D.; Weruaga, E. Oleoylethanolamide Treatment Modulates Both Neuroinflammation and Microgliosis, and Prevents Massive Leukocyte Infiltration to the Cerebellum in a Mouse Model of Neuronal Degeneration. Int. J. Mol. Sci. 2023, 24, 9691. [Google Scholar] [CrossRef] [PubMed]
- Díaz, D.; Lepousez, G.; Gheusi, G.; Alonso, J.R.; Lledo, P.-M.; Weruaga, E. Bone marrow cell transplantation restores olfaction in the degenerated olfactory bulb. J. Neurosci. 2012, 32, 9053–9058. [Google Scholar] [CrossRef] [PubMed]
- Díaz, D.; Pilar, C.; Carretero, J.; Alonso, J.R.; Weruaga, E. Daily bone marrow cell transplantations for the management of fast neurodegenerative processes. J. Tissue Eng. Regen. Med. 2019, 13, 1702–1711. [Google Scholar] [CrossRef] [PubMed]
- Ledda, F.; Paratcha, G. Assembly of Neuronal Connectivity by Neurotrophic Factors and Leucine-Rich Repeat Proteins. Front. Cell. Neurosci. 2016, 10, 199. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, A.M.; O’Keeffe, G.W. Neurotrophic factor therapy for Parkinson’s disease: Past, present and future. Neural. Regen. Res. 2016, 11, 205–207. [Google Scholar] [CrossRef]
- Fernandez, A.M.; Carro, E.M.; Lopez-Lopez, C.; Torres-Aleman, I. Insulin-like growth factor I treatment for cerebellar ataxia: Addressing a common pathway in the pathological cascade? Brain Res. Brain Res. Rev. 2005, 50, 134–141. [Google Scholar] [CrossRef]
- Colucci-D’amato, L.; Speranza, L.; Volpicelli, F. Neurotrophic Factor BDNF, Physiological Functions and Therapeutic Potential in Depression, Neurodegeneration and Brain Cancer. Int. J. Mol. Sci. 2020, 21, 7777. [Google Scholar] [CrossRef]
- Carro, E.; Trejo, J.L.; Busiguina, S.; Torres-Aleman, I. Circulating insulin-like growth factor I mediates the protective effects of physical exercise against brain insults of different etiology and anatomy. J. Neurosci. 2001, 21, 5678–5684. [Google Scholar] [CrossRef]
- Nahm, S.-S.; Frank, T.C.; Browning, M.D.; Sepulvado, J.M.; Hiney, J.K.; Abbott, L.C. Insulin-like growth factor-I improves cerebellar dysfunction but does not prevent cerebellar neurodegeneration in the calcium channel mutant mouse, leaner. Neurobiol. Dis. 2003, 14, 157–165. [Google Scholar] [CrossRef]
- Carrascosa, C.; Torres-Aleman, I.; Lopez-Lopez, C.; Carro, E.; Espejo, L.; Torrado, S.; Torrado, J. Microspheres containing insulin-like growth factor I for treatment of chronic neurodegeneration. Biomaterials 2004, 25, 707–714. [Google Scholar] [CrossRef]
- Morton, D.B.; Jennings, M.; Buckwell, A.; Ewbank, R.; Godfrey, C.; Holgate, B.; Inglis, I.; James, R.; Page, C.; Sharman, I.; et al. Refining procedures for the administration of substances. Report of the BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. British Veterinary Association Animal Welfare Foundation/Fund for the Replacement of Animals in Medical Experiments/Royal Society for the Prevention of Cruelty to Animals/Universities Federation for Animal Welfare. Lab. Anim. 2001, 35, 1–41. [Google Scholar] [PubMed]
- Milne, S.C.; Corben, L.A.; Yiu, E.; Delatycki, M.B.; Georgiou-Karistianis, N. Gastrocnemius and soleus spasticity and muscle length in Friedreich’s ataxia. J. Clin. Neurosci. 2016, 29, 29–34. [Google Scholar] [CrossRef] [PubMed]
- Bach, M.A.; Shen-Orr, Z.; Lowe, W.L.; Roberts, C.T.; Leroith, D. Insulin-like growth factor I mRNA levels are developmentally regulated in specific regions of the rat brain. Mol. Brain Res. 1991, 10, 43–48. [Google Scholar] [CrossRef] [PubMed]
