Large-Scale Screening and Identification of S-RNase Alleles in Chinese and European Apricot Accessions Reveal Their Diversity and Geographic Distribution Patterns

Abstract

Apricot (Prunus armeniaca L.) exhibits a gametophytic self-incompatibility (GSI) system. To identify the S-genotypes of the main apricot cultivars, including 133 native Chinese cultivars and 35 foreign accessions, PCR was performed using a combination of five primers based on the conserved regions of Prunus S-RNase genes. After cloning and sequencing the PCR products, the S-genotypes of all 168 apricot cultivars were determined. A total of 46 different S-RNase alleles, with 15 new alleles, were identified. For all 168 accessions, the top five most frequent S-alleles were S₈, S₁₁, S₉, S₁₆, and S₅₃. S₁₁, S₈, and S₁₆ were the most frequent in Chinese cultivars, and S₉, S₈, and S₂ were mostly found in European accessions. For Chinese apricot cultivars, the distribution of S-alleles among five geographic regions was also investigated. In Northwest China, S₁₆ was the most frequent S-allele. In the Xinjiang region, S₆₆, S₄₉, and S₁₄ were the top three most frequent S-alleles. In North China, S₈, S₁₁, and S₅₃ were the top three most frequent S-alleles. In addition, the self-compatible type, S_C, was not detected in these 133 Chinese accessions. Finally, the phylogenetic tree of apricot S-alleles indicated that there are four groups of S-RNase genes (S₉₇/S₁₀₆, S₁₄/S_14a/S₆₆, S₉/S₁₇/S₄₄, and S₂₃/S₅₃) presenting a very close relation. These results provide more data on the S-genotypes of apricot accessions, which can support future breeding programs by aiding in the selection of the appropriate parents and contributing to efficient orchard design by combining cultivars with suitable pollinizers.

1. Introduction

Apricot (Prunus armeniaca L.), one of the most popular temperate tree fruit species, is widely grown around the world. The total planting area of apricot trees worldwide reached 5.73 million acres, with a total production of about 4.48 million tons (FAOSTAT, 2023, https://www.fao.org/faostat/ (accessed on 19 August 2025)). As the primary center of origin for apricot (Prunus armeniaca L.), China has extensive apricot germplasm diversity, with over 2000 distinct cultivars and landraces. The apricot fruit is attractive due to its unique pleasant aroma and high nutritional value. Unfortunately, most Chinese cultivars exhibit self-incompatibility, resulting in low fruit setting [1]. In apricot production, the single plant yield has a significant positive correlation with the self-(in)compatibility of the cultivar [2]. Because of self-incompatibility, it is necessary to select and grow suitable pollinating trees when establishing an apricot orchard.

Traditional compatibility assessment in controlled pollination trials primarily relied on empirical knowledge derived from agricultural practice. Early diagnostic criteria classified cultivars as definitively self-compatible when exhibiting fruit set rates exceeding 6% through self-pollination [2,3]. However, the investigation of fruiting rates is time-consuming and labor-intensive. In the laboratory, fluorescence microscopy can be used to observe pollen tube growth, but this method requires expensive equipment and complex procedures. Advances in research have revealed that the self-incompatibility of apricots is gametophytic, controlled by a single S-locus with multiple alleles [4]. This locus includes at least the stigma S-RNase gene and the pollen SFB gene. When the pollen and stigma exhibit the same allele, the growth of the pollen tube in the stigma is hindered, resulting in self-incompatibility [5].

Studies have demonstrated that the S-RNase genes exhibit tissue-specific expression patterns in stigma tissues. RNase activity is crucial for the inhibition of pollen tube growth during the incompatibility response and may be involved in the degradation of ribosomal RNA [6,7]. Therefore, the S-genotype of a given cultivar can be quickly detected through specific PCR amplification of S-alleles, and the compatibility between any two cultivars can be determined by comparing their S-genotypes. This technology provides a scientific basis for the selection of pollen cultivars in production [8]. S-allele characterization has been successfully implemented across the main Rosaceae species, including apricot [9,10], plum [11,12], Japanese apricot [13], sweet cherry [14,15], almond [16], apple [17], and strawberry [18]. This methodology has also been extended to other self-incompatible fruit crops beyond Rosaceae, including citrus [19] and pomelo [20].

For apricot, extensive research has been conducted on the S-RNase genes of apricot worldwide since 1998. Burgos et al. used non-equilibrium pH gradient electrophoresis to separate and identify S-RNases associated with gametophytic self-incompatibility in nine apricot cultivars. This was the first study to report the RNase activities associated with the incompatibility alleles S₁, S₂, S₃, S₄, S₅, and S₆ and the compatibility Sc in apricot [4]. Subsequently, Romero cloned three S-RNase genes from the apricot genome [6]. In 2010, a total of 31 different S-genotypes were assigned to the 51 Turkish apricot cultivars. The S-RNase intron regions used to determine their lengths and the S-genotypes were detected via polymerase chain reaction (PCR) amplification [5]. The S-genotypes of 55 Moroccan apricot accessions were determined, resulting in 37 self-compatible genotypes [21]. The S-alleles of 44 new European apricot genotypes were further identified [22]. Boubakri et al. identified the S-genotypes of 68 Eurasian apricot variety groups from the Iran–Caucasus region and the Mediterranean basin planted in Tunisian regions. Self-compatible apricot cultivars were also discovered [23]. In contrast to Eurasian research, studies on Chinese apricot S-genotypes remain limited and have emerged more recently. In 2005, a pair of primers was designed, and S-allele-specific PCR was developed. Nine S-alleles, S₁–S₉, were first revealed via S-allele-specific PCR and confirmed via Southern blot analysis [24]. The S-genotypes of 16 apricot cultivars were also determined via the S-allele PCR approach, and the results were confirmed via cross-pollination tests among these cultivars [25]. Wu Jun et al. [26] analyzed the S-genotypes of 14 Chinese apricot cultivars and named eight new S-alleles. Jiang Xin et al. [27] detected the S-genotypes of 27 apricot varieties cultivated in Xinjiang and found 15 new S-alleles. Cumulatively, 96 apricot S-RNase genes have been registered in GenBank, reflecting both methodological progress and global collaboration.

