Next Article in Journal
Transcriptome and Metabolome Analyses Reveal Molecular Mechanisms Regulating Growth Traits in Large Yellow Croaker (Larimichthys crocea)
Previous Article in Journal
Sentinel Lymph Node Biopsy in Melanoma: Overview and Updates
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 19
10.3390/ijms26199471
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Impact of Helicobacter pylori Virulence Genotypes cagA, vacA, oipA, and babA2 on Severity of Gastropathies in Brazilian Patients

by
Diogo Nery Maciel
1,
Hellen Christina de Oliveira Santos-Dutra
1,
Viviane Lopes Rocha
1,
Lucas Trevizani Rasmussen
2 and
Mônica Santiago Barbosa
1,*
1
Institute of Tropical Pathology and Public Health, Federal University of Goiás, Goiânia 74690-900, Brazil
2
Department of Biomedicine, University Center of Integrated Faculties of Ourinhos, Ourinhos 19909-100, Brazil
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(19), 9471; https://doi.org/10.3390/ijms26199471
Submission received: 12 May 2025 / Revised: 25 June 2025 / Accepted: 26 June 2025 / Published: 27 September 2025
(This article belongs to the Special Issue Helicobacter pylori in Gastric Diseases)
Browse Figures
Versions Notes

Abstract

Helicobacter pylori (H. pylori) is a Gram-negative, spiral-shaped bacterium that colonizes the human stomach and is linked to various gastroduodenal diseases. The severity of different clinical outcomes may be determined by the combination of virulence genes. The aim of this study was to assess the combinations of the cytotoxin-associated gene A (cagA), the vacuolating cytotoxin A gene (vacA), the outer inflammatory protein A gene (oipA), and the blood group antigen-binding adhesin gene (babA2) genotypes in H. pylori and their associations with the clinical outcomes of infection in patients from Central Brazil. This cross-sectional study included 106 patients who underwent endoscopy or gastrectomy. The presence and genotypes of H. pylori were confirmed using Polymerase Chain Reaction (PCR). Gastropathies were classified according to established severity criteria. Multivariate logistic regression and Venn diagrams were used to evaluate gene combinations. In this study, the infection prevalence was 65.1%. The cagA/vacA/oipA/babA2 combination showed a protective effect against erosive esophagitis (p = 0.002), erosive duodenitis (p = 0.003), and general duodenitis (p < 0.001). No significant association was observed between this gene combination and severe gastric diseases, although a trend toward protection against gastric atrophy was noted (p = 0.049). These findings suggest that the coexistence of cagA/vacA/oipA/babA2 may play a protective role against inflammatory lesions. Further studies should explore the functional role of these gene combinations, also considering the immunogenetic profile of the host.

1. Introduction

Helicobacter pylori (H. pylori) harbors a range of virulence genes that are associated with various gastric pathologies, including gastritis, peptic ulcers, Mucosa-Associated Lymphoid Tissue (MALT) lymphoma, and gastric cancer [1,2]. It is estimated that more than 50% of the global population is infected. However, prevalence rates vary substantially, as factors such as lifestyle and socioeconomic status directly influence the infection rate, which varies across different settings, being significantly higher in developing countries (50.8%), such as Brazil, compared to developed countries (34.7%) [1,3,4].
The infection often persists asymptomatically for long periods, which favors the progression of these gastropathies. It is a Gram-negative, microaerophilic, flagellated bacterium, whose adaptive capacity helps in the colonization of the human gastrointestinal tract of approximately half of the global population [5,6,7]. This successful adaptation of the bacterium to the hostile environment of the stomach is favored by a series of virulence factors, which allow its adhesion to the gastric epithelium and evasion of the host’s immune system [8,9].
Prevalence studies conducted in latin american populations have found rates between 60% and 91% [10,11,12]. The choice of the central-west region of Brazil for this study was due to the geographic diversity of the pathogen and the scarcity of data related to the molecular epidemiology of H. pylori in this area. This region is characterized by significant socioeconomic contrasts, the coexistence of urban and rural areas with different levels of infrastructure and access to health care, and weaknesses in epidemiological surveillance. It is believed that these factors collectively influence both the prevalence of infection and the genetic variability of circulating strains, highlighting the importance of conducting specific regional studies.
Among the most studied virulence factors of H. pylori are the cagA, vacA, oipA, and babA genes, which play fundamental roles in the pathogenesis of the infection. The CagA (cytotoxin-associated gene A) protein is one of the main proteins responsible for inducing inflammatory responses and altering cellular signaling in the host. Its activity, particularly in association with the type IV secretion system, is strongly implicated in the genesis of epithelial lesions and gastric carcinogenesis [13]. VacA (vacuolating cytotoxin A) plays an important role in modulating the immune response and vacuolation of gastric cells, inducing cellular damage and stimulating an environment conducive to pathogen persistence [14].
The OipA (outer Inflammatory Protein A) plays a key role in modulating gastric inflammation by inducing the expression of pro-inflammatory cytokines, like interleukin-8 (IL-8), and enhancing bacterial adhesion to the stomach mucosa, which exacerbates the inflammatory response [15]. OipA expression triggers apoptotic pathways and cytoskeletal changes in gastric epithelial cells, contributing to the progression of severe gastropathies [16]. On the other hand, the BabA protein (blood-group antigen-binding adhesin) acts as a specialized adhesin, mediating the attachment of H. pylori to glycosylated structures expressed on the gastric mucosa. This interaction is a critical step in establishing and maintaining the host-pathogen relationship [17].
H. pylori’s extensive genetic plasticity influences the clinical variability observed in infected individuals. Co-expression of certain genes can amplify inflammation, promote infection persistence, and increase the risk of severe gastric complications [18]. Studies indicate that the association between certain alleles of cytotoxin-associated gene A (cagA) and vacuolating cytotoxin A gene (vacA), for example, is directly related to the progression to gastric cancer, while the concomitant expression of outer inflammatory protein A gene (oipA), and the blood group antigen-binding adhesin gene (babA2) may confer a greater capacity for adhesion and colonization of the gastric epithelium [19,20].
Recent research indicates that the expression of OipA is associated with other H. pylori virulence markers, such as cagA, vacA s1/m1 and babA2. In strains with preserved cag-PAI pathogenicity island, there is greater coexpression of oipA, which suggests a possible synergistic effect between these genetic determinants. The geographic variability of these virulence factors may represent an adaptive mechanism to the gastric microenvironment, which interacts with host elements and environmental factors, and influences the clinical manifestations of the infection [2,21].
Therefore, the combination of multiple virulence factors plays a critical role in the progression of infection and the severity of associated gastric lesions. Integrated analysis of these genetic profiles is essential for understanding the pathogenesis of H. pylori [15].
The advent of multi-omic approaches, integrating genomics, transcriptomics, proteomics, and metabolomics, has decisively expanded the understanding of the Helicobacter pylori–host relationship. The simultaneous analysis of multiple molecular contexts can yield consistent associations between virulence factors and clinical outcomes [22,23,24]. Within this framework, the present study employs a combinatorial gene analysis approach, aligning with contemporary trends in systems biology to provide an integrated perspective on H. pylori virulence.
This study aimed to investigate the combinations between the cagA, vacA, oipA, and babA2 genotypes of H. pylori and their associations with different clinical outcomes in patients from Central Brazil.