- Bondy, C.; Lee, W. Correlation between insulin-like growth factor (IGF)-binding protein 5 and IGF-I gene expression during brain development. J. Neurosci. 1993, 13, 5092–5104. [Google Scholar] [CrossRef]
- Fernandez, A.M.; Torres-Alemán, I. The many faces of insulin-like peptide signalling in the brain. Nat. Rev. Neurosci. 2012, 13, 225–239. [Google Scholar] [CrossRef]
- Botusan, I.R.; Zheng, X.; Narayanan, S.; Grünler, J.; Sunkari, V.G.; Calissendorff, F.S.; Ansurudeen, I.; Illies, C.; Svensson, J.; Jansson, J.-O.; et al. Deficiency of liver-derived insulin-like growth factor-I (IGF-I) does not interfere with the skin wound healing rate. PLoS ONE 2018, 13, e0193084. [Google Scholar] [CrossRef]
- McMorris, F.A.; Mozell, R.L.; Carson, M.J.; Shinar, Y.; Meyer, R.D.; Marchetti, N.A. Regulation of oligodendrocyte development and central nervous system myelination by insulin-like growth factors. Ann. N. Y. Acad. Sci. 1993, 692, 321–334. [Google Scholar] [CrossRef]
- Yao, D.L.; Liu, X.; Hudson, L.D.; Webster, H.D. Insulin-like growth factor I treatment reduces demyelination and up-regulates gene expression of myelin-related proteins in experimental autoimmune encephalomyelitis. Proc. Natl. Acad. Sci. USA 1995, 92, 6190–6194. [Google Scholar] [CrossRef]
- Laron, Z. Insulin-like growth factor 1 (IGF-1): A growth hormone. Mol. Pathol. 2001, 54, 311–316. [Google Scholar] [CrossRef]
- Yakar, S.; Adamo, M.L. Insulin-like growth factor 1 physiology: Lessons from mouse models. Endocrinol. Metab. Clin. North. Am. 2012, 41, 231–247. [Google Scholar] [CrossRef]
- Falk, T.; Zhang, S.; Sherman, S.J. Vascular endothelial growth factor B (VEGF-B) is up-regulated and exogenous VEGF-B is neuroprotective in a culture model of Parkinson’s disease. Mol. Neurodegener. 2009, 4, 49. [Google Scholar] [CrossRef] [PubMed]
- Nag, S.; Eskandarian, M.R.; Davis, J.; Eubanks, J.H. Differential expression of vascular endothelial growth factor-A (VEGF-A) and VEGF-B after brain injury. J. Neuropathol. Exp. Neurol. 2002, 61, 778–788. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Jin, K.; Childs, J.T.; Xie, L.; Mao, X.O.; Greenberg, D.A. Increased severity of cerebral ischemic injury in vascular endothelial growth factor-B-deficient mice. J. Cereb. Blood Flow Metab. 2004, 24, 1146–1152. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Xu, G.; Wang, Y.; Xu, X.; Liu, X.; Tang, S.; Zhang, F.; Zhang, J.; Tang, L.; Wu, Q.; et al. Safety and efficacy of conbercept in neovascular age-related macular degeneration: Results from a 12-month randomized phase 2 study: AURORA study. Ophthalmology 2014, 121, 1740–1747. [Google Scholar] [CrossRef]
- Li, Y.; Zhang, F.; Nagai, N.; Tang, Z.; Zhang, S.; Scotney, P.; Lennartsson, J.; Zhu, C.; Qu, Y.; Fang, C.; et al. VEGF-B inhibits apoptosis via VEGFR-1–mediated suppression of the expression of BH3-only protein genes in mice and rats. J. Clin. Investig. 2008, 118, 913–923. [Google Scholar] [CrossRef]
- Gillardon, F.; Bäurle, J.; Wickert, H.; Grüsser-Cornehls, U.; Zimmermann, M. Differential regulation of bcl-2, bax, c-fos, junB, and krox-24 expression in the cerebellum of Purkinje cell degeneration mutant mice. J. Neurosci. Res. 1995, 41, 708–715. [Google Scholar] [CrossRef]