However, despite the extensive documentation of apricot cultivars, research on their self-incompatibility (SI) systems remains disproportionately limited. Furthermore, the presence of synonymies and homonymies among some known S-RNase alleles led to a lack of comparability between different studies. Notably, identical cultivars have been assigned conflicting S-RNase genotypes in separate investigations. For instance, the S-RNase genotype of the same apricot cultivar ‘Yinxiangbai’ was reported as S₂₃S₃₆ by Wuyun et al. [28] vs. S₉S₁₇ by Zhang et al. [25]. ‘Honghebao’ was also given two distinct S-RNase genotypes, S₉S₁₁ and S₈S₉, in different studies [24,25], and the S-RNase genotype of ‘Xinshiji’ was recorded as S₇S₈ and S₉S₁₀ in different studies. These discrepancies have limited the exchange of information. As a result, systematic research on the molecular mechanisms underlying apricot self-incompatibility has been hindered.

In China, apricot cultivation spans extensive areas across distinct geographical regions, primarily taking place in North China (Beijing, Tianjin, Hebei, Shanxi), Northwest China (Gansu, Shaanxi), and Northeast China (Liaoning, Heilongjiang, Jilin). There are also supplementary cultivation zones in Shandong and Henan. Regional cultivars show strong locality-specific characteristics, and there is some varietal overlap between regions, which contributes to remarkably diverse germplasm. However, most cultivars exhibit self-incompatibility, with S-genotype characterization remaining incomplete for many cultivars. Current S-genotype data for Chinese apricots remains limited, with fewer than 70 cultivars documented to date [24,25,26]. This incomplete understanding of incompatibility relationships has impeded the use of parental selection in hybrid breeding programs and the configuration of effective pollination trees in commercial orchards.

In this study, the S-RNase genotypes of 168 apricot cultivars, primarily native to China, were determined through targeted PCR analysis and S-RNase sequencing. Then, the S-allele frequency distribution patterns in Chinese apricot accessions were compared to those in foreign ones, and the geographic distribution of S-allele frequencies within Chinese apricot cultivars was analyzed. Furthermore, we performed molecular characterization of self-compatibility determinants in selected high-yield genotypes, aiming to identify S_C alleles within Chinese apricot accessions. The findings aid in establishing cross-incompatibility groups to avoid pollination problems in orchards and provide useful information for breeders in selecting parental genotypes. The novel S-RNase allele sequences obtained in this study provide critical data resources for advancing phylogenetic analyses of S-locus evolution within Rosaceae species.

2. Results

2.1. Identification of S-Alleles in Apricot

The S-genotypes of 168 apricot cultivars were characterized through PCR amplification of the second intron regions using five primer pairs, followed by sequencing and homology analysis with DNAMAN 8 software. Sequence alignment revealed 99–100% similarity among fragments of identical/near-identical length. Exon-derived amino acid sequences demonstrated complete conservation (100% homology) across all samples. Comprehensive analysis combining intron size polymorphisms with sequence patterns identified 46 distinct S-alleles through NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 20 February 2025))verification. Thirty-one alleles matched previously reported apricot S-RNase genes, while fifteen represented novel S-alleles. The fragment sizes and the GenBank accession numbers are shown in

Table 1. Sequence from 168 apricot cultivars aligned with 31 published S-alleles.

S-Allele	PCR Fragment Size (bp)/Intron Sizes (bp)					Genebank Accession No.
	EM-PC2consFD,	Pru-C2,	Pru-C2,	ASI II,	PaCons II-F,
	EM-PC3consRD	Amy-C5	PCE-R	Amy-C5	PaCons II-R
S2	895/706	1096/706				AY587562.1
S8		827/410	573/409	928/411		AY884212.1
S9		885/467				AY853594.1
S10	266/180					AY846872.1
S11	464/275	672/275				DQ868316.1
S12	359/171					DQ870628.1
S13	401/212					DQ870629.1
S14	493/305					DQ870630.1
S14a	495/309					GU574199.1
S15	469/283					DQ870631.1
S16	481/292	700/292				DQ870631.1
S17	657/461					DQ270001.1
S18-1 *	307/108					DQ270000.1
S18-2 *	1337/1148	1546/1148				DQ870634.1
S20	1936/1749					EF160078.1
S23	693/505					EU037262.1
S24	357/168	588/168				EU037263.1
S25	772/583	994/584				EU037264.1
S26			416/289			EU037265.1
S28		1352/946				EU836684.1
S30		726/285				EF185301.1
S35	312/124					GU574196.1
S36		718/299				GU574198.1
S40-1 *	539/353	749/353				GU354239.1
S40-2 *				542/164		HQ342870.1
S44			635/464			HQ342874.1
S49		653/212				HQ342879.1
S52	1296/1111	1512/1110				KF951503.2
S53		965/508				KF975455.2
S54					1296/891	KT223013.1
S66		704/308				JQ317152.1

* S_18-1 and S_18-2, represent two different S₁₈ alleles with different Genebank accession No.; S_40-1 and S_40-2 represent two different S₄₀ alleles with different Genebank accession No.