2. Results

2.1. Demographic and Clinical Characteristics of Participants

A total of 106 patients with dyspepsia, who underwent upper gastrointestinal endoscopy or gastrectomy as indicated for diagnostic purposes, were included in the study. Of these, 69 tested positive for H. pylori, representing an approximate prevalence of 65.1% in this sample. The population consisted of 82 females and 24 males, aged between 18 and 75 years, with a predominance of individuals over 51 years of age. Infection was more common among participants with primary education and those from families with a monthly income between one and two minimum wages (Table 1).

2.2. Endoscopic Findings and Their Association with H. pylori Infection

Table 2 presents the distribution of clinical–endoscopic findings in the sample of 106 patients with dyspepsia, classified according to the presence or absence of H. pylori. Among the infected patients (n = 69), the most common findings were anthematous gastritis (42.0%) and erosive gastritis (30.4%). Less prevalent findings included gastric adenocarcinoma (2.9%), intestinal metaplasia (2.9%), and gastric ulcer (1.4%). In the non-infected group (n = 37), anthematous gastritis was also the most common finding (37.8%), followed by erosive gastritis (29.7%) and gastric atrophy (18.9%). A significant difference was observed for the diagnosis of gastric atrophy (p = 0.035), which was more prevalent among non-infected patients. Other diagnoses, such as intestinal metaplasia, erosive duodenitis, erosive esophagitis, and general gastritis, did not show statistically significant differences between the groups (p > 0.05). The overall frequency of severe gastric disease was relatively low in both groups, with a predominance of non-severe lesions in the total sample.
The distribution of H. pylori virulence gene combinations according to endoscopic diagnosis is described in Table 3.

2.3. Association Between Virulence Genes and Demographic or Clinical Variables

The cagA/babA2 combination had the highest overall frequency (21.7%), followed by cagA/oipA (13.0%) and cagA/oipA/babA2 (10.1%). No gene combination showed a statistically significant association with the severity of gastric disease (p > 0.05). The analysis of H. pylori virulence gene combinations is essential for understanding the impact of these genetic variants on the pathogenesis of gastric diseases. However, the lack of significant association with clinical outcomes observed in this study may reflect the complexity of interactions among microbial virulence factors, host genetics, and other factors that influence disease progression.
The cagA/vacA/oipA/babA2 gene combination did not show significant differences regarding age group (p = 0.120) or sex (p = 0.100), despite the predominance of this gene combination in the female group (80%). The association with gastric adenocarcinoma and intestinal metaplasia was not statistically significant, but a protective trend against gastric atrophy was observed (p = 0.049; Odds Ratio (OR) = 0.88; 95% Confidence Interval (CI): 0.75–0.98). Among non-severe diseases, the presence of this gene combination was correlated with a lower risk of erosive duodenitis (p = 0.003; OR = 0.65; 95% CI: 0.49–0.86) and erosive esophagitis (p = 0.002; OR = 0.60; 95% CI: 0.42–0.81). Additionally, individuals with the cagA/vacA/oipA/babA2 combination had a lower likelihood of developing general duodenitis (p < 0.001; OR = 0.54; 95% CI: 0.39–0.76). These findings suggest a potential protective role for this gene combination against inflammatory lesions in the gastrointestinal tract (Table 4).

2.4. Distribution Patterns of Virulence Gene Combinations

A more detailed analysis of the cagA/vacA/oipA/babA2 gene combination and predictive variables, such as sociodemographic characteristics, risk factors, and the severity of gastropathies, is presented in the Forest Plot shown in Figure 1, which displays the Odds Ratio values.
The Venn diagrams represented in Figure 2 show the distribution of combinations of the H. pylori virulence genes cagA, vacA, and oipA in patients diagnosed with severe or non-severe gastric disease. The intersections indicate the coexistence of two or more genes in the same sample. In the group with severe disease, seven samples exhibited the cagA gene, of which three had vacA coexisting, two had oipA coexisting, and two had cagA, vacA, and oipA simultaneously. The isolated presence of vacA or oipA was not observed in this group.
Figure 3 shows two Venn diagrams that illustrate the distribution of combinations of the H. pylori virulence genes cagA, oipA, and babA2 in patients diagnosed with severe or non-severe gastric disease. The intersections indicate the coexistence of two or more genes in the same sample. Among the cases classified as severe, five samples presented only the cagA gene, while two samples simultaneously exhibited cagA, oipA, and babA2. No cases of coexistence between cagA and babA2, or isolated manifestation of oipA or babA2, were identified in this group. In the group with non-severe disease, the predominance of samples positive only for cagA was observed (n = 23). In addition, seven samples presented coexistence of cagA and babA2, five simultaneously exhibited the three genes (cagA, oipA, and babA2), and two cases were positive for cagA and oipA. Three unique observations were also detected: one for oipA, one for babA2, and a combination of oipA and babA2 without cagA.