- Hurtado-Chong, A.; Yusta-Boyo, M.J.; Vergaño-Vera, E.; Bulfone, A.; De Pablo, F.; Vicario-Abejón, C. IGF-I promotes neuronal migration and positioning in the olfactory bulb and the exit of neuroblasts from the subventricular zone. Eur. J. Neurosci. 2009, 30, 742–755. [Google Scholar] [CrossRef]
- Oishi, K.; Watatani, K.; Itoh, Y.; Okano, H.; Guillemot, F.; Nakajima, K.; Gotoh, Y. Selective induction of neocortical GABAergic neurons by the PDK1-Akt pathway through activation of Mash1. Proc. Natl. Acad. Sci. USA 2009, 106, 13064–13069. [Google Scholar] [CrossRef]
- Ito, M. Cerebellar circuitry as a neuronal machine. Prog. Neurobiol. 2006, 78, 272–303. [Google Scholar] [CrossRef]
- Sillitoe, R.V.; Joyner, A.L. Morphology, molecular codes, and circuitry produce the three-dimensional complexity of the cerebellum. Annu. Rev. Cell Dev. Biol. 2007, 23, 549–577. [Google Scholar] [CrossRef]
- Manto, M.; Bower, J.M.; Conforto, A.B.; Delgado-García, J.M.; Da Guarda, S.N.F.; Gerwig, M.; Habas, C.; Hagura, N.; Ivry, R.B.; Mariën, P.; et al. Consensus paper: Roles of the cerebellum in motor control--the diversity of ideas on cerebellar involvement in movement. Cerebellum 2012, 11, 457–487. [Google Scholar] [CrossRef] [PubMed]
- Reeber, S.L.; Otis, T.S.; Sillitoe, R.V. New roles for the cerebellum in health and disease. Front. Syst. Neurosci. 2013, 7, 83. [Google Scholar] [CrossRef]
- Vožeh, F. Jan Evangelista Purkyne and the cerebellum then and now. Physiol. Res. 2015, 64 (Suppl. 5), S567–S584. [Google Scholar] [CrossRef] [PubMed]
- Carta, I.; Chen, C.H.; Schott, A.L.; Dorizan, S.; Khodakhah, K. Cerebellar modulation of the reward circuitry and social behavior. Science 2019, 363, eaav0581. [Google Scholar] [CrossRef] [PubMed]
- Goodlett, C.R.; Hamre, K.M.; West, J.R. Dissociation of spatial navigation and visual guidance performance in Purkinje cell degeneration (pcd) mutant mice. Behav. Brain Res. 1992, 47, 129–141. [Google Scholar] [CrossRef]
- Tuma, J.; Kolinko, Y.; Vozeh, F.; Cendelin, J. Mutation-related differences in exploratory, spatial, and depressive-like behavior in pcd and Lurcher cerebellar mutant mice. Front. Behav. Neurosci. 2015, 9, 116. [Google Scholar] [CrossRef]
- Hantaï, D.; Akaaboune, M.; Lagord, C.; Murawsky, M.; Houenou, L.; Festoff, B.; Vaught, J.; Rieger, F.; Blondet, B. Beneficial effects of insulin-like growth factor-I on wobbler mouse motoneuron disease. J. Neurol. Sci. 1995, 129, 122–126. [Google Scholar] [CrossRef]
- Zhang, W.; Lee, W.-H.; Triarhou, L.C. Grafted cerebellar cells in a mouse model of hereditary ataxia express IGF–I system genes and partially restore behavioral function. Nat. Med. 1996, 2, 65–71. [Google Scholar] [CrossRef]
- Contreras, P.C.; Vaught, J.L.; Gruner, J.A.; Brosnan, C.; Steffler, C.; Arezzo, J.C.; Lewis, M.E.; Kessler, J.A.; Apfel, S.C. Insulin-like growth factor-I prevents development of a vincristine neuropathy in mice. Brain Res. 1997, 774, 20–26. [Google Scholar] [CrossRef]
- Saatman, K.E.; Contreras, P.C.; Smith, D.H.; Raghupathi, R.; McDermott, K.L.; Fernandez, S.C.; Sanderson, K.L.; Voddi, M.; McIntosh, T.K. Insulin-like growth factor-1 (IGF-1) improves both neurological motor and cognitive outcome following experimental brain injury. Exp. Neurol. 1997, 147, 418–427. [Google Scholar] [CrossRef]
- Fernandez, A.M.; de la Vega, A.G.; Torres-Aleman, I. Insulin-like growth factor I restores motor coordination in a rat model of cerebellar ataxia. Proc. Natl. Acad. Sci. USA 1998, 95, 1253–1258. [Google Scholar] [CrossRef]