. The second introns of all 31 S-RNase genes were found within the hypervariable region (RHV), with sizes ranging from 180 bp (S₁₀) to 1749 bp (S₂₀), demonstrating a high degree of length polymorphism that distinguishes the different S-RNase alleles.

Most alleles showed unique GenBank accession correspondence. However, some S-RNase genes, such as S₁₈, S₄₀, and S₅₂, have the same S-allele accession number that corresponds to two GeneBank accession numbers. Furthermore, the gene sequences and amino acid sequences are also completely different. For S₅₂, after BLAST searches in the NCBI database, the sequence of the A-S₅₂ allele was matched to two PaS₅₂-RNases from two different apricot cultivars, ‘Daguohuanna’ and ‘Kabakehuanna’, under the accession numbers KF951503.2 and HQ342882.1, respectively. KF951503.2 showed the complete sequence of S₅₂, while HQ342882.1 was a partial sequence. In this study, the amino acid (AA) sequences from seven different cultivars with A-S₅₂ showed the highest similarity to S₅₂, with the accession number KF951503.2. It is different from the pattern of S₅₂, and there were four cultivars that were assigned S₁₈, associated with different Genebank accession Numbers: (DQ270000.1 and DQ870634.1) https://www.ncbi.nlm.nih.gov/nuccore/DQ270000.1/, https://www.ncbi.nlm.nih.gov/nuccore/DQ870634.1 (accessed on 20 February 2025)) are marked as S_18-1 and S_18-2 in this study. S_40-1 and S_40-2 represent two different S₄₀ with different Genebank accession Nos. (GU354239.1 and HQ342870.1) (https://www.ncbi.nlm.nih.gov/nuccore/GU354239.1, https://www.ncbi.nlm.nih.gov/nuccore/HQ342870.1 (accessed on 20 February 2025)).

2.2. Identification of New S-Alleles in Apricot

The DNA sequences were initially aligned with the Prunus S-RNase cDNA sequence exhibiting the highest homology from GenBank. Intron/exon boundaries were identified using the conserved GT/AG splicing rule, with intron sizes determined subsequently. Corresponding amino acid sequences were deduced through DNAMAN software analysis and compared against existing S-RNase homologs in GenBank. Fifteen novel S-alleles were identified with characteristic Prunus S-RNase structural features, including four conserved domains (C2, C3, RC4, and C5), a hypervariable region (RHV), and an undocumented, unique intron size configuration. Critical analysis revealed distinct RHV variations in these sequences compared to all registered P. armeniaca S-RNase genes in GenBank. Based on sequence homology analysis through NCBI GenBank and following the nomenclature protocols of Vilanova et al. [29] and Halázs et al. [5], these new alleles were designated as S₉₃–S₁₀₇, continuing the existing S-RNase gene number in GenBank. The novel sequences have been deposited in GenBank under the accession numbers PV206780–PV206794, with specific assignments corresponding to each allele (

Table 2. Fifteen new S-alleles in apricot accessions.

S-Alleles	Cultivar No.	Cultivar Name	Primer Pairs and PCR Fragment Size (bp)/Intron Sizes (bp)		GeneBank Accession No.
			EM-PC2consFD, EM-PC3consRD	Pru-C2, Amy-C5
S93	22	Jingjia No. 2	273/90		PV206781
S94	46	Dafeng	502/319		PV206782
S95	28	Jingren No.4		683/275	PV206783
S96	74	Hongjinzhen		575/173	PV206784
S97	58	Xingtaihongjiexing		746/458	PV206785
S98	25	Jingren No.1		871/460	PV206791
S99	158	Harmat		884/460	PV206786
S100	82	Dongning No.2		924/522	PV206792
S101	96	Lintonghongxing		1348/928	PV206787
S102	23	Jingluofeng		1416/996	PV206793
S103	52	Longwangmao		1452/1044	PV206788
S104	75	Jinkaite		1466/1035	PV206789
S105	100	Niujiaobangzi		1625/1214	PV206794
S106	31	Longquanwuxiangbai	533/346		PV206790
S107	69	Yuhankui	1227/1046		PV206780

). The second introns within the RHV demonstrated significant length polymorphism (90 bp -1214 bp), providing distinctive molecular characters for different S-alleles (Figure 1 and Table 2).

2.3. Identification of Sc-Allele

Previous studies have confirmed that the coding regions of S₈- and S_C-RNase alleles are identical, with the S₈- and S_C-haplotypes differing exclusively in their SFB gene structure. Specifically, a 358 bp insertion was identified in the SFB_C. To discriminate the S_C-haplotype, we implemented a two-tiered molecular strategy. Initially, the allele-specific primer pair AprSC8R/PaConsI F was selected to amplify the S_C/S₈-RNase allele. As demonstrated in Figure 2A, a 546 bp fragment was successfully amplified in six cultivars, including the positive control cultivars ‘Bergeron’ (S₂S_C) and ‘Bora’ (S₉S_C), with determined S-genotypes [30]. In contrast, no amplification products were observed in the negative control cultivar ‘Hargrand’ (S₁S₂). Subsequently, employing the primer pair AprFBC8 [5], we distinguished between the S₈- and S_C-alleles. Cultivars carrying the SFB_C-allele showed an amplification product fragment of approximately 500 bp, whereas those with the SFB₈-allele produced a fragment of about 150 bp (Figure 2B). The combinatorial results conclusively revealed that only three cultivars, ‘Nifa’, ‘Bora’, and ‘Bergeron’, were self-compatible, carrying the S_C-haplotype. The S₈-allele was identified in ‘H-48’, ‘Zhupishui’, and ‘99-31’ germplasm (Figure 2B).