3. Discussion

This study evaluated the combinations of the cagA, vacA, oipA, and babA2 virulence genes and their associations with the severity of gastrointestinal lesions in a dyspeptic population infected with H. pylori in the Central region of Brazil. The prevalence of infection was 65.1. The distribution of the studied genes and sociodemographic variables, such as age and sex, did not show significant differences. These findings support observations that the pathogenicity of H. pylori seems to be more related to bacterial and immunological factors than to isolated sociodemographic factors [6,25].
The frequency of the cagA (79.7%) and vacA (53.6%) genes was higher in this study, followed by babA2 (15.9%) and oipA (26.1%). Although cagA was more common among cases of severe disease, its presence did not reach statistical significance, similar to the other genes. Previous studies suggest that the isolated presence of these genes does not absolutely predict the severity of clinical manifestations, but certain combinations can enhance the microorganism’s infection capability [26,27].
In this study, the cagA/vacA/oipA/babA2 combination showed a significant protective association against inflammatory lesions, such as erosive duodenitis, erosive esophagitis, and general duodenitis. These findings support the idea that the simultaneous interaction of multiple virulence factors can modulate the host’s inflammatory response, reducing tissue damage [28]. Despite the low frequency of subgroups expressing the cagA/vacA/oipA/babA2 gene combination, the complete absence of certain inflammatory lesions among these individuals suggests a potential factor associated with clinical protection. Although numerically limited, the asymmetric distribution led to statistically significant associations, raising the hypothesis of a possible biological effect.
The combined analysis of the cagA, vacA, oipA, and babA2 genes in this study was based on both their functional roles, described in the literature, and the frequency with which these genes are investigated as key H. pylori virulence markers. While some studies have not found a direct association between these genes and specific clinical outcomes [29,30], others have suggested trends within subgroups, such as the significant association observed for the cagA+/vacA s1/m1 genotype [31]. Furthermore, Barhoine et al. (2025) [2] reported that although co-occurrence among several virulence genes was statistically significant in their study, oipA, babA, and iceA showed no direct correlation with histopathological parameters, reinforcing the complexity of gene–gene interactions and the importance of contextual analysis.
This complex interaction between pathogen and host mechanisms, reinforced by the combination of virulence genes, allows for successful bacterial colonization through evasion of the immune system [32].
Our results suggest that the combined presence of the cagA, vacA, and oipA genes is more common in non-severe forms of the disease, although the cagA gene is present in all cases classified as severe. This contrasts with a study conducted in the Southeast region of Brazil, where the combination of the cagA, vacA, dupA, and oipA virulence factors showed high prevalence in patients with chronic gastritis and gastric cancer [31].
The absence of vacA and oipA as isolated factors in severe diseases reinforces the possibility that increased pathogenicity is more associated with the presence of cagA or the combination of multiple genes. In contrast, non-severe lesions demonstrated greater diversity of gene combinations, while severe disease cases showed a more restricted profile, concentrated on the isolated presence of cagA or the triple gene association. In a study conducted in Ecuador, the cagA/oipA combination was associated with an increased risk of developing acute gastric inflammation and lymphoid follicular hyperplasia [24].
The findings of this research reinforce the central role of the cagA gene in the virulence of the microorganism, especially in more aggressive clinical forms. The cag pathogenicity island (cag-PAI) contains genes encoding a secreted effector protein (CagA) and components of a type IV secretion system (Cag T4SS), which are closely related to the pathogenesis of H. pylori [33]. Approximately 60% to 70% of H. pylori strains express CagA, leading to increased synthesis of interleukin-8 (IL-8). The presence of tyrosine-containing motifs in the CagA structure, once phosphorylated, allows for its translocation into gastric epithelial cells via the Cag T4SS. Alterations in the sequence of these motifs have been correlated with gastric mucosal degeneration and increased predisposition to gastric adenocarcinoma [34].
The oipA and babA2 genes, important for bacterial adhesion to the gastric mucosa, showed prevalences of 15.9% and 26.1%, respectively. Despite their recognized role in bacterial adhesion and inflammation induction, their isolated combinations were not associated with lesion severity, suggesting that their influence depends on the genetic context of the strain and host factors. The lower frequency of the oipA genotype observed in this study contrasts with data from populations in Vietnam, where high prevalence and association with pre-neoplastic gastric mucosal alterations have been reported [12]. Conversely, despite the high detection of oipA in studies conducted in China, no significant correlation was found between this genotype and gastroduodenal clinical manifestations [14]. These data may reflect unique characteristics of the studied populations.
Among the main limitations of this study are the exploratory design, including the reduced sample size of specific subgroups, especially the subgroup with severe clinical manifestations, in addition to the absence of functional analyses and the lack of control for host variables. However, the findings reinforce the importance of the molecular characterization of H. pylori strains and serve as a basis for future hypotheses that encourage the development of broader genomic and immunogenetic approaches, with more integrative investigative strategies. Its contribution lies in the identification of preliminary patterns that should be validated by future studies with greater sample representation and statistical power.

4. Materials and Methods

4.1. Population and Samples

This cross-sectional study included 106 individuals with dyspeptic symptoms, aged 18 to 75, who underwent upper gastrointestinal endoscopy or gastrectomy at referral hospitals in the city of Goiânia, Goiás, Brazil. The exclusion criteria ruled out patients currently using proton pump inhibitors, H2 receptor antagonists, immunosuppressive agents, or antibiotics. Additionally, participants with evidence of active gastrointestinal bleeding, pregnant or lactating women, and those deemed ineligible for endoscopy were excluded. All participants signed an informed consent form (ICF) and completed a sociodemographic questionnaire. The confidentiality and privacy of all personal data were strictly protected throughout the study, ensuring the integrity of participant information.
Sample collection followed the guidelines of the IV Brazilian Consensus on Helicobacter pylori Infection. During the endoscopic procedure, two biopsy samples were taken from the antral region and two from the gastric body, as recommended for histological representativeness [35]. Tumor samples from patients with gastric cancer were obtained during gastrectomy, ensuring the preservation of morphological integrity and neoplastic tissue representativeness for analysis [36].
One sample from the antrum and another from the gastric body were sent to the Clinical Pathology Laboratory of the University Hospital at the Federal University of Goiás (HC/UFG) for histopathological analysis. The two remaining fragments were refrigerated and stored at −20 °C in the Helicobacter pylori Research Center (NEHP) of the same institution. These samples were later subjected to molecular analysis following previously established protocols, as described in prior publications by the NEHP [37,38].

4.2. Histology

Gastric mucosa samples obtained through endoscopy or gastrectomy were fixed in 10% buffered formalin solution. The tissue fragments were then stained with hematoxylin-eosin and Giemsa. Histopathological evaluation was performed according to the Sydney System, which standardizes the classification of morphological changes in the gastric mucosa [39].

4.3. DNA Extraction

DNA extraction followed the manufacturer’s protocol for the QIAamp DNA Mini Kit® (Qiagen, Valencia, CA, USA). The quantification and assessment of the purity of the extracted genomic DNA were conducted using optical density measurements with a NanoDrop® ND-1000 UV-Vis spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA), ensuring the integrity and quality of the genetic material for subsequent analyses.

4.4. DNA Amplification of H. pylori and Virulence Genes cagA, vacA, oipA, and babA2

The PCR technique was used for the molecular diagnosis of H. pylori infection, targeting the amplification of a fragment of the 16S ribosomal RNA (rRNA) gene. Samples that tested positive for H. pylori were then further analyzed for the detection of the virulence genes cagA, vacA, oipA, and babA2.
The amplification of the 16S rRNA, cagA, vacA, oipA, and babA2 genes was carried out using a BioRad® thermal cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Each PCR reaction contained the following components: 0.5 µL of Taq DNA polymerase (2.5 units), 5 µL of CoralLoad 10X PCR buffer (QIAamp, Qiagen) containing 1.5 mM MgCl2, 2 µL of dNTPs (2.5 mM), and 33.5 µL of milli-Q water. After mixing, 5 µL of DNA from each sample (150 ng) was added, bringing the total reaction volume to 50 µL. DNA from H. pylori-positive samples was used as a positive control in the PCR reactions. DNA-free water was used as a negative control to ensure the absence of contamination and validate the specificity of the amplification process.
Details regarding the oligonucleotides used for the amplification of each gene, along with the PCR conditions and expected fragment sizes, are provided in Table 5 [40,41,42,43].
The PCR products were stained with BlueGreen nucleic acid dye (Lab Biotechnology® Co., Ltd., Beijing, China) and subjected to electrophoresis on a 1.5% agarose gel. The visualization of the fragments was performed under ultraviolet (UV) light using a transilluminator, confirming the presence and size of the generated amplicons.