- Fernandez, A.M.; de la Vega, A.G.; Planas, B.; Torres-Aleman, I. Neuroprotective actions of peripherally administered insulin-like growth factor I in the injured olivo-cerebellar pathway. Eur. J. Neurosci. 1999, 11, 2019–2030. [Google Scholar] [CrossRef]
- Markowska, A.; Mooney, M.; Sonntag, W. Insulin-like growth factor-1 ameliorates age-related behavioral deficits. Neuroscience 1998, 87, 559–569. [Google Scholar] [CrossRef]
- Lin, Y.-S.; Cheng, W.-L.; Chang, J.-C.; Lin, T.-T.; Chao, Y.-C.; Liu, C.-S. IGF-1 as a Potential Therapy for Spinocerebellar Ataxia Type 3. Biomedicines 2022, 10, 505. [Google Scholar] [CrossRef]
- Nieto-Bona, M.P.; Garcia-Segura, L.M.; Torres-Aleman, I. Orthograde transport and release of insulin-like growth factor I from the inferior olive to the cerebellum. J. Neurosci. Res. 1993, 36, 520–527. [Google Scholar] [CrossRef]
- Carro, E.; Nuñez, A.; Busiguina, S.; Torres-Aleman, I. Circulating insulin-like growth factor I mediates effects of exercise on the brain. J. Neurosci. 2000, 20, 2926–2933. [Google Scholar] [CrossRef]
- Poesen, K.; Lambrechts, D.; Van Damme, P.; Dhondt, J.; Bender, F.; Frank, N.; Bogaert, E.; Claes, B.; Heylen, L.; Verheyen, A.; et al. Novel role for vascular endothelial growth factor (VEGF) receptor-1 and its ligand VEGF-B in motor neuron degeneration. J. Neurosci. 2008, 28, 10451–10459. [Google Scholar] [CrossRef]
- Hagberg, C.E.; Falkevall, A.; Wang, X.; Larsson, E.; Huusko, J.; Nilsson, I.; van Meeteren, L.A.; Samen, E.; Lu, L.; Vanwildemeersch, M.; et al. Vascular endothelial growth factor B controls endothelial fatty acid uptake. Nature 2010, 464, 917–921. [Google Scholar] [CrossRef]
- Dhondt, J.; Peeraer, E.; Verheyen, A.; Nuydens, R.; Buysschaert, I.; Poesen, K.; Van Geyte, K.; Beerens, M.; Shibuya, M.; Haigh, J.J.; et al. Neuronal FLT1 receptor and its selective ligand VEGF-B protect against retrograde degeneration of sensory neurons. FASEB J. 2011, 25, 1461–1473. [Google Scholar] [CrossRef]
- Yue, X.; Hariri, D.; Caballero, B.; Zhang, S.; Bartlett, M.; Kaut, O.; Mount, D.; Wüllner, U.; Sherman, S.; Falk, T. Comparative study of the neurotrophic effects elicited by VEGF-B and GDNF in preclinical in vivo models of Parkinson’s disease. Neuroscience 2013, 258, 385–400. [Google Scholar] [CrossRef]
- Falk, T.; Yue, X.; Zhang, S.; McCourt, A.D.; Yee, B.J.; Gonzalez, R.T.; Sherman, S.J. Vascular endothelial growth factor-B is neuroprotective in an in vivo rat model of Parkinson’s disease. Neurosci. Lett. 2011, 496, 43–47. [Google Scholar] [CrossRef]
- Wang, T.; Morgan, J.I. The Purkinje cell degeneration (pcd) mouse: An unexpected molecular link between neuronal degeneration and regeneration. Brain Res. 2007, 1140, 26–40. [Google Scholar] [CrossRef]
- Castro, J.; Garcia, R.I.; Kwok, S.; Banerjee, A.; Petravicz, J.; Woodson, J.; Mellios, N.; Tropea, D.; Sur, M. Functional recovery with recombinant human IGF1 treatment in a mouse model of Rett Syndrome. Proc. Natl. Acad. Sci. USA 2014, 111, 9941–9946. [Google Scholar] [CrossRef]
- Puche, J.E.; Muñoz, Ú.; García-Magariño, M.; Sádaba, M.C.; Castilla-Cortázar, I. Partial IGF-1 deficiency induces brain oxidative damage and edema, which are ameliorated by replacement therapy. Biofactors 2016, 42, 60–79. [Google Scholar] [CrossRef]