2.4. Analysis of S-Genotypes of 168 Apricot Cultivars

Table 3. S-genotypes of 168 apricot cultivars.

No.	Cultivar	Province, Country of Origin	S-Genotype	Areas
1	Baixing 10-38	Beijing, China	S9S10	North China
2	Beianhe	Beijing, China	S9S17
3	Beishandabian	Beijing, China	S10S53
4	Beizhaihongxing	Beijing, China	S93S103
5	Chuanling	Beijing, China	S8S53
6	Dabada	Beijing, China	S36
7	Fangshanhongxing	Beijing, China	S11
8	Fangshanxiangbai	Beijing, China	S17S53
9	Guajiayutianhexiangbai	Beijing, China	S8S17
10	H20-5	Beijing, China	S9S95
11	H21-25	Beijing, China	S23S53
12	H23-37	Beijing, China	S14S66
13	H23-43	Beijing, China	S14S66
14	H23-44	Beijing, China	S14S66
15	H-48	Beijing, China	S8S52
16	Honghuomeizi	Beijing, China	S8S53
17	Huangjianzui	Beijing, China	S2S66
18	Jingcuihong	Beijing, China	S10S11
19	Jingfeihong	Beijing, China	S8S11
20	P35-146	Beijing, China	S8S30
21	Jingjia No.1	Beijing, China	S24S49
22	Jingjia No.2	Beijing, China	S24S93
23	Jingluofeng	Beijing, China	S11S102
24	Jingluohong	Beijing, China	S8S95
25	Jingren No.1	Beijing, China	S98
26	Jingren No.2	Beijing, China	S8
27	Jingren No.3	Beijing, China	S103
28	Jingren No.4	Beijing, China	S95
29	Jingren No.5	Beijing, China	S24
30	Jingxianghong	Beijing, China	S10S11
31	Jingzaohong	Beijing, China	S9S36
31	Longquanwuxiangbai	Beijing, China	S53S106
33	Luotuohuang	Beijing, China	S8S11
34	Mituoluo	Beijing, China	S11
35	P51-54	Beijing, China	S11S17
36	Pingguohong	Beijing, China	S8S66
37	Shanbaixing	Beijing, China	S17S53
38	Shanhuangxing	Beijing, China	S8S11
39	Xiaoyubada	Beijing, China	S23S53
40	Yingchun	Beijing, China	S24S36
41	Zaoxiangbai	Beijing, China	S10S53
42	Zhuyaozi	Beijing, China	S10S35
43	Guanlaoyelian	Tianjin province, China	S8S16
44	Wanxiangbai	Tianjin province, China	S17S53
45	Cangzaotian No.1	Hebei province, China	S11S49
46	Chuanzhihong	Hebei province, China	S8S24
46	Dafeng	Hebei province, China	S8S94
48	Erhongxing	Hebei province, China	S11S17
49	Ganyu	Hebei province, China	S8S16
50	Jiguang	Hebei province, China	S8S9
51	Jinyu	Hebei province, China	S13S52
52	Longwangmao	Hebei province, China	S11S103
53	Muguaxing	Hebei province, China	S11S16
54	Qingmisha	Hebei province, China	S9S44
55	Shizixing	Hebei province, China	S10S53
56	Tianedan	Hebei province, China	S9S16
57	Xingtaidahongxing	Hebei province, China	S17S36
58	Xingtaihongjiexing	Hebei province, China	S8S97
59	You No.1	Hebei province, China	S11S103
60	You No.2	Hebei province, China	S11
61	Zaohongxing	Hebei province, China	S36
62	Zaohuang	Hebei province, China	S9S53
63	Guanyelian	Shanxi province, China	S28
64	Hongbada	Henan province, China	S101	Central China
65	Lixing	Henan province, China	S40-1
66	Mixiangxing	Henan province, China	S11S15
67	Yangshaohuang No.1	Henan province, China	S13S102
68	Yangshaohuang No.2	Henan province, China	S36S102
69	Yuhankui	Henan province, China	S11S107
70	Yuzaoguan	Henan province, China	S9S53
71	Badou	Anhui, China	S36S102	East China
72	Caizihuang	Shandong province, China	S11S16
73	Honghebao	Shandong province, China	S9S16
74	Hongjinzhen	Shandong province, China	S96
75	Jinkaite	Shandong province, China	S11S104
76	Kuijin	Shandong province, China	S11S102
77	Laoshanhong	Shandong province, China	S11
78	Pingdingzhen	Shandong province, China	S12S36
79	Qingdaodahong	Shandong province, China	S11
80	Zaoyu	Shandong province, China	S20
81	Dongning No.1	Heilongjiang province, China	S16S100	Northeast China
82	Dongning No.2	Heilongjiang province, China	S100
83	Baixing	Liaoning province, China	S10
84	Daxingmei	Liaoning province, China	S8
85	Guofeng	Liaoning province, China	S8S18-2
86	Caoxing	Gansu province, China	S8S17	Northwest China
87	Dajiexing	Gansu province, China	S16
88	Dapiantou	Gansu province, China	S36S102
89	Zhupishui	Gansu province, China	S8
90	Taoxing	Ningxia province, China	S16
91	Meixing	Qinghai province, China	S25
92	Caopixing	Shaanxi province, China	S16
93	Haidongxing	Shaanxi province, China	S16
94	Jidanxing	Shaanxi province, China	S25S26
95	Lanzhuhong	Shaanxi province, China	S16S23
96	Lingtonghongxing	Shaanxi province, China	S101
97	Lintonghongxing No.2	Shaanxi province, China	S16
98	Liquanerzhuanzi	Shaanxi province, China	S16
99	Machuanling	Shaanxi province, China	S11S16
100	Niujiaobangzi	Shaanxi province, China	S105
101	Niujiaohuang	Shaanxi province, China	S105
102	Qinwang	Shaanxi province, China	S40-2
103	Touwojie	Shaanxi province, China	S16
104	Xinong 25	Shaanxi province, China	S10S36
105	Yinxiangbai	Shaanxi province, China	S36S53
106	Zaotianhe	Shaanxi province, China	S16S105
107	Zhanggongyuan	Shaanxi province, China	S24S25
108	Ake	Xinjiang, China	S12S66
109	Chibangzi	Xinjiang, China	S13S49
110	Cuijianali	Xinjiang, China	S49S66
111	Dabaiyou	Xinjiang, China	S18-2S49
112	Daguohuanna	Xinjiang, China	S14S49
113	Dayoujia	Xinjiang, China	S49S66
114	Heiyexing	Xinjiang, China	S16S66
115	Kezimayisang	Xinjiang, China	S14aS66
116	Kuikepiman	Xinjiang, China	S11S53
117	Kumaiti	Xinjiang, China	S49S66
118	Liguangxing	Xinjiang, China	S24S49
119	Muyage	Xinjiang, China	S14S66
120	Pinaizi	Xinjiang, China	S13S49
121	Qiaoerpang	Xinjiang, China	S14S66
122	Saimaiti	Xinjiang, China	S24S53
123	Shushangganxing	Xinjiang, China	S14S66
124	Xinjiangshaxing	Xinjiang, China	S8S102
125	Xinshisheng	Xinjiang, China	S52S53
126	Bingtangwei	China	S17S25	Unclear
127	Haihongzhen	China	S9S17
128	Haiquanhong	China	S8S11
129	Hongxing	China	S11
130	Kuhehonglian	China	S16S102
131	Longjingbaixing	China	S15S16
131	Xiaopuxiangbai	China	S17S53
133	Yinxing	China	S23S53
134	Meiwuming	American	S2S8	Foreign areas
135	99-2	Czech Republic	S8S9
136	99-12	Czech Republic	S24
137	99-15	Czech Republic	S8S9
138	99-27	Czech Republic	S52
139	99-31	Czech Republic	S8S66
140	99-37	Czech Republic	S17S18-2
141	99-38	Czech Republic	S11
142	99-43	Czech Republic	S9S17
143	99-44	Czech Republic	S24S9
144	99-45	Czech Republic	S11
145	Aurora	Czech Republic	S8S9
146	Betinka	Czech Republic	S8S52
147	Hargand	Czech Republic	S2
148	Jennycot	Czech Republic	S2S9
149	Jitka	Czech Republic	S24S49
150	LE5137	Czech Republic	S24
151	Rumjanaja	Czech Republic	S8S53
152	Bergeron	France	S2SC
153	Canino	France	S2S9
154	Early orange	France	S9S11
155	Cegledi bibor kajszi	Hungary	S14S66
156	Cegledi orias	Hungary	S14S66
157	Cegledi piroska	Hungary	S36
158	Harmat	Hungary	S99
159	B088	Italy	S54
160	B089	Italy	S2S9
161	B095	Italy	S49S93
162	Bora	Italy	S9SC
163	Corlate	Italy	S18-1
164	Ninfa	Italy	S2SC
165	Wondercot	Italy	S9S52
166	Yidalixing	Italy	S52
167	Pinghexing	Japan	S8S9
168	Xinzhoudashi	Japan	S16