4.5. Diagnosis of Gastroduodenal Diseases and Severity Criteria

The stratification of patients with gastroduodenal lesions, based on the degree of severity, was conducted by the gastroenterology services and clinical pathology laboratories of the recruiting hospitals. This classification relied on the analysis of endoscopic reports and histopathological examinations. Clinical outcomes were grouped into two categories: non-severe, including duodenitis, esophagitis, gastritis, xanthelasma, and ulcers; and severe, comprising gastric adenocarcinoma, gastric atrophy, and intestinal metaplasia [44].

4.6. Data Analysis

Descriptive statistics were used to characterize the demographic and clinical profiles of the patients. Categorical variables were expressed as absolute frequencies (n) and relative frequencies (%), while continuous variables were reported as means and standard deviations. To compare the distribution of patient characteristics according to H. pylori infection status (positive vs. negative), Pearson’s chi-square test was applied.
To investigate the associations of individual virulence genes (cagA, vacA, dupA, oipA, babA2) and their combinations (e.g., cagA/vacA/oipA/babA2, cagA/oipA, cagA/babA2, cagA/oipA/babA2) with clinical outcomes, multiple logistic regression models were fitted. Each model included one gene or gene combination as the binary outcome variable (presence/absence), and the clinical and demographic features were included as independent predictors. The predictor variables entered into the models were as follows: age group, sex, and the presence or absence of each of the following clinical diagnoses—gastric adenocarcinoma, gastric atrophy, intestinal metaplasia, erosive duodenitis, erosive esophagitis, enanthematous gastritis, erosive gastritis, duodenal ulcer, gastric ulcer, xanthelasma, enanthematous duodenitis, general gastritis, and general duodenitis.
To prevent multicollinearity and overfitting, all regression models were adjusted using ridge penalization. Odds Ratios, 95% Confidence Intervals, Wald statistics, and p-values were reported for each predictor variable.
Additionally, the distribution of virulence gene combinations was analyzed using binary coding (presence = 1, absence = 0), and patients were categorized into two clinical outcome groups, “Severe” and “Non-severe” gastropathy. Venn diagrams were used to graphically illustrate the intersections among gene combinations in both groups. These diagrams were created in R (version 12.1) using the VennDiagram and ggVennDiagram packages, applying the venn.diagram() function for clinical group stratification.
All statistical analyses were conducted using SPSS version 26.0 (IBM Corp., Armonk, NY, USA), with a two-tailed significance level set at α = 0.05.

5. Conclusions

In this study, the cagA/vacA/oipA/babA2 combination demonstrated a potential protective effect against the occurrence of erosive esophagitis, erosive duodenitis, and unspecified duodenitis. These findings suggest that the synergistic interaction of multiple bacterial virulence determinants may modulate the host’s inflammatory response, directly influencing the clinical outcome of H. pylori infection. In exploratory studies involving low-prevalence genetic variables, such evidence may support initial hypotheses when interpreted with caution. In this context, the results, despite statistical limitations, may contribute to the understanding of the interactions between virulence genotypes and clinical manifestations of H. pylori infection. Future investigations should aim to further characterize virulence gene variants and explore the immunogenetic profiles of hosts, with the goal of elucidating the molecular mechanisms involved in pathogenesis and refining risk stratification for the development of more severe clinical complications.

Author Contributions

Study design: D.N.M., L.T.R. and M.S.B.; sample collection and processing: D.N.M., H.C.d.O.S.-D. and V.L.R.; article writing and revision: D.N.M., H.C.d.O.S.-D. and M.S.B.; orientation and correction of the article: V.L.R., L.T.R. and M.S.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Institutional Review Board Statement

The research received ethical approval from the Research Ethics Committee of the Hospital das Clínicas at the Federal University of Goiás (HC/UFG), under protocol number 2.519.032 (CAAE: 83422017.7.0000.5078), and from the Research Ethics Committee of the Goiás Association for Combating Cancer (ACCG) in Goiânia, Goiás, under protocol number 2.885.763 (CAAE: 95637418.3.3001.0031), in September 2018.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Additional data supporting the manuscript are available from the corresponding author upon request.

Acknowledgments

We thank Lucas Trevizani for kindly providing DNA from H. pylori-positive samples for use as a positive control in the PCR reactions. We would also like to thank CAPES (Coordination for the Improvement of Higher Education Personnel) and PROAP (Programa de Apoio à Pós-graduação) for supporting research in Brazil.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
H. pyloriHelicobacter pylori
cagACytotoxin-associated A gene
vacAVacuolating cytotoxin A gene
oipAOuter Inflammatory Protein A gene
babA2Blood-group antigen-binding adhesin gene
PCRPolymerase chain reaction