- Song, F.; Liu, T.; Meng, S.; Li, F.; Zhang, Y.; Jiang, L. Insulin-Like Growth Factor-1 Alleviates Expression of Abeta(1-40) and alpha-, beta-, and gamma-Secretases in the Cortex and Hippocampus of APP/PS1 Double Transgenic Mice. J. Mol. Neurosci. 2018, 66, 595–603. [Google Scholar] [CrossRef]
- Harvey, S.; Carragher, M.; Dickey, M.W.; Pierce, J.E.; Rose, M.L. Dose effects in behavioural treatment of post-stroke aphasia: A systematic review and meta-analysis. Disabil. Rehabilitation 2020, 44, 2548–2559. [Google Scholar] [CrossRef]
- Miquerol, L.; Langille, B.L.; Nagy, A. Embryonic development is disrupted by modest increases in vascular endothelial growth factor gene expression. Development 2000, 127, 3941–3946. [Google Scholar] [CrossRef]
- Ennaceur, A.; Delacour, J. A new one-trial test for neurobiological studies of memory in rats. 1: Behavioral data. Behav. Brain Res. 1988, 31, 47–59. [Google Scholar] [CrossRef]
- Ennaceur, A. One-trial object recognition in rats and mice: Methodological and theoretical issues. Behav. Brain Res. 2010, 215, 244–254. [Google Scholar] [CrossRef]
- Moy, S.S.; Nadler, J.J.; Perez, A.; Barbaro, R.P.; Johns, J.M.; Magnuson, T.R.; Piven, J.; Crawley, J.N. Sociability and preference for social novelty in five inbred strains: An approach to assess autistic-like behavior in mice. Genes, Brain Behav. 2004, 3, 287–302. [Google Scholar] [CrossRef]
- Schönfeld, L.M.; Dooley, D.; Jahanshahi, A.; Temel, Y.; Hendrix, S. Evaluating rodent motor functions: Which tests to choose? Neurosci. Biobehav. Rev. 2017, 83, 298–312. [Google Scholar] [CrossRef] [PubMed]









| Gen Name | Forward Primer (3′-5′) | Reverse Primer (5′-3′) |
|---|---|---|
| Igf-1 | GAAGACGACATGATGTGTATCTTTATC | AGCAGCCTTCCAACTCAATTAT |
| Bdnf | GTGGTGTAAGCCGCAAAGA | AACCATAGTAAGGAAAAGGATGGTC |
| Vegf-A | AATGCTTTCTCCGCTCTGAA | AAAAACGAAAGCGCAAGAAA |
| Vegf-B | AGGAGGTTCGCCTGTGCT | GCTCAACCCAGACACCTGTAG |
| Gapdh | GCCTATGTGGCCTCCAAGGA | GTGTTGGGTGCCCCTAGTTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pérez-Revuelta, L.; Pérez-Boyero, D.; Pérez-Martín, E.; Cabedo, V.L.; Téllez de Meneses, P.G.; Weruaga, E.; Díaz, D.; Alonso, J.R. Neuroprotective Effects of VEGF-B in a Murine Model of Aggressive Neuronal Loss with Childhood Onset. Int. J. Mol. Sci. 2025, 26, 538. https://doi.org/10.3390/ijms26020538
Pérez-Revuelta L, Pérez-Boyero D, Pérez-Martín E, Cabedo VL, Téllez de Meneses PG, Weruaga E, Díaz D, Alonso JR. Neuroprotective Effects of VEGF-B in a Murine Model of Aggressive Neuronal Loss with Childhood Onset. International Journal of Molecular Sciences. 2025; 26(2):538. https://doi.org/10.3390/ijms26020538
Chicago/Turabian StylePérez-Revuelta, Laura, David Pérez-Boyero, Ester Pérez-Martín, Valeria Lorena Cabedo, Pablo González Téllez de Meneses, Eduardo Weruaga, David Díaz, and José Ramón Alonso. 2025. "Neuroprotective Effects of VEGF-B in a Murine Model of Aggressive Neuronal Loss with Childhood Onset" International Journal of Molecular Sciences 26, no. 2: 538. https://doi.org/10.3390/ijms26020538
APA StylePérez-Revuelta, L., Pérez-Boyero, D., Pérez-Martín, E., Cabedo, V. L., Téllez de Meneses, P. G., Weruaga, E., Díaz, D., & Alonso, J. R. (2025). Neuroprotective Effects of VEGF-B in a Murine Model of Aggressive Neuronal Loss with Childhood Onset. International Journal of Molecular Sciences, 26(2), 538. https://doi.org/10.3390/ijms26020538