presents the S-genotype profiles of 168 apricot cultivars collected from diverse geographical regions. Among these cultivars, 122 (72.6%) accessions exhibited heterozygous S-genotypes at their S-RNase loci, demonstrating two distinct S-alleles for each cultivar. The other 46 cultivars, such as ‘Dabada’, ‘Fangshanhongxing’, ‘Guanyelian’, ‘Liquanerzhuanzi’, ‘Jingren No.1’, ‘Zhupishui’, ‘Daxingmei’, and ‘99-45’, showed mono-allelic expression at the S-locus, with only one detectable S-allele, while the complementary allele remained unidentified. Notably, 31 cultivars were found to carry novel S-RNase alleles (S₉₃–S₁₀₇) that were previously uncharacterized.

These results were supported by a previous study on controlled cross-pollination tests for some apricot cultivars [1]. The fruit set percentages of ‘luotuohuang’ × ‘Honghebao’, ‘luotuohuang’ × ‘Dapiantou’, ‘Dapiantou’ × ‘Honghebao’, ‘Xinong 25’ × ‘Luotuohuang’ were 10.8–16.7%. According to the accepted criteria [2,3], these cultivars are cross-compatible. Correspondingly, in this study, each combination of cultivars has a different S-genotype. The S-genotypes of ‘luotuohuang’, ‘Honghebao’, ‘Dapiantou’, and ‘Xinong 25’ were S₈S₁₁, S₉S₁₆, S₃₆S₁₀₂, and S₁₀S₃₆, respectively. ‘Chuanling’ (S₈S₅₃) and ‘Luotuohuang’ (S₈S₁₁), which shared one S-allele, were considered as semi-compatible and, usually, cannot be selected as pollinizers for each other.