References

  1. Wattanawongdon, W.; Simawaranon Bartpho, T.; Tongtawee, T. Relationship between Helicobacter pylori virulence genes and gastroduodenal disease. J. Int. Med. Res. 2023, 51, 03000605231161465. [Google Scholar] [CrossRef] [PubMed]
  2. Barhoine, M.; Moustaoui, F.; Hammani, O.; Aghrouch, M.; Lemkhente, Z.; Belhabib, Z.; Bajaddoub, Z.; Touyar, A.; Aqoudad, N.; Rherissi, B.; et al. The Effect of Helicobacter pylori Gene Combinations of cagA, cagE, virB11, vacA and babA on the Outcome of Gastric Disease in a Southern Moroccan Population. Pathogens 2025, 14, 279. [Google Scholar] [CrossRef] [PubMed]
  3. Bashir, S.K.; Khan, M.B. Overview of Helicobacter pylori Infection, Prevalence, Risk Factors, and Its Prevention. Adv. Gut Microbiome Res. 2023, 2023, 9747027. [Google Scholar] [CrossRef]
  4. Zamani, M.; Ebrahimtabar, F.; Zamani, V.; Miller, W.H.; Alizadeh-Navaei, R.; Shokri-Shirvani, J.; Derakhshan, M.H. Systematic review with meta-analysis: The worldwide prevalence of Helicobacter pylori infection. Aliment. Pharmacol. Ther. 2018, 1, 868–876. [Google Scholar] [CrossRef]
  5. Sedarat, Z.; Taylor-Robinson, A.W. Helicobacter pylori Outer Membrane Proteins and Virulence Factors: Potential Targets for Novel Therapies and Vaccines. Pathogens 2024, 13, 392. [Google Scholar] [CrossRef]
  6. Hooi, J.K.; Ying Lai, W.; Khoon Ng, W.; Suen, M.M.; Underwood, F.E.; Tanyingoh, D.; Malfertheiner, P.; Graham, D.Y.; Wong, V.W.; Wu, J.C.; et al. Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-analysis. Gastroenterology 2017, 153, 420–429. [Google Scholar] [CrossRef]
  7. Wondmagegn, Y.M.; Girmay, G.; Amare, G.A.; Assefa, M.; Tamir, M.; Abriham, Z.Y.; Setegn, A. Prevalence of intestinal parasites and Helicobacter pylori co-infection in people with gastrointestinal symptoms in Africa: A systematic review and meta-analysis. BMC Infect. Dis. 2025, 25, 20. [Google Scholar] [CrossRef]
  8. Teng, K.W.; Hsieh, K.S.; Hung, J.S.; Wang, C.J.; Liao, E.C.; Chen, P.C.; Lin, Y.H.; Wu, D.C.; Lin, C.H.; Wang, W.C.; et al. Helicobacter pylori employs a general protein glycosylation system for the modification of outer membrane adhesins. Gut Microbes 2022, 14, 2130650. [Google Scholar] [CrossRef] [PubMed]
  9. Ansari, S.; Yamaoka, Y. Helicobacter pylori BabA in adaptation for gastric colonization. World J. Gastroenterol. 2017, 23, 158–4169. [Google Scholar] [CrossRef]
  10. González-Stegmaier, R.; Aguila-Torres, P.; Villarroel-Espíndola, F. Historical and Molecular Perspectives on the Presence of Helicobacter pylori in Latin America: A Niche to Improve Gastric Cancer Risk Assessment. Int. J. Mol. Sci. 2024, 25, 1761. [Google Scholar] [CrossRef]
  11. Curado, M.P.; de Oliveira, M.M.; Fagundes, M.d.A. Prevalence of Helicobacter pylori infection in Latin America and the Caribbean populations: A systematic review and meta-analysis. Cancer Epidemiol. 2019, 60, 141–148. [Google Scholar] [CrossRef] [PubMed]
  12. Bustos-Fraga, S.; Salinas-Pinta, M.; Vicuña-Almeida, Y.; de Oliveira, R.B.; Baldeón-Rojas, L. Prevalence of Helicobacter pylori genotypes: cagA, vacA (m1), vacA (s1), babA2, dupA, iceA1, oipA and their association with gastrointestinal diseases. A cross-sectional study in Quito-Ecuador. BMC Gastroenterol. 2023, 23, 197. [Google Scholar] [CrossRef]
  13. Roberts, J.R.; Tran, S.C.; Frick-Cheng, A.E.; Bryant, K.N.; Okoye, C.D.; McDonald, W.H.; Ohi, M.D. Subdomains of the Helicobacter pylori Cag T4SS outer membrane core complex exhibit structural independence. Life Sci. Alliance 2024, 7, 6. [Google Scholar]
  14. Farsimadan, M.; Heravi, F.S.; Emamvirdizadeh, A.; Moradi, S.; Iranpour, H.; Tabasi, E.; Cover, T.L.; Ohi, M.D. Evaluation of Helicobacter pylori Genotypes in Obese Patients with Gastric Ulcer, Duodenal Ulcer, and Gastric Cancer: An Observational Study. Dig. Dis. 2022, 40, 355–361. [Google Scholar] [CrossRef] [PubMed]
  15. Thai, T.H.N.; Nguyen, H.P.; Nguyen, T.H.Y.; Nguyen, T.B.H.; Nguyen, T.H.; Nguyen, T.M.N.; Ha, T.M.T. Genetic diversity of the oipA gene among Helicobacter pylori isolates and clinical outcome in Vietnam. Infect. Genet. Evol. 2023, 112, 105438. [Google Scholar] [CrossRef]
  16. Hedayati, M.A.; Salavati, S. Transcriptional Profile of Helicobacter pylori Virulence Genes in Patients with Gastritis and Gastric Cancer. Can. J. Infect. Dis. Med. Microbiol. 2021, 2021, 1309519. [Google Scholar] [CrossRef]
  17. Zhao, Q.; Song, C.; Wang, K.; Li, D.; Yang, Y.; Liu, D.; Wang, L.; Zhou, N.; Xie, Y. Prevalence of Helicobacter pylori babA, oipA, sabA and homB genes in isolates from Chinese patients with different gastroduodenal diseases. Med. Microbiol. Immunol. 2020, 209, 565–577. [Google Scholar] [CrossRef]
  18. Abadi, M.S.S.; Ashrafi-Dehkordi, K.; Ahmadi, R.; Rahimian, G.; Mirzaei, Y.; Fereidani, R.; Shohan, M.; Azadegan-Dehkordi, F. Frequency of virulence-associated genotypes of Helicobacter pylori and their correlation with clinical outcome and histological parameters in infected patients. Heliyon 2021, 7, e07610. [Google Scholar] [CrossRef]
  19. Qasim, M.T.; Mohammed, Z.I. The Association of Helicobacter pylori Infection and Virulence Factors in Gastric Cancer in Thi-Qar, Iraq. Asian Pac. J. Cancer Biol. 2024, 9, 541–545. [Google Scholar] [CrossRef]
  20. Othman, K.I.; Balaky, S.T.J. Investigating the potential association of Helicobacter pylori cagA, vacA s1/s2, iceA1, iceA2, babA2, sabA and oipA genotypes with gastric disease severity. Cell. Mol. Biol. 2025, 71, 88–95. [Google Scholar] [CrossRef]
  21. Farzi, N.; Yadegar, A.; Aghdaei, H.A.; Yamaoka, Y.; Zali, M.R. Genetic diversity and functional analysis of oipA gene in association with other virulence factors among Helicobacter pylori isolates from Iranian patients with different gastric diseases. Infect. Genet. Evol. 2018, 60, 26–34. [Google Scholar] [CrossRef]
  22. Liu, D.; Peng, J.; Xie, J.; Xie, Y. Comprehensive analysis of the function of helicobacter-associated ferroptosis gene YWHAE in gastric cancer through multi-omics integration, molecular docking, and machine learning. Apoptosis 2024, 29, 439–456. [Google Scholar] [CrossRef]
  23. Mohamed, S.H.; Hamed, M.; Alamoudi, H.A.; Jastaniah, Z.; Alakwaa, F.M.; Reda, A. Multi-omics analysis of Helicobacter pylori–associated gastric cancer identifies hub genes as a novel therapeutic biomarker. Brief. Bioinform. 2025, 26, bbaf241. [Google Scholar] [CrossRef]
  24. Chen, R.; Li, Y.; Chen, X.; Chen, J.; Song, J.; Yang, X.; Ye, L.; Wu, Z.; Xie, P.; Zhong, Q.; et al. dupA+ H. pylori reduces diversity of gastric microbiome and increases risk of erosive gastritis. Front. Cell. Infect. Microbiol. 2023, 13, 1103909. [Google Scholar] [CrossRef]
  25. Razuka-Ebela, D.; Polaka, I.; Parshutin, S.; Santare, D.; Ebela, I.; Murillo, R.; Herrero, R.; Tzivian, L.; Leja, M. Sociodemographic, Lifestyle and Medical Factors Associated with Helicobacter Pylori Infection. J. Gastrointest. Liver Dis. 2020, 29, 319–327. [Google Scholar] [CrossRef]
  26. Abdullah, M.; Greenfield, L.K.; Bronte-Tinkew, D.; Capurro, M.I.; Rizzuti, D.; Jones, N.L. VacA promotes CagA accumulation in gastric epithelial cells during Helicobacter pylori infection. Sci. Rep. 2019, 9, 38. [Google Scholar] [CrossRef]