2.5. S-Allele Frequency Distribution Patterns Between Chinese and Foreign Apricot Accessions

As illustrated in Figure 3, S₈ emerged as the predominant S-allele across all 168 apricot accessions, followed sequentially by S₁₁, S₉, S₁₆, and S₅₃. Comparative analysis revealed distinct distribution patterns between Chinese cultivars and foreign accessions. For Chinese apricot cultivars, S₁₁ was the most frequent S-allele (occurred in 26 genotypes), followed by S₈ (in 23 genotypes), S₁₆ (in 20 genotypes), S₅₃ (in 19 genotypes), S₆₆ (in 14 genotypes), S₁₇ (in 12 genotypes), S₉ (in 11 genotypes), and S₄₉ (in 10 genotypes). The remaining 35 S-alleles occurred at relatively lower frequencies, each present in fewer than 10 genotypes. For S₂, S_14a, S₂₀, S₂₆, S₂₈, S₃₀, S_40-1, S_40-2, S₄₄, S₉₄, S₉₆, S₉₇, S₉₈ S₁₀₄, S₁₀₆, and S₁₀₇, each S-allele was detected in only one genotype. For foreign accessions, S₉, S₈, S₂, S₂₄, and S₅₂ were the top three most frequent, occurring in 12, 8, and 7 genotypes, respectively. Each of the eight S-alleles, including S₁₆, S_18-1, S_18-2, S₃₆, S₅₃, S₅₄, S₉₃, and S₉₉, was also detected in only one European cultivar. In both Chinese apricot cultivars and foreign accessions, S₈ and S₉ were the relatively more frequent S-alleles. Sc was found in only three European genotypes, and could not be detected in the tested Chinese apricot cultivars. In addition, it was found that S₅₃ was mostly found in white-fleshed apricot cultivars, such as ‘Xiaoyubada’, ‘Fangshanxiangbai’, ‘Shanbaixing’, ‘Chuanling’, and ‘Zaoxiangbai’, which comprised 11 of the 19 cultivars with S₅₃ (Table S1).

2.6. Geographic Distribution Patterns of S-Allele Frequencies in Chinese Apricot Cultivars

The distribution of S-alleles demonstrated significant geographic dependency among Chinese apricot accessions, with distinct frequency patterns emerging across five major regions (Figure 4 and Table S2). The key distribution characteristics of the alleles exhibit a diverse geographic spectrum. There are three alleles, S₁₁, S₁₆, and S₁₀₂, that are present in four regions. Additionally, there are tri-regional alleles, such as S₈, S₉, S₁₀, S₁₃, S₁₈, S₃₆, and S₅₃; bi-regional alleles, like S₁₄ S₁₇, S₂₃, S₂₄, S₃₅, S₄₀, S₄₉, S₅₂, S₆₆, and S₁₀₁; and 25 alleles that are specific to single regions. In terms of regional frequency profiles, the northwestern region of China, encompassing Gansu, Shaanxi, Ningxia, and Qinghai, has 40 accessions containing 23 S-alleles, with S₁₆ being the dominant allele. The Xinjiang region has 18 accessions with 14 alleles, with S₆₆ leading in frequency at 25%, followed by S₄₉ at 22%, and S₁₄ at 11% (Table 3). In North China, which includes Beijing, Tianjin, Hebei, and Shanxi, there are 63 accessions exhibiting 28 alleles. The most frequent alleles are S₈ at 15%, S₁₁ at 13%, S₅₃ at 10%, and S₉ and S₁₇ at 7%. In the northeastern part of China, there are five cultivars with five S-alleles (S₈, S₁₀, S₁₆, S_18-2, and S₁₀₀) detected, with S₈ and S₁₀₀ being the dominant S-alleles. In Central China, specifically Henan Province, there are seven accessions containing 11 alleles, with S₁₁ and S₁₀₂ co-dominant at 17% each. Lastly, in East China, which covers Shandong and Anhui, there are ten accessions with nine alleles, with S₁₁ being the predominant allele at 31%.

2.7. S-RNase Gene Sequence Alignment and Phylogeny

The predicted amino acid sequences between the C2 and C5 regions from 46 detected S-RNases were aligned with each other using the Clustal W algorithm, and a neighbor-joining tree was constructed. The phylogenetic tree demonstrated that there are four groups of S-RNase genes that are closely related, such as S₉₇ and S₁₀₆; S₁₄, S_14a, and S₆₆; S₉, S₁₇, and S₄₄; and S₂₃ and S₅₃ (Figure 5). Detailed sequence comparisons showed distinct amino acid (AA) variations among these groups. For S₉₇ and S₁₀₆, a single amino acid difference was observed in the C3 domain. S_14a vs. S₁₄, displayed two AA and four AAs variations in the C2 and C3 conserved regions, respectively. Both S₁₄ and S_14a exhibited an additional valine residue (V) in the hypervariable region (RHV) compared to S₆₆. Compared to S₉, S₁₇ lacked one valine residue (V) in the RHV, while S₄₄ lacked two amino acid residues (leucine and valine, L and V). In comparison with S₅₃, S₂₃ has a deletion of one amino acid (a tyrosine, Y) in the RHV region and has another difference of one amino acid in the C3 region.

3. Discussion

The spatial distribution of S-RNase alleles exhibits distinct biogeographical clustering, serving as a molecular signature for tracing germplasm evolution. Our analyses revealed pronounced regional specificity. S₆₆ and S₄₉ mainly appear in the Xinjiang apricot population. S₁₆ is present with high frequency in the north regions, including Northwest China (Figure 4 and Table S2). These differences may reflect varying environmental selection pressures or the effects of genetic drift across regions. Data from the literature indicated that the S₇-allele is only present in Southern Europe and North Africa [30]. The alleles S₁₀–S₁₄ showed an Armenian origin and have also been detected in Turkish and Moroccan apricots, but are absent in Western and Southern European countries [23]. The self-compatible type, S_C, was not detected in Chinese apricots, only existing in European apricot cultivars. It is generally accepted that the genetic diversity of apricots decreases from east to southwest, and in this context, it is questionable whether S_C might be one of the causes [30]. In addition, in this study, we also found that S₈, S₉, and S₁₁ appear at relatively high frequencies in both Chinese native cultivars and some European cultivars (Figure 3), which might be ancient genes of apricot cultivars.

In plum, the S-locus genotype is suitable for diversity studies in polyploid Prunus species [12]. Alburquerque et al. [31] declared that the number of S-alleles in apricot should be low, as only eight alleles were detected in Mediterranean and North American accessions. Halász et al. [10] identified more (at least nine) new alleles in the tested Eastern European and Central Asian genotypes, and further explained that the Central Asian eco-geographical group has a more variable genetic background compared to the European group. In this study, 43 S-alleles were detected among 133 Chinese apricot cultivars, and the diversity of S-alleles is related to the rich genetic diversity of Chinese apricot resources.

The S-genotype may be highly associated with certain trait characteristics of the cultivar. In this study, we found that S₅₃ appears at a high frequency in white-fleshed cultivars (Table S1). Cultivars with the S₈ genotype have a higher yield, similar to that of S_C cultivars. The self-compatibility of S₈ cultivars needs further verification (Table S3). S₆₆ mainly appears in the Xinjiang apricot population. A defining morphological feature of these apricot cultivars is their glabrous exocarp (fruit epidermis), characterized by a smooth cuticular structure and distinct glossiness (Table S4). For botanical classification, they are exclusively classified as Prunus armeniaca var. glabra Sun S.X. Supporting this point, Wu et al. [26] reported that the more frequent occurrence of these three alleles may be due to their linkage to beneficial traits or conferring adaptation to local environmental conditions. Also, in sweet cherry, certain S-alleles have a higher selective advantage and confer beneficial economic characteristics [32].

The S-allele type has been used as a means of cultivar identification. Among these tested cultivars, ‘Jingzaohong’ (S₉S₃₆) was a new accession developed by cross-breeding in recent years. Its female parent and pollen parent were ‘Dapiantou’ (S₃₆S₁₀₂ and ‘Honghebao’ (S₉S₂₆), respectively. ‘S₉’ and ‘S₃₆’ were inherited from ‘Honghebao’ (S₉S₁₆) and ‘Dapiantou’ (S₃₆S₁₀₂), respectively (Table 3). The present data shows good correspondence between the S-alleles of the parents and those inherited by the individual cultivars. Another new apricot cultivar ‘Jingluofeng (S₁₁S₁₀₂)’ was selected from the seeding of the cultivar ‘Luotuohuang (S₈S₁₁)’, and ‘S₁₁’ was inherited from its female parent ‘Luotuohuang’ (S₈S₁₁). These results are from the previous report by Zhang et al. on Chinese apricots [25]. For the cultivars ‘Hongfeng’ (S₉S₁₀) and ‘Xinshiji’ (S₉S₁₀), ‘S₉’ and ‘S₁₀’ were inherited from their parents ‘Honghebao’ (S₉S₁₁) and ‘Erhuacao’ (S₁₀S₁₁), respectively. Common alleles may indicate a common origin [10], a notion supported by SSR markers [33].

In order to verify the homonymy in S-RNase naming among apricot cultivars, we analyzed the S-alleles identified in this study with all known synonyms from previous studies (Table S5). There are 17 cultivars in this study that were assigned S-genotypes in previous studies. Some cultivars, such as ‘Jiguang’, ‘Zhanggongyuan’, and ‘Bergeron’, had the same S-genotypes in this study as in previous studies, suggesting that the cultivar names are accurate. ‘Qiaoerpang’, ‘Yinxiangbai’, ‘Honghebao’, ‘Canino’, and ‘Ninfa’ had only one similar S-allele. The other nine cultivars presented completely different S-genotypes. These cultivars may be regarded as instances of homonymy.

China is recognized as the center of apricot origin and has an extremely abundant apricot germplasm [34]; however, few S-genotypes of this germplasm have been determined. In this study, S-genotypes of as many as 133 apricots native to China were identified. However, there were 46 cultivars that exhibited only one S-allele (Table 3). In this experiment, all 46 varieties were analyzed using five pairs of primers, and each primer pair consistently yielded only a single allele. A similar result was reported by Boubakri et al. in a study on Tunisian apricot cultivars, in which only one S-allele was detected [23]. However, the underlying reasons for this observation remain unclear. One possibility is that large intron fragments within the S-RNase of these cultivars may hinder effective amplification [26], making the current primers less suitable for these specific genotypes. Additionally, some cultivars have complex genetic backgrounds. For instance, ‘Jingren No.2’, ‘Jingren No.1’, ‘Jingren No.3’, ‘Jingren No.4’, and ‘Jingren No.5’ were all derived from distant hybridization between apricot (Prunus armeniaca) and almond (Prunus amygdalus) [35]. Although the primers used are generally applicable across Prunus species, designing primers based on specific sequence features and screening optimal primer combinations may improve amplification efficiency in these genetically complex accessions. Another plausible explanation is that some cultivars exhibit homozygosity at the S-locus, a phenomenon previously reported in Prunus species [10]. To accurately determine the S-haplotypes of these undetected alleles, more advanced genomic approaches such as long-read sequencing should be employed.

Currently, comprehensive S-genotype data can provide scientific guidance for apricot production. First, S-genotype data enables the creation of empirically validated cross-incompatibility matrices for optimized orchard pollinizer design. These cross-compatibility matrices, which group cultivars by S-genotype, directly support pollinizer selection (Table S6). Secondly, this data provides a molecular foundation for strategic parental selection in apricot breeding programs, particularly for developing self-compatible cultivars through specific S-alleles. The newly identified S-RNase genes substantially expand the known allele diversity within P. armeniaca and provide new molecular markers for phylogenetic studies of S-locus evolution in Rosaceae.

4. Materials and Methods

4.1. Plant Materials

A total of 168 apricot accessions with known and unknown compatibility phenotypes were analyzed in this study. The collection comprised 133 Chinese cultivars and 35 international accessions, including 32 European cultivars, 1 American accession, and 2 Japanese genotypes. These cultivars were obtained from the apricot germplasm collection of the Institute of Forestry and Pomology, Beijing Academy of Agriculture and Forestry Sciences.

4.2. DNA Extraction

Total genomic DNA was extracted from young leaves using the Hi-DNAsecure Plant kit DP350-03 (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. The concentration of the isolated DNA was determined using a Thermo Scientific NanoDrop™ spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA.) and via electrophoresis on 1% agarose gels.

4.3. PCR Amplification

Five primer pairs, previously reported as universal primer combinations for Prunus plants, were used to perform the specific PCR amplification of S-alleles: EM-PC2consFD+EM-PC3consRD, PruC2+Amy-C5R, PruC2+PCE-R, As1II+AmyC5R, and PaConsII-F+PaConsII-R. The specific primer sequences are shown in

Table 4. Sequences of five primer pairs used for S-RNase gene amplification.

Number	Primer Name	Sequence (5′ to 3′)	References
1	EM-PC2consFD	TCACM * ATYCATGGCCTATGG	Sutherland et al., 2004 [36]
	EM-PC3consRD	AW * CTR * CCRTGY * TTGTTCCATTC
2	Pru-C2	CTATGGCCAAGTAATTATTCAAACC	Tao et al., 1999 [37]
	Pru-C5	TACCACTTCATGTAACAACTGAG
3	Pru-C2	CTATGGCCAAGTAATTATTCAAACC	Tao et al., 1999; Wu et al., 2009 [26,37]
	PCE-R	TGTTTGTTCCATTCGCCTTCCC
4	AS1II	TATTTTCAATTTGTGCAATGG	Tamura et al., 2000 [16]
	AmyC5R	CAAAATACCACTTCATGTAACAAC
5	PaCons II-F	GGCCAAGTAATTATTCAAACC	Sonneveld et al., 2003 [14]
	PaCons II-R	CATAACAAARTACCACTTCATGTAAC

* M = A/C; Y = C/T; W = A/T; and R = A/G.

. PCR cycling parameters and conditions were as described in the respective references.

4.4. Cloning and Sequencing of S-Alleles

The PCR-amplified fragments were excised from 1.2% agarose gels and purified using the Agarose Gel DNA Purification Kit (TaKaRa, Dalian, China). The purified products were cloned into the pEASY-Blunt Simple Cloning vector (Tiangen Biotech, Beijing, China) following the manufacturer’s instructions and transformed into Escherichia coli DH5α. To obtain an accurate sequence and avoid errors caused by PCR, three independent positive clones of each fragment were sequenced by Sangon Biotech Company (Shanghai, China).

To identify the S_C-haplotype, a two-step approach was used, as described by Halász et al. [5]. For the first step, an allele-specific reverse primer, AprSC8-R, was used in combination with PaConsI-F [14] to amplify the S_C/S₈-RNase allele. For the second step, specific primers, AprFBC8-F and AprFBC8-R, were designed selectively to amplify the SFBC/8 alleles [38].

4.5. Analysis for Sequence Data and Identification of S-Alleles

DNAMAN 8 software was employed for multiple sequence alignment and annotation of putative S-alleles. Nucleotide sequences were subjected to homology analysis using BLASTN against the NCBI nucleotide database. Intron–exon boundaries were determined through comparative alignment of genomic DNA with corresponding DNA references from Prunus armeniaca S-alleles. The translated amino acid sequences spanning the conserved C2–C5 domains were derived from the annotated nucleotide data. Subsequent protein-level verification employed BLASTP (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 20 February 2025)) to compare deduced amino acid sequences against the NCBI non-redundant database.

4.6. Construction of Phylogenetic Tree Based on S-RNase Gene Sequences

All the predicted amino acid sequences between the C2 and C5 regions from 46 detected S-RNase genes were aligned with each other using the ClustalW algorithm in MEGA 11, and a neighbor-joining tree was constructed. Two apple (Malus domestica) S-RNase alleles (Md-S₂₄: AWL24801.1; Md-S₅₈: AWL24810.1) were used as outgroup. The Poisson correction method was used to compute evolutionary distances, and the reliability test was performed 1000 times using Bootstrap.

5. Conclusions

In this study, the S-genotypes of 168 apricot cultivars were determined via cloning and sequencing the specific PCR products. A total of 46 different S-RNase alleles, with 31 previously reported and 15 new alleles, were identified. The self-compatible type, S_C, was not detected in the 133 Chinese accessions tested. Then, the S-allele frequency distribution patterns were investigated, and the results indicated that S₈ emerged as the predominant S-allele across all tested apricot accessions, followed sequentially by S₁₁, S₉, S₁₆, and S₅₃. The geographic distribution patterns of S-allele frequencies in Chinese apricot cultivars were also analyzed. The most frequent alleles in Northern China are S₈, S₁₁, and S₅₃. In the northwestern region of China, S₁₆ was the dominant S-RNase gene. Based on the S-RNase gene sequence data, the phylogenetic tree of apricot S-alleles was constructed. These results can benefit future breeding programs by aiding the selection of appropriate parents and can contribute to efficient orchard design by promoting the planting of cross-compatible apricot cultivars.