  27. Yang, K.; Shi, L.; Chen, J. Analysis of the relationship between oipA, babA2, babB genotypes and Helicobacter pylori-related gastric precancerous lesions. J. Pak. Med. Assoc. 2023, 73, 249–252. [Google Scholar] [CrossRef]
  28. Fan, J.; Zhu, J.; Xu, H. Strategies of Helicobacter pylori in evading host innate and adaptive immunity: Insights and prospects for therapeutic targeting. Front. Cell. Infect. Microbiol. 2024, 14, 1342913. [Google Scholar] [CrossRef]
  29. Osman, H.A.; Hasan, H.; Suppian, R.; Hassan, S.; Andee, D.Z.; Majid, N.A.; Zilfalil, B.A. Prevalence of Helicobacter pylori cagA, babA2, and dupA genotypes and correlation with clinical outcome in Malaysian patients with dyspepsia. Turk. J. Med. Sci. 2015, 45, 940–946. [Google Scholar] [CrossRef]
  30. Yamaoka, Y.; Kodama, T.; Gutierrez, O.; Kim, J.G.; Kashima, K.; Graham, D.Y. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: Studies in four different countries. J. Clin. Microbiol. 1999, 37, 2274–2279. [Google Scholar] [CrossRef]
  31. Sallas, M.L.; Melchiades, J.L.; Zabaglia, L.M.; Moreno, J.R.d.P.; Orcini, W.A.; Chen, E.S.; Smith, M.D.A.C.; Payão, S.L.M.; Rasmussen, L.T. Prevalence of Helicobacter pylori vacA, cagA, dupA and oipA Genotypes in Patients with Gastric Disease. Adv. Microbiol. 2017, 7, 1–9. [Google Scholar] [CrossRef]
  32. Cadamuro, A.C.T.; Rossi, A.F.T.; Maniezzo, N.M.; Silva, A.E. Helicobacter pylori infection: Host immune response, implications on gene expression and microRNAs. World J. Gastroenterol. 2014, 20, 1424. [Google Scholar] [CrossRef] [PubMed]
  33. Cover, T.L.; Lacy, D.B.; Ohi, M.D. The Helicobacter pylori Cag Type IV Secretion System. Trends Microbiol. 2020, 28, 682–695. [Google Scholar] [CrossRef] [PubMed]
  34. Elbehiry, A.; Marzouk, E.; Abalkhail, A.; Sindi, W.; Alzahrani, Y.; Alhifani, S.; Alshehri, T.; Anajirih, N.A.; ALMutairi, T.; Alsaedi, A.; et al. Pivotal role of Helicobacter pylori virulence genes in pathogenicity and vaccine development. Front. Med. 2024, 11, 1523991. [Google Scholar] [CrossRef]
  35. Coelho, L.G.V.; Marinho, J.R.; Genta, R.; Ribeiro, L.T.; Passos Mdo, C.F.; Zaterka, S.; Assumpção, P.P.; Barbosa, A.J.A.; Barbuti, R.; Braga, L.L.; et al. IV Brazilian Consensus Conference on Helicobacter Pylori Infection. Arq. Gastroenterol. 2018, 55, 97–121. [Google Scholar] [CrossRef]
  36. Braga, L.L.B.C.; Batista, M.H.R.; De Azevedo, O.G.R.; Da Silva Costa, K.C.; Gomes, A.D.; Rocha, G.A.; Queiroz, D.M.M. oipA “on” status of Helicobacter pylori is associated with gastric cancer in North-Eastern Brazil. BMC Cancer 2019, 19, 48. [Google Scholar] [CrossRef]
  37. Silva, L.L.L.; Oliveira, A.K.S.; Gama, A.R.; Pontes, J.C.; Ramos, A.F.P.L.; Silva, A.M.T.C.; Cardoso, D.M.M.; Blanco, A.J.V.; Rasmussem, L.T.; Carneiro, L.C.; et al. Prevalence of Helicobacter pylori cagA, dupA and vacA genotypes and their association with the severity of gastropathies in patients with dyspepsia. Genet. Mol. Res 2021, 20, GMR18883. [Google Scholar] [CrossRef]
  38. Oliveira, A.K.S.; Silva, L.L.d.L.; Miguel, M.P.; Blanco, A.J.V.; Carneiro, L.C.; Barbosa, M.S. Helicobacter pylori cagA virulence gene and severe esogastroduodenal diseases: Is there an association? Arq. Gastroenterol. 2021, 58, 468–475. [Google Scholar] [CrossRef]
  39. Stolte, M.; Meining, A. The updated Sydney System: Classification and grading of gastritis as the basis of diagnosis and treatment. Can. J. Gastroenterol. Hepatol. 2001, 15, 591–598. [Google Scholar] [CrossRef]
  40. Scholte, G.H.A.; Van Doom, L.J.; Quint, W.G.V.; Lindeman, J. Polymerase chain reaction for the detection of Helicobacter pylori in formaldehyde-sublimate fixed, paraffin-embedded gastric biopsies. Diagn. Mol. Pathol. 1997, 6, 238–243. [Google Scholar] [CrossRef]
  41. Dadashzadeh, K.; Peppelenbosch, M.P.; Adamu, A.I. Helicobacter pylori Pathogenicity Factors Related to Gastric Cancer. Can. J. Gastroenterol. Hepatol. 2017, 2017, 7942489. [Google Scholar] [CrossRef]
  42. Mansour, K.B.; Fendri, C.; Zribi, M.; Masmoudi, A.; Labbene, M.; Fillali, A.; Mami, N.B.; Najjar, T.; Meherzi, A.; Sfar, T.; et al. Prevalence of Helicobacter pylori vacA, cagA, iceA and oipA genotypes in Tunisian patients. Ann. Clin. Microbiol. Antimicrob. 2010, 9, 10. [Google Scholar] [CrossRef]
  43. Van Doorn, L.J.; Figueiredo, C.; Rossau, R.; Jannes, G.; Van Asbroeck, M.; Sousa, J.C.; Carneiro, F.; Quint, W.G.V. Typing of Helicobacter pylori vacA gene and detection of cagA gene by PCR and reverse hybridization. J. Clin. Microbiol. 1998, 36, 1271–1276. [Google Scholar] [CrossRef]
  44. Paredes-Osses, E.; Sáez, K.; Sanhueza, E.; Hebel, S.; González, C.; Briceño, C.; Cancino, A.C. Association between cagA, vacAi and dupA genes of Helicobacter pylori and gastroduodenal pathologies in Chilean patients. Folia Microbiol. 2017, 62, 437–444. [Google Scholar] [CrossRef]
Ijms 26 09471 g001
Figure 1. A Forest Plot demonstrating the Odds Ratios for the association of the cagA/vacA/oipA/babA2 gene combination with sociodemographic variables and gastropathies. The horizontal lines represent the 95% confidence intervals (CI) of the Odds Ratio (OR) estimates, while the black dots indicate the estimated point values for each group or variable. The vertical red dashed line marks the null value (OR = 1), which indicates no statistical association between the analyzed variable and the outcome.
Figure 1. A Forest Plot demonstrating the Odds Ratios for the association of the cagA/vacA/oipA/babA2 gene combination with sociodemographic variables and gastropathies. The horizontal lines represent the 95% confidence intervals (CI) of the Odds Ratio (OR) estimates, while the black dots indicate the estimated point values for each group or variable. The vertical red dashed line marks the null value (OR = 1), which indicates no statistical association between the analyzed variable and the outcome.
Ijms 26 09471 g001
Ijms 26 09471 g002
Figure 2. Venn diagrams representing the distribution of H. pylori virulence gene combinations (cagA, vacA, and oipA) in samples from patients with severe (a) and non-severe (b) gastric diseases. Each color represents the presence of a gene or gene combination (salmon: cagA; green: vacA; purple: oipA; lilac: overlap between cagA and oipA; lilac–gray: overlap between cagA, vacA, and oipA; blue–green: overlap between oipA and vacA; brown: overlap between the cagA and vacA genes).
Figure 2. Venn diagrams representing the distribution of H. pylori virulence gene combinations (cagA, vacA, and oipA) in samples from patients with severe (a) and non-severe (b) gastric diseases. Each color represents the presence of a gene or gene combination (salmon: cagA; green: vacA; purple: oipA; lilac: overlap between cagA and oipA; lilac–gray: overlap between cagA, vacA, and oipA; blue–green: overlap between oipA and vacA; brown: overlap between the cagA and vacA genes).
Ijms 26 09471 g002
Ijms 26 09471 g003
Figure 3. Venn diagrams representing the intersections of H. pylori virulence gene combinations (cagA, oipA, and babA2) in samples from patients with severe (a) or non-severe (b) gastric diseases. Each color represents the presence of a gene or gene combination (salmon: cagA; green: oipA; purple: babA2; lilac–gray: overlap between cagA, oipA, and babA2; lilac: overlap between cagA and babA2; blue–green: overlap between oipA and babA2; brown: overlap between the cagA and oipA genes).
Figure 3. Venn diagrams representing the intersections of H. pylori virulence gene combinations (cagA, oipA, and babA2) in samples from patients with severe (a) or non-severe (b) gastric diseases. Each color represents the presence of a gene or gene combination (salmon: cagA; green: oipA; purple: babA2; lilac–gray: overlap between cagA, oipA, and babA2; lilac: overlap between cagA and babA2; blue–green: overlap between oipA and babA2; brown: overlap between the cagA and oipA genes).
Ijms 26 09471 g003
Table 1. The sociodemographic characteristics of the sample according to H. pylori detection (n = 106).
Table 1. The sociodemographic characteristics of the sample according to H. pylori detection (n = 106).
Total
n = 106		H. pylori n (%)p *
No
n = 37		Yes
n = 69
Age Group
<40 years28 (26.4%)5 (13.5%)23 (33.3%)0.087
40 to 50 years19 (17.9%)8 (21.6%)11 (15.9%)
51 years or more59 (55.7%)24 (64.9%)35 (50.7%)
Sex
Female82 (77.4%)29 (78.4%)53 (76.8%)0.856
Male24 (22.6%)8 (21.6%)16 (23.2%)
Education Level **
Illiterate7 (6.6%)3 (8.1%)4 (5.8%)0.463
Primary education55 (51.9%)20 (54.1%)35 (50.7%)
Secondary education35 (33.0%)13 (35.1%)22 (31.9%)
Higher education9 (8.5%)1 (2.7%)8 (11.6%)
Monthly Family Income
<1 minimum wage13 (12.3%)3 (8.1%)10 (14.5%)0.471
1 to 2 minimum wages36 (34.0%)12 (32.4%)24 (34.8%)
3 to 5 minimum wages33 (31.1%)10 (27.0%)23 (33.3%)
5 or more minimum wages4 (3.8%)2 (5.4%)2 (2.9%)
Unknown20 (18.9%)10 (27.0%)10 (14.5%)
* Pearson’s chi-square; n, absolute frequency; %, relative frequency. ** Note: Education level was classified as follows: illiterate (no formal education), primary education (completed elementary school), secondary education (completed high school), and higher education (completed undergraduate or postgraduate studies), according to the Brazilian education system.
Table 2. The clinical profile of the sample according to H. pylori detection (n = 106).
Table 2. The clinical profile of the sample according to H. pylori detection (n = 106).
Total
n = 106		H. pylori n (%)p *
No
n = 37		Yes
n = 69
Severe Diseases
Gastric adenocarcinoma2 (1.9%)0 (0.0%)2 (2.9%)0.296
Gastric atrophy11 (10.4%)7 (18.9%)4 (5.8%)0.035
Intestinal metaplasia6 (5.7%)4 (10.8%)2 (2.9%)0.093
Non-severe Diseases
Esophagus
Erosive esophagitis15 (14.2%)5 (13.5%)10 (14.5%)0.890
Stomach
Anthematous gastritis43 (40.6%)14 (37.8%)29 (42.0%)0.675
Chronic gastritis1 (0.9%)1 (2.7%)0 (0.0%)0.170
Erosive gastritis32 (30.2%)11 (29.7%)21 (30.4%)0.940
Gastric ulcer4 (3.8%)3 (8.1%)1 (1.4%)0.086
General gastritis74 (69.8%)25 (67.6%)49 (71.0%)0.713
Xanthelasma (gastric)1 (0.9%)0 (0.0%)1 (1.4%)0.462
Duodenum
Anthematous duodenitis4 (3.8%)0 (0.0%)4 (5.8%)0.135
Duodenal ulcer1 (0.9%)0 (0.0%)1 (1.4%)0.462
Duodenitis1 (0.9%)1 (2.7%)0 (0.0%)0.170
Erosive duodenitis10 (9.4%)2 (5.4%)8 (11.6%)0.299
General duodenitis15 (14.2%)3 (8.1%)12 (17.4%)0.191
* Pearson’s chi-square; n, absolute frequency; %, relative frequency.
Table 3. The characterization of genes and gene combinations according to the severity of gastropathies (n = 69).
Table 3. The characterization of genes and gene combinations according to the severity of gastropathies (n = 69).
Total
n = 69		 Diagnostic p *
Normal
18 (17.0%)		Non-Severe
72 (67.9%)		Severe
16 (15.1%)
Genes
cagA55 (79.7%)11 (84.6%)37 (75.5%)7 (100.0%)0.285
vacA37 (53.6%)7 (53.8%)27 (55.1%)3 (42.9%)0.831
oipA11 (15.9%)0 (0.0%)9 (18.4%)2 (28.6%)0.173
babA218 (26.1%)2 (15.4%)14 (28.6%)2 (28.6%)0.621
Gene Combinations
cagA/vacA/oipA/babA25 (7.2%)0 (0.0%)5 (10.2%)0 (0.0%)0.333
cagA/oipA9 (13.0%)0 (0.0%)7 (14.3%)2 (28.6%)0.173
cagA/babA215 (21.7%)1 (7.7%)12 (24.5%)2 (28.6%)0.383
cagA/oipA/babA27 (10.1%)0 (0.0%)5 (10.2%)2 (28.6%)0.130
* Pearson’s chi-square; n, absolute frequency; %, relative frequency.
Table 4. The distribution of the cagA/vacA/oipA/babA2 gene combination and its association with sociodemographic variables and the severity of gastropathies.
Table 4. The distribution of the cagA/vacA/oipA/babA2 gene combination and its association with sociodemographic variables and the severity of gastropathies.
cagA/vacA/oipA/babA2WaldOR (95% CI)p *
AbsentPresent
Age Group
18 to 50 years31 (48.4%)3 (60.0%)2.42Ref
51 years or more33 (51.6%)2 (40.0%)0.53 (0.24–1.11)0.120
Sex
Female49 (76.6%)4 (80.0%)2.70Ref
Male15 (23.4%)1 (20.0%)0.56 (0.24–1.02)0.100
Severe Diseases
Gastric adenocarcinoma2 (3.1%)0 (0.0%)2.670.76 (0.54–1.00)0.102
Gastric atrophy4 (6.3%)0 (0.0%)3.630.88 (0.75–0.98)0.049
Intestinal metaplasia2 (3.1%)0 (0.0%)1.830.82 (0.60–1.00)0.176
Non-severe Diseases
Esophagus
Erosive esophagitis10 (15.6%)0 (0.0%)9.940.60 (0.42–0.81)0.002
Stomach
Anthematous gastritis26 (40.6%)3 (60.0%)0.141.18 (0.48–2.72)0.704
Erosive gastritis18 (28.1%)3 (60.0%)2.262.06 (0.66–4.56)0.133
Gastric ulcer1 (1.6%)0 (0.0%)1.220.94 (0.82–1.00)0.269
General gastritis44 (68.8%)5 (100.0%)0.010.98 (0.58–1.60)0.930
Xanthelasma (gastric)1 (1.6%)0 (0.0%)1.070.95 (0.84–1.00)0.302
Duodenum
Anthematous duodenitis4 (6.3%)0 (0.0%)3.810.83 (0.68–0.98)0.049
Duodenal ulcer1 (1.6%)0 (0.0%)1.220.94 (0.82–1.00)0.269
Erosive duodenitis8 (12.5%)0 (0.0%)9.110.65 (0.49–0.86)0.003
General duodenitis12 (18.8%)0 (0.0%)12.500.54 (0.39–0.76)<0.001
* Multiple logistic regression; r2 = 0.21; CI = Confidence Interval; OR = Odds Ratio; Ref = reference; r2 = coefficient of determination.
Table 5. The genes and primer sequences used for H. pylori identification and genotyping, the amplification conditions, and the expected fragment sizes.
Table 5. The genes and primer sequences used for H. pylori identification and genotyping, the amplification conditions, and the expected fragment sizes.
GeneSequence (5′ → 3′)Amplification Conditionsbp
16S
rRNA		CTGGAGARACTAAGYCCTCC
GAGGAATACTCATTGCAAGGCGA		95 °C, 2 min; 95 °C, 1 min; 60 °C, 1 min; 72 °C, 1 min (40 cycles); 72 °C, 5 min [36]150
cagAATGACTAACGAAACTATTGATC
CAGGATTTTTGATCGCTTTATT		94 °C, 1 min; 53 °C, 1 min; 72 °C, 1 min (40 cycles) [37]232
vacAATGGAAATACAACAAACACAC
CCTGARACCGTTCCTACAGC		94 °C, 45 s; 54 °C, 45 s; 72 °C, 45 s (35 cycles) [39]286
oipAGTTTTTGATGCATGGGATTT
GTGCATCTCTTATGGCTTT		94 °C, 1 min; 56 °C, 1 min; 72 °C, 1 min (35 cycles) [38]401
babA2CCAAACGAAACAAAAAGCGT
GCTTGTGTAAAAGCCGTCGT		94 °C, 2 min; 94 °C, 45 s; 48 °C, 30 s; 72 °C, 60 s (35 cycles); 72 °C, 10 min [37]271
°C = degrees Celsius, min = minutes, s = seconds.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Maciel, D.N.; Santos-Dutra, H.C.d.O.; Rocha, V.L.; Rasmussen, L.T.; Barbosa, M.S. Impact of Helicobacter pylori Virulence Genotypes cagA, vacA, oipA, and babA2 on Severity of Gastropathies in Brazilian Patients. Int. J. Mol. Sci. 2025, 26, 9471. https://doi.org/10.3390/ijms26199471

AMA Style

Maciel DN, Santos-Dutra HCdO, Rocha VL, Rasmussen LT, Barbosa MS. Impact of Helicobacter pylori Virulence Genotypes cagA, vacA, oipA, and babA2 on Severity of Gastropathies in Brazilian Patients. International Journal of Molecular Sciences. 2025; 26(19):9471. https://doi.org/10.3390/ijms26199471

Chicago/Turabian Style

Maciel, Diogo Nery, Hellen Christina de Oliveira Santos-Dutra, Viviane Lopes Rocha, Lucas Trevizani Rasmussen, and Mônica Santiago Barbosa. 2025. "Impact of Helicobacter pylori Virulence Genotypes cagA, vacA, oipA, and babA2 on Severity of Gastropathies in Brazilian Patients" International Journal of Molecular Sciences 26, no. 19: 9471. https://doi.org/10.3390/ijms26199471

APA Style

Maciel, D. N., Santos-Dutra, H. C. d. O., Rocha, V. L., Rasmussen, L. T., & Barbosa, M. S. (2025). Impact of Helicobacter pylori Virulence Genotypes cagA, vacA, oipA, and babA2 on Severity of Gastropathies in Brazilian Patients. International Journal of Molecular Sciences, 26(19), 9471. https://doi.org/10.3390/ijms26199471

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop