Next Article in Journal
NR3C1/GLMN-Mediated FKBP12.6 Ubiquitination Disrupts Calcium Homeostasis and Impairs Mitochondrial Quality Control in Stress-Induced Myocardial Damage
Next Article in Special Issue
Small RNA-Seq Reveals the Effect of Formaldehyde Treatment on Chicken Embryo Liver microRNA Profiles
Previous Article in Journal
Biallelic BAIAP3 Variants Are Associated with Isolated Retinitis Pigmentosa
Previous Article in Special Issue
Genome of Russian Snow-White Chicken Reveals Genetic Features Associated with Adaptations to Cold and Diseases
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Association Studies in Japanese Quails of the F2 Resource Population Elucidate Molecular Markers and Candidate Genes for Body Weight Parameters

by
Natalia A. Volkova
1,†,
Michael N. Romanov
1,2,3,*,†,
Nadezhda Yu. German
1,
Polina V. Larionova
1,
Anastasia N. Vetokh
1,
Ludmila A. Volkova
1,
Alexander A. Sermyagin
4,
Alexey V. Shakhin
1,
Darren K. Griffin
2,3,
Johann Sölkner
5,
John McEwan
6,
Rudiger Brauning
6 and
Natalia A. Zinovieva
1,*
1
L. K. Ernst Federal Research Center for Animal Husbandry, Dubrovitsy, Podolsk 142132, Russia
2
School of Natural Sciences, University of Kent, Canterbury CT2 7NJ, UK
3
Animal Genomics and Bioresource Research Unit (AGB Research Unit), Faculty of Science, Kasetsart University, Chatuchak, Bangkok 10900, Thailand
4
Russian Research Institute of Farm Animal Genetics and Breeding—Branch of the L. K. Ernst Federal Research Centre for Animal Husbandry, Pushkin, St. Petersburg 196625, Russia
5
BOKU University, 1180 Vienna, Austria
6
AgResearch, Invermay Agricultural Centre, Mosgiel 9053, New Zealand
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2025, 26(17), 8243; https://doi.org/10.3390/ijms26178243
Submission received: 1 July 2025 / Revised: 21 August 2025 / Accepted: 21 August 2025 / Published: 25 August 2025
(This article belongs to the Special Issue Molecular Research in Avian Genetics)

Abstract

Molecular research for genetic variants underlying body weight (BW) provides crucial information for this important selected trait when developing productive poultry breeds, lines and crosses. We searched for molecular markers—single nucleotide polymorphisms (SNPs)—and candidate genes associated with this trait in 240 F2 resource population Japanese quails (Coturnix japonica). This population was produced by crossing two breeds with contrasting growth phenotypes, i.e., Japanese (with lower growth) and Texas White (with higher growth). The birds were genotyped using the genotyping-by-sequencing method followed by a genome-wide association study (GWAS). Using 74,387 SNPs, GWAS resulted in 142 significant SNPs and 42 candidate genes associated with BW at the age of 1, 14, 28, 35, 42, 49 and 56 days. Hereby, 25 SNPs simultaneously associated with BW at more than one age were established that colocalized with nine prioritized candidate genes (PCGs), including ITM2B, SLC35F3, ADAM33, UNC79, LEPR, RPP14, MVK, ASTN2, and ZBTB16. Twelve PCGs were identified in the regions of two or more significant SNPs, including MARCHF6, EGFR, ADGRL3, ADAM33, NPC2, LTBP2, ZC2HC1C, SATB2, ASTN2, ZBTB16, ADAR, and LGR6. These SNPs and PCGs can serve as molecular genetic markers for the genomic selection of quails with desirable BW phenotypes to enhance growth rates and meat productivity.

1. Introduction

Research on the molecular basis for the formation of physiological traits and genetic variants in livestock [1,2], including poultry breeds [3,4,5,6,7], is an important prerequisite for the implementation of promising performance and adaptation phenotypes [8,9,10,11]. It has practical use in genomic selection, forecasting and assessment of productive and reproductive potential [12,13,14,15,16]. The development and competitiveness of industrial poultry farming largely depends on the creation and use of high productive breeds and crosses characterized by improved egg and meat qualities [17,18,19,20,21,22]. This is impracticable to implement without effective selection work aimed at searching for and identifying valuable molecular markers and genotypes [23,24,25,26,27]. Such work makes use of modern high-throughput and whole-genome methods and approaches [28,29,30,31,32] based on the study of physiological and molecular genetic mechanisms of the formation and manifestation of selectively significant traits [33,34].
Body weight (BW) is one of the main traits taken into account in poultry breeding and selection. This is particularly the case when developing commercial crosses and lines for the production of both meat and eggs [35,36,37,38]. BW indicator and the dynamics of its change during ontogenesis serve as an important criterion for monitoring the development, assessment and prediction of the productive qualities of poultry [39,40,41,42]. A number of studies have established correlations between BW and linear measurements [39,40,41,43]. It has been shown that higher BW in the early ontogenesis period of birds positively correlates with rapid growth, higher BW and good meat qualities of birds at a later age [42,44,45]. Smaldone et al. [46] reported the results of studies on the effectiveness of using two commercially available types of electrical equipment for stunning broilers at slaughter, taking into account their BW. An inverse relationship was found between broiler BW and the number of carcass lesions (i.e., hemorrhages and dark meat).
BW indicator is also important in egg poultry farming where BW of laying hens correlates with their egg performance and quality [45,47]. In particular, Raziq et al. [47] showed that laying hens with a higher BW at the beginning of egg laying, compared to their peers with lower or average BW, were characterized by a higher BW at maturity, an earlier maturation period and a higher egg weight. Herewith, hens with a lower BW at the beginning of egg laying had a higher egg production. A negative correlation between BW of laying hens and egg production was also confirmed for Japanese quails (Coturnix japonica; CJA) [48]. Notably, a positive effect of selection for higher BW of quail females at an early age on the egg weight indicator was noted [45].
The BW indicator is influenced by a number of factors. The growth potential of poultry is determined primarily by its genotype. Numerous studies have shown the genetic determination of this trait in different poultry species, in particular, chickens [36,49,50], quails [43,51,52,53], ducks [54,55,56,57,58] and turkeys [17,59]. The implementation of the genetic growth potential largely depends on feeding [60,61,62] and housing conditions [63].
To date, extensive information has been accumulated on genetic markers associated with BW and growth rate in different types of poultry, especially when using whole-genome genotyping and sequencing [64,65,66,67,68,69]. Herewith, a significant proportion of such studies were performed on chickens. This is facilitated by the availability of commercial genome-wide DNA arrays for molecular genetic studies available for this poultry species [31,70,71,72,73,74]. There are no such commercial genomic analysis systems for quail, however, which relatively limits the research to find loci and candidate genes that determine the degree of manifestation of economically important phenotypes. In this regard, research in this area of quail molecular genetics is relevant and in demand.
In our earlier studies using the genotyping-by-sequencing (GBS) technique, we analyzed potential genes and selection signatures in eight quail breeds [75]. We identified SNPs and prioritized candidate genes (PCGs) associated with abdominal fat deposition, growth and meat productivity in F2 quails from a resource population obtained using two breeds, i.e., Japanese (of lower growth rate) and Texas White (of higher growth rate) [52,76]. The aim of the current study was to extend these previous works to focus in more detail on the search for SNPs and identification of candidate genes associated with BW at different age periods, specifically at 1 (BW1), 7 (BW7), 14 (BW14), 21 (BW21), 28 (BW28), 35 (BW35), 42 (BW42), 49 (BW49) and 56 (BW56) days of age. In line with this aim, a genome-wide association study (GWAS) for BW indices was performed in F2 quails of different ages from the same cross of Japanese (with average BW) and Texas White (with higher growth rate) breeds based on GBS genotyping data.

2. Results

2.1. F2 Resource Population Phenotypic Data and Population Stratification

Descriptive metrics for the age dynamics of BW in F2 quails of the resource population in comparison with the original parent breeds are presented in Table 1. At all studied ages, F2 quails exceeded Japanese quails in this indicator by 4–26% and were inferior to Texas White quails by 6–25%, i.e., tended to demonstrate intermediate values. The maximum differences in the studied BW traits of the resource population quails and the original parent breeds were noted in a later age period. It should be noted that there was a higher variability of the established BW values in the resource population quails compared to Japanese and Texas White quails at the age of 7 and 14 days.
Table 2 shows the results of computing the heritability coefficients and variation components. The highest heritability was noted in quails at the age of one day (0.565) with a smooth decrease in genetic variability for BW14 (0.312). Over the investigation period, starting from 21 to 56 days of age, minor fluctuations in the heritability coefficients for BW of individuals were observed in dynamics (from 0.277 to 0.293) with a tendency for its smooth decline as the birds grow. Most likely, this may be explained by the individual age-related characteristics of the bird’s body with an increase in its BW, a change in physiological status (sexual maturity) and, accordingly, a reaction to environmental factors.
Genetic correlations between different age groups of quails in terms of BW indicators are presented in Table 3.
Genetic correlation between BW1 and the indices in subsequent age periods had low correlation values, which may indicate an independent character of the BW1 trait formation caused by prenatal development (e.g., egg size/weight, maternal age, etc.). At later ages, regular changes in the correlation dependence were observed in the dynamics. With increasing age of the birds, between adjacent indices within the compared age group, the genetic correlation lowered, thereby demonstrating the complex nature of inheritance of the BW index. It can be noted that the tightness of the genetic correlations for BW28 to BW56 was the greatest (0.492–0.751), which in turn indicates the potential for selection of individuals for further breeding according to this index.
After filtering the raw data, a total of 115,743 SNPs were generated, while 92,618 SNPs remained after quality control and were used for the subsequent analysis. To assess and characterize the SNP-based genetic structure of the F2 quail resource population, groups of F2 individuals were formed depending on their origin. Taking into account the males used to obtain F2 quails, eight groups were established (F2_1 to F2_8). According to the principal component analysis (PCA), the studied groups of F2 quails formed one a few overlapping clusters in the projections PC1–PC2, PC1–PC3 and PC2–PC3. This population stratification pattern is visually represented in Figure 1a–c).
Given the observed structure of the F2 resource population, a GWAS was subsequently performed using the first three PCs as covariates as outlined below.

2.2. Genome-Wide Association Studies

The experimental data on the BW indices in F2 quails of the genotyped resource population were used for genome-wide association studies. The GWAS results are presented in Figure 2 and Supplementary Figure S1.
The analysis performed at the level of established significance value of p < 6.72 × 10−7 revealed 142 SNPs associated with BW in the studied population quails aged from 1 to 56 days (Supplementary Table S1). These SNPs were localized on 21 of 28 chromosomes explored. Their maximum number was detected on chromosomes CJA4 (27 SNPs), CJA26 (24 SNPs) and CJA1 (20 SNPs), and the minimum one on CJA11 (1 SNP).
Data on the number of significant SNPs found and their chromosomal distribution, taking into consideration the examined BW indices of various-aged F2 quails in the resource population, are shown in Table 4.
The number of significant SNPs associated with BW varied depending on the age of the studied birds. The maximum number of significant SNPs associations with the studied BW trait was established at the age of 42 and 56 days (50 and 42 SNPs, respectively), and the minimum one at the age of 1 day and 14–21 days (3–8 SNPs). According to the BW BW14 indicator, no significant SNPs were identified in this study at the established threshold.
Notably, 25 SNPs associated with BW in two or more age periods were identified, including 17 SNPs associated with two indicators, four SNPs with three indicators and four SNPs with 4–5 indicators. The list of these SNPs is presented in Table 5.

2.3. Candidate Genes Including PCGs

The identified significant SNPs associated with BW in F2 quails of the resource population at different age periods were used to annotate candidate genes associated with the studied parameters (Table 4). In the regions of the identified SNPs (± 0.2 Mb), 419 genes were identified (Supplementary Table S1), including 42 candidate genes in the direct positions of these SNPs. As shown in Table 3, nine PCGs were identified in the positions of 25 SNPs associated with more than one BW index, including ITM2B (integral membrane protein 2B), SLC35F3 (solute carrier family 35 member F3), ADAM33 (ADAM metallopeptidase domain 33), UNC79 (unc-79 homolog, NALCN channel complex subunit), LEPR (leptin receptor), RPP14 (ribonuclease P/MRP subunit p14), MVK (mevalonate kinase), ASTN2 (astrotactin 2), and ZBTB16 (zinc finger and BTB domain containing 16). In 12 PCGs (Table 4), two or more SNPs associated with BW in quails of the studied population were found, including MARCHF6 (membrane associated ring-CH-type finger 6), EGFR (epidermal growth factor receptor), ADGRL3 (adhesion G protein-coupled receptor L3), ADAM33, NPC2 (NPC intracellular cholesterol transporter 2), LTBP2 (latent transforming growth factor beta binding protein 2), ZC2HC1C (zinc finger C2HC-type containing 1C), SATB2 (SATB homeobox 2), ASTN2, ZBTB16, ADAR (adenosine deaminase RNA specific), and LGR6 (leucine rich repeat containing G protein-coupled receptor 6). Moreover, five SNPs were localized within one gene, namely ADAM33, for each of which significant associations were established with 3–5 studied indicators, in particular, BW14, BW21, BW28, BW35 and BW42.
PCGs (at p < 6.72 × 10−7) associated with BW in F2 quails of the resource population at different age periods are shown in Table 6.
Figure 3 represents a summary information on the significant associations of genes established in the positions of the identified SNPs for BW in quails at different age periods.

2.4. ADAM33 Association Analysis Example

Taking into account the established significant associations for five SNP loci of the ADAM33 gene, their allelic variants were examined in more detail, determining the degree of phenotypic manifestation of the BW indicators in quails of the F2 resource population in relation to their specific genotypes. The results obtained are presented in Table 7 and Supplementary Table S2.
BW in quails of the studied population varied depending on the genotype at the loci of the ADAM33 gene. Significantly higher values of this trait were found in quails with the genotype GG at locus 4:81160836, CC at loci 4:81160722 and 4:81160897, and TT at loci 4:81160888 and 4:81171150 in almost all age periods considered (BW1, BW7, BW14, BW21, BW28, BW35, BW42, BW49 and BW56). Differences in the dynamics of BW of quails of the resource population depending on the genotype are shown in Figure 4.

2.5. Gene Ontology Analysis

Of the 419 candidate genes identified in this study, 394 genes, including 42 PCGs, were functionally annotated for gene ontology (GO) terms conforming to three main GO hierarchies, i.e., biological process (GO:BP), cellular component (GO:CC) and molecular function (GO:MF) (Figure 5, Supplementary Figure S2 and Table S3). Accordingly, the most candidate genes were represented in the following GO:BP terms: transcription regulation (37 genes), transcription (36 genes) and transport (34 genes). The GO:CC terms most enriched in candidate genes were membrane (146 genes), nucleus (63 genes) and cytoplasm (44 genes). The most represented GO:MF terms for candidate genes were transferase (49 genes), hydrolase (30 genes), receptor (29 genes) and kinase (27 genes). When only 42 PCGs were considered, most enriched was the GO:CC term membrane (12 genes) (Supplementary Figure S2).
Based on GO term enrichment scores using the DAVID functional annotation tool [77,78], the annotated 394 annotated candidate genes were grouped into 56 functional clusters, six of which had enrichment scores greater than 1.2 (Supplementary Table S3). These clusters included candidate genes related to G-protein coupled receptor, protein tyrosine kinase activator activity, ATP binding, positive regulation of fat cell differentiation, cartilage development, and phosphoprotein. The full list of annotated candidate genes, their functions and clusters are presented in Supplementary Table S3. However, statistically, the GO terms that make up these clusters cannot be accepted as significant and it cannot be considered that the GO analysis has yielded reliable data in our hands. Thus, we have to stipulate that, based on GO term enrichment score analysis, statistical significance was not achieved for them.

3. Discussion

Identification of physiological and molecular genetic markers and mechanisms that determine the phenotypic expression of bird body’s potentials pertinent to economically important traits in poultry [79,80,81,82] is essential for modern agriculture. Specifically, it is crucial for the development of genetic methods, efficient genomic selection technologies, and the creation of new highly productive strains and crosses in poultry farming, including quail breeding [83,84,85,86,87,88,89].
BW is an important selected trait for characterizing growth, development and productive qualities of poultry. In meat and egg poultry farming, including quail farming, targeted selection of poultry for this trait has practical significance and demand [35,45,90,91,92,93]. The efficiency of selection of individuals for BW increases significantly when using molecular genetic methods of their assessment by a set of genetic markers that determine the phenotypic manifestation of this trait [52,53,59,71,94,95].
We performed GWAS for the BW indicators in quails at different age periods using a specially created F2 resource population. F2 resource populations are a convenient model population for molecular genetic studies. Work on the development and use of such model populations is widely carried out in various poultry species, in particular, chickens [21,64,71,73,96], turkeys [17], quails [51,97,98,99], ducks [54]. In our studies, the F2 resource population was produced through a series of crosses between two quail breeds that contrasted in the BW index, i.e., the Japanese characterized by a relatively lower growth rate and the Texas White distinguished by a higher rate of BW growth [52,76].
Here, in the course of the conducted GWAS for BW parameters in F2 quails of the resource population aged from 1 to 56 days, we established significant associations of the studied characteristics with 142 SNPs and 42 candidate genes localized in the positions of these SNPs. Below we will focus on considering PCGs revealed in our study.

3.1. Identification and Relevance of PCGs for BW Parameters

From the viewpoint of using genetic markers in genomic selection, it is of great benefit to search for loci and candidate genes associated with more than one economically, physiologically or adaptively important traits. In this study, SNPs associated with several considered BW traits were localized and the corresponding PCGs in the area of these SNPs were detected. Specifically, 25 SNPs associated with BW in quails at two or more considered ages were determined, including significant associations of four SNPs with BW in 3–5 age periods (BW14, BW21, BW28, BW35, and BW42). In the positions of these 25 SNPs, nine PCGs were identified, including ITM2B, SLC35F3, ADAM33, UNC79, LEPR, RPP14, MVK, ASTN2 and ZBTB16. Along with SNPs common to several BW traits considered in this study, we identified 12 PCGs that were co localized with the positions of two and more SNPs associated with the studied traits. These included MARCHF6, EGFR, ADGRL3, ADAM33, NPC2, LTBP2, ZC2HC1C, SATB2, ASTN2, ZBTB16, ADAR, and LGR6. In all, we established 18 unique PCGs, taking into consideration that ADAM33, ASTN2 and ZBTB16 were shared between the two groups of PCGs. Below, we consider molecular, physiological and economic relevance of these 18 PCGs in terms of their possible involvement in formation BW-related and other important traits in quails used in our GWAS.

3.1.1. LEPR and ASTN2

Based on the analysis of open information sources, other studies had previously confirmed the association of the two PCGs, LEPR and ASTN2, with BW in poultry. For instance, El Moujahid et al. [100] showed an association of the LEPR gene with BW in chickens at the age of 49 and 70 days, as well as feed conversion ratio and feed intake. Studies on quails have established the effects of this PCG on the growth indicators of birds at the age of 3 and 5 weeks [101], BW and average daily body weight gain (ADBWG) at the age of 56 days [52]. Li et al. [102] also established the effect of the LEPR gene on the deposition of abdominal fat in broilers, the accumulation of which in the body of chickens contributes to an increase in their BW. Among many other examples, SNPs in this PCG were linked to growth and carcass traits in cattle [103,104]. In pigs, LEPR effects were demonstrated on body composition [105], productivity and quality traits [106,107], and fatness and growth traits [108]. In sheep, this PCG was associated with age at onset of puberty [109] and reproductive seasonality traits [110]. ASTN2 has been associated with abdominal circumference in a crossbred commercial pig population [111] and with hair growth and hair follicle development in yaks [112]. Previously, we demonstrated the association of the ASTN2 gene with BW at 63 days, ADBWG, dressed carcass weight, and drumstick weight in F2 resource population chickens [71]. In the present study, we established significant associations of the LEPR and ASTN2 genes with BW in quails of the resource population at the age of 42 and 49 days.

3.1.2. EGFR and ADGRL3

Two PCGs, EGFR and ADGRL3, have been shown to be associated with BW and growth in other livestock species. In particular, the EGFR gene was linked to weaning weight [113]. The ADGRL3 gene, which is involved in cell differentiation and energy metabolism, has been associated with growth performance in pigs [114] and sheep [115]. These two PCGs were also found to be involved in the regulation of lipid metabolism. For instance, the EGFR gene was related to the regulation of abdominal fat deposition in broilers [116], the proliferation of quail follicular granulosa cells [117] and the regulation of chicken feather follicle morphogenesis [118]. The ADGRL3 gene was involved in the accumulation of subcutaneous fat in cattle [119]. In the present study, we showed an association of the ADGRL3 and EGFR genes with BW in resource population quails at the age of 28 and 56 days, respectively, which echoes the findings of studies on other animal species.

3.1.3. MVK, NPC2, SATB2, ADAR, ITM2B and LTBP2

A number of studies conducted on farm animals, including poultry, have established an impact of the PCGs identified in this study on the growth, development, and metabolism parameters that determine BW. Specifically, the MVK and NPC2 genes were found to be involved in the regulation of fat deposit accumulation in broiler chickens [120] and pigs [121]. The SATB2 gene was found to play a role in skeletal muscle development in pigs by regulating myoblast migration [122], gonadal development and ovarian weight in ducks [123] and α- and β-keratin gene cluster switching in chickens [124]. The ADAR gene was found to be relevant to bone and muscle development in cattle [125]. Some other PCGs have been shown to be associated with body conformation parameters related to growth and BW. In particular, the ITM2B gene was linked to keel length in chickens [69]. In pigs, the LTBP2 gene was associated with the number of thoracic vertebrae, which determines body length, in F2 intercrosses [126] and with teat number [127].

3.1.4. SLC35F3 and ADAM33

Solute carrier SLC35F3 was shown to be one of small molecule transporters that are potentially involved in nutrient absorption and skeletogenesis [128]. ADAM family membrane proteins participate in morphogenesis and tissue formation during chick embryonic development [129,130,131]. ADAM33 is a gene with a possible function in muscle development and neurogenesis [132], while having also shown preferential expression in smooth muscle, myofibroblasts and fibroblasts of asthmatic airways [132,133]. Davis [134] reported ADAM33 among 93 candidate genes that exhibited significant differential enrichment in breast muscle of modern Ross 708 broilers relative to the Illinois legacy broiler line. Additionally, it seems to be related to immune system and environmental/climate adaptation in indigenous sheep breeds [132,135].

3.1.5. ADAR, UNC79 and RPP14

ADAR may play a role in developing body conformation traits such as the rear view of the rear legs in cattle [136]. UNC79 is an auxiliary subunit of the NALCN sodium channel complex (or channelosome) in cell membranes [137,138]; however, its in vivo function in humans is mostly unknown [139]. This PCG may be associated with cold tolerance in chickens [10]. In invertebrate organisms, UNC79 may play a significant role in the adaptive evolution of mud crabs [140] and regulating starvation resistance in Drosophila [141]. RPP14 may be relevant to muscle growth and functioning as it was up-regulated in Musculus longissimus dorsi of steers [142].

3.1.6. ZBTB16

The transcription factor ZBTB16 is associated with cell cycle signaling pathways. In particular, it regulates innate and innate-like lymphoid lineage development [143,144,145] and juvenile spermatogonial stem cell development [146]. The ZBTB16 gene may be related to the regulation of abdominal fat deposition in meat-producing ducks [57]. ZBTB16 also contributes to the bioenergetics of murine brown adipocytes during acute adaptive thermogenesis [147] and showed upregulation in brown adipose tissue and skeletal muscle in cold-stimulated mice, facilitating the deposition of intramuscular fat [148]. Overexpression of ZBTB16 promotes white adipogenesis and causes the production of brown-like adipocytes in the white intramuscular preadipocytes in M. longissimus dorsi of steers [149]. ZBTB16 was linked to lipid deposition and muscle growth in M. longissimus dorsi of pigs according to its demonstrated up-regulated differential expression [150]. Adiposity and BW decreased in rats when one copy of Zbtb16 was lost [151]. The human body mass index, waist-to-hip ratio and low-density lipoprotein cholesterol levels were all linked to the SNPs in ZBTB16 [152]. ZBTB16 might also be a candidate for milk fat yield in dairy cattle [153].

3.1.7. MARCHF6, ZC2HC1C and LGR6

MARCHF6 has been found to be a crucial regulator of a number of metabolic processes, such as protein quality control, cholesterol and lipid droplet homeostasis, and more [154]. The metabolism of lipids and sterols is influenced by its substrates. Post-translationally, MARCHF6 expression is sensitive to the level of cholesterol; elevated cholesterol inhibits its degradation, which raises MARCHF6 levels [155]. ZC2HC1C may be related to such important body conformation traits as number of thoracic vertebrae and number of ribs in intercross pig populations [156,157]. It was also identified amongst candidate genes linked to the age at first calving in cattle that are found within the top 1% of genomic windows [158] and may contribute to adaptive traits in the mustelids [159]. In mice, LGR6 plays a role in skeletal muscles, being transiently expressed during myogenic differentiation and myoblast differentiation and fusion [160]. It also participates in regulating osteogenesis [161].
Collectively, the data obtained in this study pertaining the direct effect of such PCGs as ADAM33, ADGRL3, EGFR, LEPR and ASTN2 on the BW indicators in quails are consistent with the results of other studies conducted both on quails and other species of livestock, including poultry. For some other PCGs identified in our research, a number of previous studies have also shown their relationship with indicators that indirectly characterize and determine BW, e.g., accumulation of fat deposits in the body (MARCHF6, MVK and NPC2), development of muscle and bone tissue (RPP14, SLC35F3, SATB2 and ADAR), and exterior traits (ITM2B and LTBP2). Some other PCGs may be beneficial in terms of overall fitness and adaptation in commercially exploited Japanese quails.
The results of this study, conducted at the molecular level, contribute to the expansion of fundamental knowledge about the physiological and molecular genetic mechanisms of formation, development and manifestation of promising performance phenotypes in quails. These serve as a basis for the development of effective technologies for genomic selection, as well as methodological approaches to predicting and assessing the productive potential of quails in order to obtain birds with specified economically important traits. Further studies may be related to the identification of allelic variants of genes in the positions of established SNPs that determine the degree of phenotypic manifestation of BW indicators and growth rate in quails.

4. Materials and Methods

4.1. Experimental Birds

Hatching eggs of purebred quails were purchased from the Genofond LLC (All-Russian Poultry Research and Technological Institute, Sergiyev Posad, Russia). Birds were hatched and raised at the L. K. Ernst Federal Research Centre for Animal Husbandry (LKEFRCAH) according to generally accepted feeding and maintenance requirements described elsewhere (e.g., [162,163,164]). In particular, the premises used for keeping quails were furnished with the necessary equipment for the full cycle of raising from young to adult birds. The required temperature of 20 to 25 °C and humidity of 55 to 65% were maintained in the premises. At all stages of growing, the birds had free access to compound feed and clean running water. Commercial compound feed was used for feeding in accordance with the age of the birds.
To obtain the F2 resource population, a series of crosses were carried out using two breeds with contrasting BW phenotype and growth rate, i.e., Japanese (of lower BW and growth rate) and Texas White (of higher BW and growth rate). In more detail, the F2 resource population was based on the original parental breeds characterized by a higher growth rate (Texas White) and a slower growth (Japanese). At all stages of producing the F2 resource population, strict accounting of kinship was carried out to exclude inbreeding. Initially, four families (F0_1–F0_4) were formed, each of which included one male and five females. In groups F0_1 and F0_2, Japanese males were used as a paternal parental stock, and Texas White females as a maternal stock. In groups F0_3 and F0_4, the reciprocal combination of parental breeds was used, i.e., Texas White males mated to Japanese females. From F0 individuals, F1 quails were obtained (F1_1–F1_4) that were used to deliver the F2 resource population. For this purpose, eight F1 families were formed in the following combinations: groups 1 and 2, one male F1_1 and three females F1_2; groups 3 and 4, one male F1_2 and three females F1_1; groups 5 and 6, one male F1_3 and three females F1_4; and groups 7 and 8, one male F1_4 and three females F1_3. A total of 640 F2 quails were produced. To search for significant associations of SNPs and candidate genes with BW, a model resource population was formed within the framework of this study, including 240 F2 female quails. When forming this experimental sampling, contrasting phenotypes of F2 female quails by BW at the age of 8 weeks were taken into account. To characterize the genetic structure of this population, F2 individuals were divided into eight groups (F2_1 to F2_8) depending on the F1 males used to produce them, and their DNA samples were collected.

4.2. Phenotypic Traits and Their Statistical Analyses

F2 quails from the resource population (n = 240) were phenotyped for BW1, BW7, BW14, BW28, BW35, BW42, BW49 and BW56. Weighing was performed by qualified personnel using electronic scales with a measurement error of 0.01 g. To assess the growth dynamics of the F2 resource population in comparison with the original parental breeds, BW measurement was conducted using Japanese (n = 30) and Texas White (n = 20) quails at the same ages of 1, 7, 14, 21, 28, 35, 42 and 49 days.
To calculate the heritability indices for BW of individuals for the age periods from Day 1 to Day 56 and genetic correlations between them, a mixed model equation was developed using the BLUP Animal Model methodology based on the calculation of variance-covariance complexes using the REML (restricted maximum likelihood) procedure. A multi-trait model was used in the analysis. These calculations were performed using the BLUPF90 family of programs [165].
The mixed model equation was utilized as follows:
y i j k l =   μ + P G i + H a t c h j + S e x k + a n i m a l l + e i j k l ,
where y is the value of the resultant BW trait (from 1 to 56 days with a step of 7 days) for individual l in the i-th group from the parent family of the resource population, the j-th hatching batch of during incubation and the k-th sex; µ is the average value of the trait for each age group from the studied sample of the quail resource population; PG is the fixed effect of the i-th group from the parent family of the resource population; Hatch is the fixed effect of the j-th hatching batch of chicks during incubation; Sex is the fixed effect of the k-th sex of an individual; animal is the randomized (random) effect of individual l from the F2 resource population; and e is the residual (undistributed) variance of the equation model.
The heritability coefficient (h2) was calculated using the following formula:
h 2 = V a r A V a r A + V a r E ,
where VarA is the genetic variance of the model equation for the studied trait; and VarE’ is the residual variance of the model equation for the studied trait.

4.3. Sampling and DNA Extraction

DNA was extracted from the feather pulp of F2 quails of the resource population using the Syntol kit for animal tissue (Syntol, Moscow, Russia). The concentration of the isolated DNA was assessed using a Qubit 3.0 fluorimeter (Thermo Fisher Scientific, Wilmington, DE, USA), and the purity of the extracted DNA (based on the OD260/280 ratio) was assessed using a Thermo Fisher Scientific’s NanoDrop-2000 spectrophotometer.

4.4. Sequencing, Genotyping and SNP Quality Control

Genotyping of quails was carried out using the GBS technique according to the protocol by Elshire et al. [166], with some modifications proposed by Dodds et al. [167]. In the course of the study, a GBS library was prepared using double digestion with PstI–MspI restriction enzymes, including negative controls without DNA. The Pippin Prep system (SAGE Science, Beverly, MA, USA) was used to select DNA fragments of 220–340 bp, taking into account the length of the genomic sequence along with adapters (148 bp). A set of 768 unique adapter sequences (manufactured by Illumina, San Diego, CA, USA and Integrated DNA Technologies Coralville, IA, USA) were used and contained 10-nucleotide barcodes differing by at least three mutational steps. The corresponding adapter sequences were used as follows: PstI_barcode_adapter_F, ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNTGCA; PstI_barcode_adapter_R, NNNNNNNNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT; MspI(Y)_Common_F, CGAGATCGGAAGAGCGGACTTTAAGC; and MspI_Common_R, GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. Sequencing was performed on the Illumina NovaSeq 6000 platform using v1.5 reagents in the single-read mode (101 nucleotides). Quality control of the generated data was performed using the DECONVQC algorithm [168,169] and FastQC software [170]. The mean GBS coverage depth was 0.269.
The Japanese quail Coturnix japonica 2.0 (CJA 2.0) genome assembly [171] from the Ensembl 104 and Ensembl Genomes 51 databases [172] was used as a reference genome. Data processing was performed using cutadapt to remove adapter sequences and demultiplex by barcodes [173,174]. The quality of fastq files was additionally checked using FastQC [170]. Read alignment to the reference genome was executed using bowtie2 (version 2.4.4; [175]), and subsequent processing and sorting of BAM files was performed using samtools [176].
Joint genotyping of the output files was performed using commands from the snpGBS [177] and bamtools [176] packages to generate a single VCF file (bcftools mpileup … | bcftools call-m—| bcftools view-M2 …). Using R software (version 4.0.0; [178,179]), the data were presented in a format suitable for further analysis. PLINK 1.9 [180,181] was used to quality control the SNP detection. Quail genotypes were filtered according to the genotyping efficiency parameter (MAF 0.03), and SNPs that were genotyped in fewer than 90% of samples (genotype 0.1) were not included in the study.
Quality control and filtering of the GBS genotyping data for each sample and each SNP were performed in the R software environment (version 4.0.0; [178,179]) using the PLINK 1.9 software package [180,181], applying the following filters in the program: --mind 0.10, --geno 0.10, --maf 0.03, --hwe 1e-6. After filtering, 74,387 SNPs were used for further analysis.

4.5. PCA Procedure

PCA [182] was performed in PLINK 1.9. Data files were prepared in the R software environment (version 4.0.0; [178,179]). Visualization of the obtained results by plotting the respective graphs was carried out in the R package (version 3.5.1) ggplot2 [183,184].

4.6. Genome-Wide Association Study and GO Analysis

The search for SNP associations with BW in F2 quails of the resource population was carried out using regression analysis in PLINK 1.9. The significance of the SNP effects and the identification of significant regions in the quail genome were assessed using the Bonferroni null hypothesis test at a threshold of p < 6.72 × 10−7. Data were visualized in the qqman package (version 0.1.9) [185] using the R programming language [186].
In the position and region (±0.2 Mb) of the identified SNPs, a search for candidate genes was performed using the CJA 2.0 genome assembly resource [171,172].
The Ensembl BioMart data mining tool and the Database for Annotation, Visualization, and Integrated Discovery (DAVID Knowledgebase; version DAVID 2021 (December 2021), v2023q4, updated quarterly) [77,78] were used to conduct functional annotation and GO term enrichment analyses for the whole candidate gene set and for the prime candidate genes (PCGs). Functional annotation visualization of candidate genes for GO terms relative to three main GO aspects, i.e., biological process, cellular component and molecular function, was performed using Microsoft Excel.

5. Conclusions

In this study, we conducted a GWAS for the BW traits in F2 Japanese quails of the resource population based on GBS genotyping data and identified relevant molecular markers and candidate genes. In the course of the conducted study, 142 significant SNPs and, correspondingly, 42 candidate genes were found to have a high significant association with BW in quails at the age of 1 (three SNPs, one gene), 14 (eight SNPs, two genes), 21 (eight SNPs, two genes), 28 (23 SNPs, seven genes), 35 (15 SNPs, seven genes), 42 (50 SNPs, 22 genes), 49 (31 SNPs, 11 genes) and 56 (42 SNPs, three genes) days. A significant proportion of the determined SNPs and candidate genes were detected on chromosomes CJA1, CJA4 and CJA5. We established 25 SNPs and nine related PCGs that were associated with BW in two or more age periods, including four SNPs associated with 4–5 BW indices. For 12 PCGs, i.e., MARCHF6, EGFR, ADGRL3, ADAM33, NPC2, LTBP2, ZC2HC1C, SATB2, ASTN2, ZBTB16, ADAR and LGR6, two or more SNPs associated with the studied indices were detected. Herewith, there was one gene, ADAM33, for which five SNPs were found that had significant associations with 3–5 indices (BW14, BW21, BW28, BW35, and BW42). Our findings are of great importance for understanding the genetic basis for the formation and manifestation of growth potential in quails. The identified significant SNPs and putative candidate genes require further study and can be used as molecular genetic markers in breeding programs aimed at increasing and improving growth performance and productivity in Japanese quail.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26178243/s1.

Author Contributions

Conceptualization, N.A.V. and N.A.Z.; methodology, P.V.L., A.V.S., N.Y.G., A.A.S., J.M. and R.B.; software, A.A.S., P.V.L. and A.V.S.; validation, N.A.V., N.Y.G., A.N.V., D.K.G. and L.A.V.; formal analysis, M.N.R., J.S., A.A.S., J.M., R.B. and P.V.L.; investigation, N.Y.G., A.N.V. and L.A.V.; data curation, N.A.V.; writing—original draft preparation, N.Y.G., N.A.V. and M.N.R.; writing—review and editing, N.A.V., M.N.R., A.A.S., J.S., J.M., R.B., D.K.G. and N.A.Z.; visualization, N.A.V., M.N.R. and P.V.L.; supervision, N.A.V., D.K.G. and N.A.Z.; project administration, N.A.V. and N.A.Z.; funding acquisition, N.A.V. and N.A.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Russian Science Foundation, Grant No. 24-16-00294 (https://rscf.ru/project/24-16-00294/; accessed on 22 June 2025).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and the LKEFRCAH ethical guidelines. Protocol No. 4 was approved by the LKEFRCAH Commission on the Ethics of Animal Experiments on 13 June 2024.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author(s). The sequence data are accessible to readers on request.

Acknowledgments

Genotyping-by-sequencing services were provided by AgResearch (Lincoln, Canterbury, New Zealand; https://www.agresearch.co.nz/partnering-with-us/products-and-services/genomnz/genotyping-services/; accessed on 22 June 2025), under curation of Tracey Van Stijn (tracey.vanstijn@agresearch.co.nz).

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviations

The following abbreviations are used in this manuscript:
BWbody weight
SNP(s)single nucleotide polymorphism(s)
GWASgenome-wide association study
PCG(s)prioritized candidate gene(s)
GBSgenotyping-by-sequencing
CJACoturnix japonica
BW1, BW7, BW14, BW21, BW28, BW35, BW42, BW49, BW561, 7, 14, 21, 28, 35, 42, 49 and 56 days of age
SDstandard deviation
CVcoefficient of variation
PCAprincipal component analysis
PC1first component
PC2second component
PC3third component
ITM2Bintegral membrane protein 2B
SLC35F3solute carrier family 35 member F3
ADAM33ADAM metallopeptidase domain 33
UNC79unc-79 homolog, NALCN channel complex subunit
LEPRleptin receptor
RPP14ribonuclease P/MRP subunit p14
MVKmevalonate kinase
ASTN2astrotactin 2
ZBTB16zinc finger and BTB domain containing 16
MARCHF6membrane associated ring-CH-type finger 6
EGFRepidermal growth factor receptor
ADGRL3adhesion G protein-coupled receptor L3
NPC2NPC intracellular cholesterol transporter 2
LTBP2latent transforming growth factor beta binding protein 2
ZC2HC1Czinc finger C2HC-type containing 1C
SATB2SATB homeobox 2
ADARadenosine deaminase RNA specific
LGR6leucine rich repeat containing G protein-coupled receptor 6
GOgene ontology
ADBWGaverage daily body weight gain
LKEFRCAHL. K. Ernst Federal Research Centre for Animal Husbandry

References

  1. Plemyashov, K.V.; Smaragdov, M.G.; Romanov, M.N. Molekulyarno-geneticheskiy polimorfizm v populyatsiyakh zhivotnykh i yego primeneniye v intensivnoy selektsii molochnogo skota: Obzor [Molecular Genetic Polymorphism in Animal Populations and Its Application in Intensive Breeding of Dairy Cattle—A Review]. In Molecular Genetic Technologies for Analysis of Gene Expression Related to Animal Productivity and Disease Resistance, Materials of the 3rd International Scientific and Practical Conference, Moscow, Russia, 30 September 2021; Pozyabin, S.V., Kochish, I.I., Romanov, M.N., Eds.; Sel’skokhozyaistvennye tekhnologii: Moscow, Russia, 2021; pp. 368–378, (In Russian with English Summary). [Google Scholar] [CrossRef]
  2. Dotsev, A.V.; Moradi, M.H.; Deniskova, T.E.; Esmailizadeh, A.; Bakoev, N.F.; Koshkina, O.A.; Griffin, D.K.; Romanov, M.N.; Zinovieva, N.A. Molecular genetic assessment aids in clarifying phylogenetic status of Iranian Kerman wild sheep. Animals 2025, 15, 238. [Google Scholar] [CrossRef]
  3. Laptev, G.Y.; Tiurina, D.G.; Yildirim, E.A.; Gorfunkel, E.P.; Ilina, L.A.; Filippova, V.A.; Dubrovin, A.V.; Dubrovina, A.S.; Brazhnik, E.A.; Novikova, N.I.; et al. Effects of glyphosate, antibiotics and an anticoccidial drug on pancreatic gene expression and blood physiology in broilers. J. Zhejiang Univ. Sci. B 2025, 26, 185–199. [Google Scholar] [CrossRef]
  4. Kulibaba, R.O.; Sakhatskyi, M.I.; Griffin, D.K.; Romanov, M.N. Molecular diversity of Ukrainian native chicken breeds: A review. Worlds Poult. Sci. J. 2024, 80, 1265–1292. [Google Scholar] [CrossRef]
  5. Weigend, S.; Romanov, M.N. Molekulare Charakterisierung genetischer Vielfalt beim Geflügel—Molecular characterization of genetic diversity in chicken. In Jahresbericht 1998; Bundesforschungsanstalt für Landwirtschaft (FAL): Braunschweig, Germany, 1999; p. 66. Available online: https://www.researchgate.net/publication/371721279 (accessed on 30 June 2025).
  6. Moiseyeva, I.G.; Kovalenko, A.T.; Mosyakina, T.V.; Romanov, M.N.; Bondarenko, Y.V.; Kutnyuk, P.I.; Podstreshny, A.P.; Nikiforov, A.A.; Tkachik, T.E. Origin, History, Genetics and Economic Traits of the Poltava Chicken Breed. Elektronnyi zhurnal [Electron. J.]; Laboratory of Animal Comparative Genetics, N.I. Vavilov Institute of General Genetics: Moscow, Russia, 2006, 4. Available online: https://web.archive.org/web/20120205195904/http://www.lab-cga.ru/articles/Jornal04/Statia2.htm (accessed on 5 February 2012). (In Russian).
  7. Moiseyeva, I.G.; Romanov, M.N.; Alexandrov, A.V.; Nikiforov, A.A.; Sevastyanova, A.A. Evolyutsiya, geneticheskaya izmenchivost’ yurlovskoy golosistoy porody kur. Sistemnyy analiz form izmenchivosti [Evolution and genetic diversity of old domestic hen’s breed—Yurlovskaya golosistaya, System analysis of variability forms]. Izv. Timiryazev S-Kh. Akad. [Izv. Timiryazev Agric. Acad.] 2009, 3, 132–147. Available online: https://kar.kent.ac.uk/46633 (accessed on 30 June 2025). (In Russian with English Summary).
  8. Vakhrameev, A.B.; Narushin, V.G.; Larkina, T.A.; Barkova, O.Y.; Peglivanyan, G.K.; Dysin, A.P.; Dementieva, N.V.; Makarova, A.V.; Shcherbakov, Y.S.; Pozovnikova, M.V.; et al. Selection-driven chicken phenome and phenomenon of pectoral angle variation across different chicken phenotypes. Livest. Sci. 2022, 264, 105067. [Google Scholar] [CrossRef]
  9. Vakhrameev, A.B.; Narushin, V.G.; Larkina, T.A.; Barkova, O.Y.; Peglivanyan, G.K.; Dysin, A.P.; Dementieva, N.V.; Shcherbakov, Y.S.; Pozovnikova, M.V.; Griffin, D.K.; et al. Pectoral angle: A glance at a traditional phenotypic trait in chickens from a new perspective. J. Agric. Sci. 2023, 161, 606–615. [Google Scholar] [CrossRef]
  10. Romanov, M.N.; Abdelmanova, A.S.; Fisinin, V.I.; Gladyr, E.A.; Volkova, N.A.; Koshkina, O.A.; Rodionov, A.N.; Vetokh, A.N.; Gusev, I.V.; Anshakov, D.V.; et al. Selective footprints and genes relevant to cold adaptation and other phenotypic traits are unscrambled in the genomes of divergently selected chicken breeds. J. Anim. Sci. Biotechnol. 2023, 14, 35. [Google Scholar] [CrossRef]
  11. Moiseeva, I.G. Fenotipicheskaya i Geneticheskaya Izmenchivost’ Pokazateley Kachestva u Kur [Phenotypic and Genetic Variability of Quality Indicators in Chickens]. Abstract of Cand. Sci. (Biol.) Dissertation, Moscow, USSR, 1965. Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=tFr9MGIAAAAJ:tOudhMTPpwUC (accessed on 30 June 2025). (In Russian with English Summary).
  12. Krutikova, A.A.; Dementieva, N.V.; Shcherbakov, Y.S.; Goncharov, V.V.; Griffin, D.K.; Romanov, M.N. Polymorphism of genes potentially affecting growth and body size suggests genetic divergence in wild and domestic reindeer (Rangifer tarandus) populations. Genes 2024, 15, 1629. [Google Scholar] [CrossRef] [PubMed]
  13. Deniskova, T.E.; Dotsev, A.V.; Koshkina, O.A.; Solovieva, A.D.; Churbakova, N.A.; Petrov, S.N.; Frolov, A.N.; Platonov, S.A.; Abdelmanova, A.S.; Vladimirov, M.A.; et al. Examination of runs of homozygosity distribution patterns and relevant candidate genes of potential economic interest in Russian goat breeds using whole-genome sequencing. Genes 2025, 16, 631. [Google Scholar] [CrossRef]
  14. Sakhatsky, N.I.; Tereshchenko, A.V.; Artemenko, A.B. [An express-method of estimation of fertilizing ability of freezing-thawing of poultry spermatozoa]. Sel’skokhozyaistvennaya Biol. [Agric. Biol.] 1987, 22, 77–80. Available online: https://www.cabidigitallibrary.org/doi/full/10.5555/19880165689 (accessed on 30 June 2025).
  15. Plemyashov, K.V.; Smaragdov, M.G.; Romanov, M.N. Genomnaya otsenka plemennykh bykov [Genomic Assessment of Breeding Bulls]. In Molecular Genetic Technologies for Analysis of Gene Expression Related to Animal Productivity and Disease Resistance, Materials of the 3rd International Scientific and Practical Conference, Moscow, Russia, 30 September 2021; Pozyabin, S.V., Kochish, I.I., Romanov, M.N., Eds.; Sel’skokhozyaistvennye tekhnologii: Moscow, Russia, 2021; pp. 363–367. Available online: https://elibrary.ru/item.asp?id=46668864 (accessed on 30 June 2025)(In Russian with English Summary).
  16. Kutnyuk, P.I.; Bondarenko, Y.V.; Ivanova, T.V. Kariometrychnyy metod vyznachennya henetychnoho potentsialu nesuchosti kurey [Karyometric method of determining the genetic potential of laying hens]. Ptakhivnytstvo [Poult. Farming] 2001, 50, 75–81. Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=c1PnDYEAAAAJ:dQ2og3OwTAUC (accessed on 30 June 2025). (In Ukrainian).
  17. Aslam, M.L.; Bastiaansen, J.W.; Crooijmans, R.P.; Vereijken, A.; Groenen, M. Whole genome QTL mapping for growth, meat quality and breast meat yield traits in turkey. BMC Genet. 2011, 12, 61. [Google Scholar] [CrossRef]
  18. Moiseyeva, I.G.; Romanov, M.N.; Kovalenko, A.T.; Mosyakina, T.V.; Bondarenko, Y.V.; Kutnyuk, P.I.; Podstreshny, A.P.; Nikiforov, A.A. The Poltava chicken breed of Ukraine: Its history, characterization and conservation. Anim. Genet. Resour. Inf. 2007, 40, 71–78. [Google Scholar] [CrossRef]
  19. Moiseyeva, I.G.; Sevastyanova, A.A.; Aleksandrov, A.V.; Vakhrameev, A.B.; Romanov, M.N.; Dmitriev, Y.I.; Semenova, S.K.; Sulimova, G.E. Orloff chicken breed: History, current status and studies. Izv. Timiryazev S-Kh. Akad. [Izv. Timiryazev Agric. Acad.] 2016, 1, 78–96. Available online: https://www.elibrary.ru/item.asp?id=25664565 (accessed on 30 June 2025). (In Russian with English Summary).
  20. Baydevlyatova, O.N.; Ogurtsova, N.S.; Shomina, N.V.; Tereshchenko, A.V. Morfologicheskiye pokazateli kachestva yaits novoy subpopulyatsii kur myaso-yaichnogo napravleniya produktivnosti [Morphological indicators of egg quality in a new chicken subpopulation of the meat-egg type of productivity]. Ptakhivnytstvo [Poult. Farming] 2009, 64, 109–115. Available online: http://avianua.com/archiv/ptahivnictvo/64/15.pdf (accessed on 30 June 2025). (In Russian with English Summary).
  21. Schreiweis, M.A.; Hester, P.Y.; Settar, P.; Moody, D.E. Identification of quantitative trait loci associated with egg quality, egg production, and body weight in an F2 resource population of chickens. Anim. Genet. 2006, 37, 106–112. [Google Scholar] [CrossRef]
  22. Moiseeva, I.G. Vliyaniye inbridinga na kachestvo kurinykh yaits [The effect of inbreeding on the quality of fowl eggs]. Genetika 1970, 6, 99–107. Available online: https://www.cabidigitallibrary.org/doi/full/10.5555/19700104311 (accessed on 30 June 2025). (In Russian).
  23. Weigend, S.; Romanov, M.N.; Ben-Ari, G.; Hillel, J. Overview on the Use of Molecular Markers to Characterize Genetic Diversity in Chickens. In XXII World’s Poultry Congress & Exhibition, Participant List & Full Text CD + Book of Abstracts, Istanbul, Turkey, 8–13 June 2004; WPSA—Turkish Branch: Istanbul, Turkey, 2004; p. 192. Available online: https://www.researchgate.net/publication/372751440 (accessed on 30 June 2025).
  24. Romanov, M.N.; Ameen, Q.A.; Shaker, A.S.; Al-Obaidi, R.M.; Griffin, D.K. Conservation genetics and breeding using molecular genetic markers in Japanese quail (Coturnix japonica). Front. Biosci. (Schol. Ed.) 2024, 16, 23. [Google Scholar] [CrossRef] [PubMed]
  25. Weigend, S.; Romanov, M.N. Genetische Diversitätsanalysen bei Hühnern mit Hilfe molekularer Marker—Assessment of genetic diversity in chickens using molecular markers. In Jahresbericht 2001; Bundesforschungsanstalt für Landwirtschaft (FAL): Braunschweig, Germany, 2002; p. 67. Available online: https://www.researchgate.net/publication/371722377 (accessed on 30 June 2025).
  26. Kulibaba, R.O.; Srikulnath, K.; Singchat, W.; Liashenko, Y.V.; Griffin, D.K.; Romanov, M.N. The application of microsatellite markers as molecular tools for studying genomic variability in vertebrate populations. Curr. Issues Mol. Biol. 2025, 47, 447. [Google Scholar] [CrossRef] [PubMed]
  27. Trufanov, O.V.; Tereshchenko, A.V. Primeneniye molekulyarnykh i biokhimicheskikh metodov dlya diagnostiki zabolevaniy sel’skokhozyaystvennoy ptitsy [Application of molecular and biochemical methods for diagnostics of poultry diseases]. Eksklyuzivnyye tekhnologii [Excl. Technol.] 2010, 3, 42–43. Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=deB5xCwAAAAJ:HtEfBTGE9r8C (accessed on 30 June 2025).
  28. Jiang, J.; Ma, L.; Prakapenka, D.; VanRaden, P.M.; Cole, J.B.; Da, Y. A large-scale genome-wide association study in US Holstein cattle. Front. Genet. 2019, 10, 412. [Google Scholar] [CrossRef]
  29. Niu, N.; Wang, H.; Shi, G.; Liu, X.; Liu, H.; Liu, Q.; Yang, M.; Wang, L.; Zhang, L. Genome scanning reveals novel candidate genes for vertebral and teat number in the Beijing Black Pig. Anim. Genet. 2021, 52, 734–738. [Google Scholar] [CrossRef]
  30. Niu, N.; Liu, Q.; Hou, X.; Liu, X.; Wang, L.; Zhao, F.; Gao, H.; Shi, L.; Wang, L.; Zhang, L. Genome-wide association study revealed ABCD4 on SSC7 and GREB1L and MIB1 on SSC6 as crucial candidate genes for rib number in Beijing Black pigs. Anim. Genet. 2022, 53, 690–695. [Google Scholar] [CrossRef] [PubMed]
  31. Dementeva, N.V.; Romanov, M.N.; Kudinov, A.A.; Mitrofanova, O.V.; Stanishevskaya, O.I.; Terletsky, V.P.; Fedorova, E.S.; Nikitkina, E.V.; Plemyashov, K.V. Studying the structure of a gene pool population of the Russian White chicken breed by genome-wide SNP scan. Sel’skokhozyaistvennaya Biol. [Agric. Biol.] 2017, 52, 1166–1174. [Google Scholar] [CrossRef]
  32. Dementieva, N.V.; Shcherbakov, Y.S.; Tyshchenko, V.I.; Terletsky, V.P.; Vakhrameev, A.B.; Nikolaeva, O.A.; Ryabova, A.E.; Azovtseva, A.I.; Mitrofanova, O.V.; Peglivanyan, G.K.; et al. Comparative analysis of molecular RFLP and SNP markers in assessing and understanding the genetic diversity of various chicken breeds. Genes 2022, 13, 1876. [Google Scholar] [CrossRef]
  33. Volyanskaya, A.R.; Akberdin, I.R.; Kulyashov, M.A.; Yevshin, I.S.; Romanov, M.N.; Shagimardanova, E.I.; Gusev, O.A.; Kolpakov, F.A. A bird’s-eye overview of molecular mechanisms regulating feed intake in chickens—With mammalian comparisons. Anim. Nutr. 2024, 17, 61–74. [Google Scholar] [CrossRef]
  34. Dementieva, N.V.; Nikitkina, E.V.; Shcherbakov, Y.S.; Pleshanov, N.V.; Ryabova, A.E.; Azovtseva, A.I.; Silyukova, Y.L.; Musidray, A.A.; Griffin, D.K.; Romanov, M.N. Genome-wide analysis of genetic predispositions linked to damaged membranes and impaired fertility as indicators of compromised sperm–egg interaction mechanisms in frozen–thawed rooster semen. Front. Biosci. (Schol. Ed.) 2025, 17, 26022. [Google Scholar] [CrossRef]
  35. Anthony, N.B.; Nestor, K.E.; Marks, H.L. Short-term selection for four-week body weight in Japanese quail. Poult. Sci. 1996, 75, 1192–1197. [Google Scholar] [CrossRef] [PubMed]
  36. Mebratie, W.; Madsen, P.; Hawken, R.; Romé, H.; Marois, D.; Henshall, J.; Bovenhuis, H.; Jensen, J. Genetic parameters for body weight and different definitions of residual feed intake in broiler chickens. Genet. Sel. Evol. 2019, 51, 53. [Google Scholar] [CrossRef]
  37. Bondarenko, Y.V.; Khvostik, V.P. Pokrashhennya produktyvnosti m’yaso-yayechnyh kurej vitchyznyanoyi selekciyi [Improving the productivity of meat and egg chickens of domestic selection]. Vìsn. Sumsʹkogo nac. agrar. unìv., Ser. Tvarynnytstvo [Bull. Sumy Natl. Agrar. Univ. Ser. Livest.] 2020, 2, 29–32, (In Ukrainian with English Summary). [Google Scholar] [CrossRef]
  38. Larkina, T.A.; Barkova, O.Y.; Peglivanyan, G.K.; Mitrofanova, O.V.; Dementieva, N.V.; Stanishevskaya, O.I.; Vakhrameev, A.B.; Makarova, A.V.; Shcherbakov, Y.S.; Pozovnikova, M.V.; et al. Evolutionary subdivision of domestic chickens: Implications for local breeds as assessed by phenotype and genotype in comparison to commercial and fancy breeds. Agriculture 2021, 11, 914. [Google Scholar] [CrossRef]
  39. Victoria, O.; Fayeye, T.R.; Ayorinde, K.L.; Olojede, H. Relationship between body weight and linear body measurements in Japanese quail (Coturnix coturnix japonica). J. Sci. Res. 2013, 6, 175–183. [Google Scholar] [CrossRef]
  40. Bekele, B.; Melesse, A.; Esatu, W.; Dessie, T. Statistical modeling of live body weight and linear body measurements of local chicken at different agro-ecologies of Ethiopia. Int. J. Poult. Sci. 2021, 20, 146–151. [Google Scholar] [CrossRef]
  41. Malomane, D.K.; Norris, D.; Banga, C.B.; Ngambi, J.W. Use of factor scores for predicting body weight from linear body measurements in three South African indigenous chicken breeds. Trop. Anim. Health Prod. 2014, 46, 331–335. [Google Scholar] [CrossRef]
  42. Mekonnen, K.T.; Lee, D.-H.; Cho, Y.-G.; Son, A.-Y.; Seo, K.-S. Estimation of carcass trait characteristics, proportions, and their correlation with preslaughter body weight in indigenous chickens in Southeastern Ethiopia. Agriculture 2024, 14, 50. [Google Scholar] [CrossRef]
  43. Adil, M.; Tayyab, M.; Hussain, J.; Firyal, S.; Ali, S.; Azam, M.; Wasim, M.; Awan, A.R. Relationship between body weight and linear body measurements in Pakistani quail (Coturnix japonica PK). Pak. J. Zool. 2024, 56, 1423–1431. [Google Scholar] [CrossRef]
  44. Mendes, A.S.; Paixão, S.J.; Restelatto, R.; Reffatti, R.; Possenti, J.C.; Moura, D.J.I.; Morello, G.M.Z.; Carvalho, T.M.R. Effects of initial body weight and litter material on broiler production. Braz. J. Poult. Sci. 2011, 13, 197–204. [Google Scholar] [CrossRef]
  45. Marks, H.L. Long-term selection for body weight in Japanese quail under different environments. Poult. Sci. 1996, 75, 1198–1203. [Google Scholar] [CrossRef]
  46. Smaldone, G.; Capezzuto, S.; Ambrosio, R.L.; Peruzy, M.F.; Marrone, R.; Peres, G.; Anastasio, A. The influence of broilers’ body weight on the efficiency of electrical stunning and meat quality under field conditions. Animals 2021, 11, 1362. [Google Scholar] [CrossRef]
  47. Raziq, F.; Hussain, J.; Ahmad, S.; Hussain, M.A.; Khan, M.T.; Ullah, A.; Qumar, M.; Wadood, F.; Gull-E-Faran. Effect of body weight at photostimulation on productive performance and welfare aspects of commercial layers. Anim. Biosci. 2024, 37, 500–508. [Google Scholar] [CrossRef]
  48. Narinc, D.; Karaman, E.; Aksoy, T.; Firat, M.Z. Genetic parameter estimates of growth curve and reproduction traits in Japanese quail. Poult. Sci. 2014, 93, 24–30. [Google Scholar] [CrossRef] [PubMed]
  49. Molee, A.; Kuadsantia, P.; Kaewnakian, P. Gene effects on body weight, carcass yield, and meat quality of Thai indigenous chicken. J. Poult. Sci. 2018, 55, 94–102. [Google Scholar] [CrossRef]
  50. Zhong, C.; Li, X.; Guan, D.; Zhang, B.; Wang, X.; Qu, L.; Zhou, H.; Fang, L.; Sun, C.; Yang, N. Age-dependent genetic architectures of chicken body weight explored by multidimensional GWAS and MolQTL analyses. J. Genet. Genom. 2024, 51, 1423–1434. [Google Scholar] [CrossRef]
  51. Haqani, M.I.; Nomura, S.; Nakano, M.; Goto, T.; Nagano, A.J.; Takenouchi, A.; Nakamura, Y.; Ishikawa, A.; Tsudzuki, M. Quantitative trait loci for growth-related traits in Japanese quail (Coturnix japonica) using restriction-site associated DNA sequencing. Mol. Genet. Genom. 2021, 296, 1147–1159. [Google Scholar] [CrossRef]
  52. Volkova, N.A.; Romanov, M.N.; Abdelmanova, A.S.; Larionova, P.V.; German, N.Y.; Vetokh, A.N.; Shakhin, A.V.; Volkova, L.A.; Sermyagin, A.A.; Anshakov, D.V.; et al. Genome-wide association study revealed putative SNPs and candidate genes associated with growth and meat traits in Japanese quail. Genes 2024, 15, 294. [Google Scholar] [CrossRef]
  53. Narushin, V.G.; Volkova, N.A.; Vetokh, A.N.; Dzhagaev, A.Y.; Volkova, L.A.; Griffin, D.K.; Romanov, M.N.; Zinovieva, N.A. Metabolic rate and egg production in Japanese quails can be predicted by assessing growth parameters of laying hens. Animals 2024, 14, 258. [Google Scholar] [CrossRef]
  54. Cai, W.; Hu, J.; Fan, W.; Xu, Y.; Tang, J.; Xie, M.; Zhang, Y.; Guo, Z.; Zhou, Z.; Hou, S. Strategies to improve genomic predictions for 35 duck carcass traits in an F2 population. J. Anim. Sci. Biotechnol. 2023, 14, 74. [Google Scholar] [CrossRef]
  55. Shkurko, M.I.; Bondarenko, Y.V. Porivnyalʹna kharakterystyka molodnyaka kachok riznykh henotypiv v umovakh prysadybnoho hospodarstva [Comparative Characteristics of Young Ducks of Different Genotypes in Homestead Farming Conditions]. In Materials of the Scientific Practical Conference of Teachers, Postgraduates and Students of the Sumy National Agrarian University, Sumy, Ukraine, 20–24 April 2015; Sumy National Agrarian University: Sumy, Ukraine, 2015; Volume 2, p. 103. Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=c1PnDYEAAAAJ:nrtMV_XWKgEC (accessed on 30 June 2025). (In Ukrainian)
  56. Shkurko, M.I.; Bondarenko, U.V.; Ostapenko, V.I. Produktyvnistʹ molodnyaka kachok riznykh henotypiv v umovakh prysadybnoho hospodarstva [Productivity of young ducks of different genotypes under conditions of farming household]. Vìsn. Sumsʹkogo nac. agrar. unìv., Ser. Tvarynnytstvo [Bull. Sumy Natl. Agrar. Univ. Ser. Livest.] 2015, 6, 75–78. Available online: http://www.irbis-nbuv.gov.ua/cgi-bin/irbis_nbuv/cgiirbis_64.exe?C21COM=2&I21DBN=UJRN&P21DBN=UJRN&IMAGE_FILE_DOWNLOAD=1&Image_file_name=PDF/Vsna_tvar_2015_6_18.pdf (accessed on 30 June 2025). (In Ukrainian with English Summary).
  57. Yang, C.; Wang, Z.; Song, Q.; Dong, B.; Bi, Y.; Bai, H.; Jiang, Y.; Chang, G.; Chen, G. Transcriptome sequencing to identify important genes and lncRNAs regulating abdominal fat deposition in ducks. Animals 2022, 12, 1256. [Google Scholar] [CrossRef] [PubMed]
  58. Kutnyuk, P.I.; Grechikhin, S.N.; Bondarenko, Y.V.; Gadyuchko, O.T. Geneticheskiy polimorfizm ovobelkov utok i yego adaptivnoye znacheniye [Genetic Polymorphism of Duck Proteins and Its Adaptive Significance]. In Molecular Genetic Markers of Animals, Proceedings of the International Conference, Kyiv, Ukraine, 14 May 1999; n.p.: Kyiv, Ukraine, 1999; p. 373. Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=c1PnDYEAAAAJ:5awf1xo2G04C (accessed on 30 June 2025). (In Russian)
  59. Kutnyuk, P.I.; Gadyuchko, O.T.; Bondarenko, Y.V. Locus Om as Body Weight Marker in Process of Frequent-dependent Selection of Turkeys. In The Poultry Industry Towards the 21st Century, Proceedings of the 10th European Poultry Conference, Jerusalem, Israel, 21–26 June 1998; World’s Poultry Science Association: Jerusalem, Israel, 1998; p. 67. Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=c1PnDYEAAAAJ:mlAyqtXpCwEC (accessed on 30 June 2025).
  60. Kaya Başar, E.; Narinç, D. Genetic parameter estimates of growth curve and feed efficiency traits in Japanese quail. Animals 2023, 13, 1765. [Google Scholar] [CrossRef]
  61. Wang, J.; Liu, Z.; Lin, H.; Jiao, H.; Zhao, J.; Ma, B.; Wang, Y.; He, S.; Wang, X. Daily feeding frequency affects feed intake and body weight management of growing layers. Poult. Sci. 2024, 103, 103748. [Google Scholar] [CrossRef]
  62. Abdelraheem, N.; Ahmed, M.; Hou, F. Effect of feed restriction on broiler chicks prior to slaughter. Open J. Anim. Sci. 2019, 9, 12–22. [Google Scholar] [CrossRef]
  63. Chaikuad, N.; Loengbudnark, W.; Chankitisakul, V.; Boonkum, W. Genetic comparisons of body weight, average daily gain, and breast circumference between slow-growing Thai native chickens (Pradu Hang dum) raised on-site farm and on-station. Vet. Sci. 2023, 10, 11. [Google Scholar] [CrossRef]
  64. Wang, S.; Wang, Y.; Li, Y.; Xiao, F.; Guo, H.; Gao, H.; Wang, N.; Zhang, H.; Li, H. Genome-wide association study and selective sweep analysis reveal the genetic architecture of body weights in a chicken F2 resource population. Front. Vet. Sci. 2022, 9, 875454. [Google Scholar] [CrossRef] [PubMed]
  65. Li, Z.; Nong, Y.; Liu, Y.; Wang, Z.; Wang, J.; Li, Z. Genome-wide association study of body size traits in Luning chickens using whole-genome sequencing. Animals 2025, 15, 972. [Google Scholar] [CrossRef] [PubMed]
  66. Cha, J.; Choo, H.; Srikanth, K.; Lee, S.-H.; Son, J.-W.; Park, M.-R.; Kim, N.; Jang, G.W.; Park, J.-E. Genome-wide association study identifies 12 loci associated with body weight at age 8 weeks in Korean native chickens. Genes 2021, 12, 1170. [Google Scholar] [CrossRef]
  67. Kanlisi, R.A.; Amuzu-Aweh, E.N.; Naazie, A.; Otsyina, H.R.; Kelly, T.R.; Gallardo, R.A.; Lamont, S.J.; Zhou, H.; Dekkers, J.; Kayang, B.B. Genetic architecture of body weight, carcass, and internal organs traits of Ghanaian local chickens. Front. Genet. 2024, 15, 1297034. [Google Scholar] [CrossRef]
  68. Mebratie, W.; Reyer, H.; Wimmers, K.; Bovenhuis, H.; Jensen, J. Genome wide association study of body weight and feed efficiency traits in a commercial broiler chicken population, a re-visitation. Sci. Rep. 2019, 9, 922. [Google Scholar] [CrossRef]
  69. Wang, J.; Liu, J.; Lei, Q.; Li, Y.; Zhang, Y.; Wang, Y.; Zhao, X.; Li, D.; Sun, G.; Kang, X.; et al. Elucidation of the genetic determination of body weight and size in Chinese local chicken breeds by large-scale genomic analyses. BMC Genom. 2024, 25, 296. [Google Scholar] [CrossRef]
  70. Dementeva, N.V.; Kudinov, A.A.; Mitrofanova, O.V.; Stanishevskaya, O.I.; Fedorova, E.S.; Romanov, M.N. Genome-wide association study of reproductive traits in a gene pool breed of the Russian White chickens. Reprod. Domest. Anim. 2018, 53 (Suppl. S2), 123–124. [Google Scholar] [CrossRef]
  71. Volkova, N.A.; Romanov, M.N.; Vetokh, A.N.; Larionova, P.V.; Volkova, L.A.; Abdelmanova, A.S.; Sermyagin, A.A.; Griffin, D.K.; Zinovieva, N.A. Genome-wide association study reveals the genetic architecture of growth and meat production traits in a chicken F2 resource population. Genes 2024, 15, 1246. [Google Scholar] [CrossRef]
  72. Volkova, N.A.; Kotova, T.O.; Vetokh, A.N.; Larionova, P.V.; Volkova, L.A.; Romanov, M.N.; Zinovieva, N.A. Genome-wide association study of testes development indicators in roosters (Gallus gallus L.). Sel’skokhozyaistvennaya Biol. [Agric. Biol.] 2024, 59, 649–657. [Google Scholar] [CrossRef]
  73. Volkova, N.A.; Romanov, M.N.; Dzhagaev, A.Y.; Larionova, P.V.; Volkova, L.A.; Abdelmanova, A.S.; Vetokh, A.N.; Griffin, D.K.; Zinovieva, N.A. Genome-wide association studies and candidate genes for egg production traits in layers from an F2 crossbred population produced using two divergently selected chicken breeds, Russian White and Cornish White. Genes 2025, 16, 583. [Google Scholar] [CrossRef]
  74. Dementieva, N.V.; Shcherbakov, Y.S.; Stanishevskaya, O.I.; Vakhrameev, A.B.; Larkina, T.A.; Dysin, A.P.; Nikolaeva, O.A.; Ryabova, A.E.; Azovtseva, A.I.; Mitrofanova, O.V.; et al. Large-scale genome-wide SNP analysis reveals the rugged (and ragged) landscape of global ancestry, phylogeny, and demographic history in chicken breeds. J. Zhejiang Univ. Sci. B 2024, 25, 324–340. [Google Scholar] [CrossRef] [PubMed]
  75. Volkova, N.A.; Romanov, M.N.; Abdelmanova, A.S.; Larionova, P.V.; German, N.Y.; Vetokh, A.N.; Shakhin, A.V.; Volkova, L.A.; Anshakov, D.V.; Fisinin, V.I.; et al. Genotyping-by-sequencing strategy for integrating genomic structure, diversity and performance of various Japanese quail (Coturnix japonica) breeds. Animals 2023, 13, 3439. [Google Scholar] [CrossRef]
  76. Volkova, N.A.; German, N.Y.; Larionova, P.V.; Vetokh, A.N.; Romanov, M.N.; Zinovieva, N.A. [Identification of SNPs and candidate genes associated with abdominal fat deposition in quails (Coturnix japonica)]. Sel’skokhozyaistvennaya Biol. [Agric. Biol.] 2023, 58, 1079–1087. [Google Scholar] [CrossRef]
  77. Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID Bioinformatics Resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef]
  78. Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Bioinformatics enrichment tools: Paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 2009, 37, 1–13. [Google Scholar] [CrossRef]
  79. Romanov, M.N.; Kochish, I.I.; Sharafetdinov, G.R.; Myasnikova, O.V.; Nikonov, I.N.; Selina, M.V.; Surai, P.F. Napravleniya sovremennykh biotekhnologicheskikh razrabotok dlya realizatsii geneticheskogo potentsiala yaichnoy ptitsy [Towards Advanced Biotechnological Developments to Realize the Genetic Potential of Egg-type Poultry]. In Molecular Genetic Technologies for Analysis of Gene Expression Related to Animal Productivity and Disease Resistance, Materials of the 3rd International Scientific and Practical Conference, Moscow, Russia, 30 September 2021; Pozyabin, S.V., Kochish, I.I., Romanov, M.N., Eds.; Sel’skokhozyaistvennye tekhnologii: Moscow, Russia, 2021; pp. 40–51, (In Russian with English Summary). [Google Scholar] [CrossRef]
  80. Kutnyuk, P.I.; Volohovich, V.A.; Moiseeva, I.G. Elektroforeticheskij Analiz Belkov Selskohozyajstvennoj Pticy: Metodicheskie Rekomendacii [Electrophoretic Analysis of Poultry Proteins: Technical Recommendations]; Ukrainian Poultry Research Institute: Kharkov, USSR, 1986; Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=tFr9MGIAAAAJ:dshw04ExmUIC (accessed on 30 June 2025). (In Russian)
  81. Gadyuchko, O.T.; Sakhatsky, N.I.; Tereshchenko, A.V.; Anisimov, V.I.; Kislaya, E.D.; Svinarev, V.F. Geneticheskiy potentsial porod i populyatsiy gusey Ukrainy [Genetic potential of breeds and populations of geese in Ukraine]. Ptakhivnytstvo [Poult. Farming] 2003, 53, 54–62. Available online: https://www.researchgate.net/publication/342746669 (accessed on 30 June 2025). (In Russian with English Summary).
  82. Kutnyuk, P.I.; Moiseeva, I.G. Informatsionno-statisticheskiye aspekty modelirovaniya populyatsionnykh protsessov s pomoshch’yu molekulyarno-geneticheskikh markerov [Information and Statistical Aspects of Modeling Population Processes Using Molecular Genetic Markers]. In Proceedings of the 1st International Conference “Molecular-Genetic Markers of Animals”, Kyiv, Ukraine, 27–29 January 1994; Zubets, M.V., Ed.; UAAS, Agrarna nauka: Kyiv, Ukraine, 1994; pp. 132–133. Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=tFr9MGIAAAAJ:7T2F9Uy0os0C (accessed on 30 June 2025). (In Russian).
  83. Baumgartner, J.; Bondarenko, Y.V. Search for Autosexing Strains and Crosses in Japanese Quail. In Proceedings of the 8th International Symposium on Actual Problems of Avian Genetics, Smolenice, Czechoslovakia, 3–6 April 1989; Slovak Society for Agriculture, Forestry, Food and Veterinary Sciences of Slovak Academy of Sciences: Bratislava, Czechoslovakia; Poultry Research and Production Institute: Ivanka pri Dunaji, Bratislava, Czechoslovakia; Czechoslovak Branch of WPSA: Smolenice, Czechoslovakia, 1989; pp. 262–265. Available online: https://www.cabidigitallibrary.org/doi/full/10.5555/19890171986 (accessed on 30 June 2025).
  84. Romanov, M.N.; Shakhin, A.V.; Abdelmanova, A.S.; Volkova, N.A.; Efimov, D.N.; Fisinin, V.I.; Korshunova, L.G.; Anshakov, D.V.; Dotsev, A.V.; Griffin, D.K.; et al. Dissecting selective signatures and candidate genes in grandparent lines subject to high selection pressure for broiler production and in a local Russian chicken breed of Ushanka. Genes 2024, 15, 524. [Google Scholar] [CrossRef] [PubMed]
  85. Bondarenko, Y.V. Polymorphism of proteins of eggs of chickens of different breeds and lines. Ptakhivnytstvo [Poult. Farming] 1974, 17, 32–37. Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=c1PnDYEAAAAJ:P7Ujq4OLJYoC (accessed on 30 June 2025).
  86. Zhang, H.; Hunt, H.D.; Cheng, H.H.; Dodgson, J.B.; Romanov, M.N.; Bacon, L.D. Identification and Evaluation of SNPs at the 3′ End of the Tva Gene Segregating Among ALSV Resistance and Susceptible Lines of Chickens. In Proceedings of the International Plant and Animal Genome XIII Conference, San Diego, CA, USA, 15–19 January 2005; Scherago International: San Diego, CA, USA, 2005; p. 123. Available online: https://www.ars.usda.gov/research/publications/publication/?seqNo115=170524 (accessed on 30 June 2025).
  87. Volkovoy, S.; Bondarenko, Y. Raduga opereniya yaponskogo perepela [Japanese quail plumage rainbow]. Priusadebnoye Khoz. [Allot. Husb.] 1989, 5, 14–15. Available online: https://yablonka.net/world/zh/686-raduga-opereniya-yaponskogo-perepela.html (accessed on 30 June 2025). (In Russian).
  88. Podstreshnyi, O.P.; Tereshchenko, O.V.; Tkachyk, T.E.; Podstreshna, I.O.; Ishchenko, Y.B. Henetychna Identyfikatsiya i Pasportyzatsiya Porid ta Liniy Ptytsi: Metodychni Rekomendatsiyi [Genetic Identification and Passportization of Poultry Breeds and Lines: Methodical Recommendations]; Poultry Research Institute of the Ukrainian Academy of Agrarian Sciences: Birky, Ukraine, 2009; Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=deB5xCwAAAAJ:j8SEvjWlNXcC (accessed on 30 June 2025). (In Ukrainian)
  89. Raetskii, A.; Mamontova, I.; Moiseeva, I. Rezul’taty ispol’zovaniya moskovskikh kur linii M5 v skreshchivanii s belymi leggornami krossa “Khayseks” [Results of using Moscow chickens of M5 line for crossing with White Leghorns of Highsex cross]. Izv. Timiryazev S-Kh. Akad. [Izv. Timiryazev Agric. Acad.] 1981, 6, 136–142. Available online: https://eurekamag.com/research/016/935/016935374.php (accessed on 30 June 2025).
  90. Moiseyeva, I.G.; Semyenova, S.K.; Gorbachyova, N.S. Chicken breed differentiation estimated by body measurements. In Proceedings of the Scientific Poultry Conference; Pigarev, N., Ed.; n.p.: Sergiev Posad, Russia, 1995; pp. 45–46. Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=tFr9MGIAAAAJ:SdhP9T11ey4C (accessed on 30 June 2025). (In Russian).
  91. Narushin, V.G.; Romanov, M.N. Modelling growth of chick embryo. In Proceedings of the 9th European Poultry Conference: Plenary Papers and Contributed Papers; Glasgow, Scotland, UK, 7–12 August 1994; Great Britain, Ministry of Agriculture, Fisheries and Food; World’s Poultry Science Association, UK Branch: Andover, UK, 1994; Volume 1, pp. 411–412. Available online: https://kar.kent.ac.uk/46310/ (accessed on 30 June 2025).
  92. Narushin, V.G.; Romanov, M.N.; Sakhatsky, N.I. Modelling growth of chick embryo: Correction for egg weight [Modelowanie wzrostu zarodka kurzego z poprawką na masę jaja]. Zeszyty Naukowe. Przegląd Hodowlany [Anim. Prod. Rev., Appl. Sci. Rep.] 1997, 31, 55–57. Available online: https://www.researchgate.net/publication/355808171 (accessed on 30 June 2025).
  93. Bondarenko, Y.V.; Romanov, M.N. Osoblyvosti statevoyi minlyvosti masy tila u dobovoho molodnyaka sviysʹkykh ptakhiv [Peculiarities of sexual variation of body weight in day-old poults of domestic birds]. In Genetics of Animal Performance, Proceedings of the All-Ukrainian Anniversary Scientific and Practical Conference, Kyiv, Ukraine, 20 December 1994; n.p.: Kyiv, Ukraine, 1994; p. 36. Available online: https://scholar.google.com/citations?view_op=view_citation&citation_for_view=c1PnDYEAAAAJ:HDshCWvjkbEC (accessed on 30 June 2025).
  94. Kochish, I.I.; Titov, V.Y.; Nikonov, I.N.; Brazhnik, E.A.; Vorobyov, N.I.; Korenyuga, M.V.; Myasnikova, O.V.; Dolgorukova, A.M.; Griffin, D.K.; Romanov, M.N. Unraveling signatures of chicken genetic diversity and divergent selection in breed-specific patterns of early myogenesis, nitric oxide metabolism and post-hatch growth. Front. Genet. 2023, 13, 1092242. [Google Scholar] [CrossRef]
  95. Khvostik, V.P.; Bondarenko, Y.V. Ekoloho-henetychni parametry zhyvoyi masy m’yaso-yayechnykh kurey riznoho henetychnoho pokhodzhennya [Ecological and genetic parameters of live weight meat and eggs hens of different genetic origin]. Vìsn. Sumsʹkogo nac. agrar. unìv., Ser. Tvarynnytstvo [Bull. Sumy Natl. Agrar. Univ. Ser. Livest.] 2024, 3, 106–109, (In Ukrainian with English Summary). [Google Scholar] [CrossRef]
  96. Lei, M.; Luo, C.; Peng, X.; Fang, M.; Nie, Q.; Zhang, D.; Yang, G.; Zhang, X. Polymorphism of growth-correlated genes associated with fatness and muscle fiber traits in chickens. Poult. Sci. 2007, 86, 835–842. [Google Scholar] [CrossRef] [PubMed]
  97. Haqani, M.I.; Nomura, S.; Nakano, M.; Goto, T.; Nagano, A.J.; Takenouchi, A.; Nakamura, Y.; Ishikawa, A.; Tsudzuki, M. Mapping of quantitative trait loci controlling egg-quality and -production traits in Japanese quail (Coturnix japonica) using restriction-site associated DNA sequencing. Genes 2021, 12, 735. [Google Scholar] [CrossRef]
  98. Vollmar, S.; Haas, V.; Schmid, M.; Preuß, S.; Joshi, R.; Rodehutscord, M.; Bennewitz, J. Mapping genes for phosphorus utilization and correlated traits using a 4k SNP linkage map in Japanese quail (Coturnix japonica). Anim. Genet. 2020, 52, 90–98. [Google Scholar] [CrossRef]
  99. Recoquillay, J.; Pitel, F.; Arnould, C.; Leroux, S.; Dehais, P.; Moréno, C.; Calandreau, L.; Bertin, A.; Gourichon, D.; Bouchez, O.; et al. A medium density genetic map and QTL for behavioral and production traits in Japanese quail. BMC Genom. 2015, 16, 10. [Google Scholar] [CrossRef]
  100. Chen, S.; Jin, S.; Lu, Y.; Zhang, D.; Ji, C.; Yang, N. Association of leptin receptor gene polymorphisms with growth and feed efficiency in meat-type chickens. Poult. Sci. 2014, 93, 1910–1915. [Google Scholar] [CrossRef]
  101. Wang, X.; Zhao, Y.; Bai, J. Research Note: Association of LEPR gene polymorphism with growth and carcass traits in Savimalt and French Giant meat-type quails. Poult. Sci. 2023, 102, 103047. [Google Scholar] [CrossRef] [PubMed]
  102. Li, Y.D.; Wang, W.J.; Li, Z.W.; Ning, W.; Fan, X.I.A.O.; Gao, H.H.; Guo, H.S.; Hui, L.I.; Wang, S.Z. Integration of association and computational methods reveals functional variants of LEPR gene for abdominal fat content in chickens. J. Integr. Agric. 2021, 20, 2734–2748. [Google Scholar] [CrossRef]
  103. da Silva, R.C.; Ferraz, J.B.; Meirelles, F.V.; Eler, J.P.; Balieiro, J.C.; Cucco, D.C.; Mattos, E.C.; Rezende, F.M.; Silva, S.L. Association of single nucleotide polymorphisms in the bovine leptin and leptin receptor genes with growth and ultrasound carcass traits in Nellore cattle. Genet. Mol. Res. 2012, 11, 3721–3728. [Google Scholar] [CrossRef]
  104. Ferraz, J.B.S.; Pinto, L.F.B.; Meirelles, F.V.; Eler, J.P.; De Rezende, F.M.; Oliveira, E.C.M.; Almeida, H.B.; Woodward, B.; Nkrumah, D. Association of single nucleotide polymorphisms with carcass traits in Nellore cattle. Genet. Mol. Res. 2009, 8, 1360–1366. [Google Scholar] [CrossRef]
  105. Ovilo, C.; Fernández, A.; Noguera, J.L.; Barragán, C.; Letón, R.; Rodríguez, C.; Mercadé, A.; Alves, E.; Folch, J.M.; Varona, L. Fine mapping of porcine chromosome 6 QTL and LEPR effects on body composition in multiple generations of an Iberian by Landrace intercross. Genet. Res. 2005, 85, 57–67. [Google Scholar] [CrossRef]
  106. Pérez-Montarelo, D.; Fernández, A.; Folch, J.M.; Pena, R.N.; Ovilo, C.; Rodríguez, C.; Silió, L.; Fernández, A.I. Joint effects of porcine leptin and leptin receptor polymorphisms on productivity and quality traits. Anim. Genet. 2012, 43, 805–809. [Google Scholar] [CrossRef]
  107. Suárez-Mesa, R.; Ros-Freixedes, R.; Pena, R.N.; Reixach, J.; Estany, J. Impact of the leptin receptor gene on pig performance and quality traits. Sci. Rep. 2024, 14, 10652. [Google Scholar] [CrossRef]
  108. Haldar, A.; French, M.C.; Brauning, R.; Edwards, S.J.; O’Connell, A.R.; Farquhar, P.A.; Davis, G.H.; Johnstone, P.D.; Juengel, J.L. Single-nucleotide polymorphisms in the LEPR gene are associated with divergent phenotypes for age at onset of puberty in Davisdale ewes. Biol. Reprod. 2014, 90, 33. [Google Scholar] [CrossRef] [PubMed]
  109. Muñoz, G.; Ovilo, C.; Silió, L.; Tomás, A.; Noguera, J.L.; Rodríguez, M.C. Single- and joint-population analyses of two experimental pig crosses to confirm quantitative trait loci on Sus scrofa chromosome 6 and leptin receptor effects on fatness and growth traits. J. Anim. Sci. 2009, 87, 459–468. [Google Scholar] [CrossRef] [PubMed]
  110. Lakhssassi, K.; Serrano, M.; Lahoz, B.; Sarto, M.P.; Iguácel, L.P.; Folch, J.; Alabart, J.L.; Calvo, J.H. The LEPR gene is associated with reproductive seasonality traits in Rasa Aragonesa sheep. Animals 2020, 10, 2448. [Google Scholar] [CrossRef]
  111. Deng, S.; Qiu, Y.; Zhuang, Z.; Wu, J.; Li, X.; Ruan, D.; Xu, C.; Zheng, E.; Yang, M.; Cai, G.; et al. Genome-wide association study of body conformation traits in a three-way crossbred commercial pig population. Animals 2023, 13, 2414. [Google Scholar] [CrossRef]
  112. Meng, G.; Bao, Q.; Ma, X.; Chu, M.; Huang, C.; Guo, X.; Liang, C.; Yan, P. Analysis of copy number variation in the whole genome of normal-haired and long-haired Tianzhu white yaks. Genes 2022, 13, 2405. [Google Scholar] [CrossRef] [PubMed]
  113. Paredes-Sánchez, F.A.; Sifuentes-Rincón, A.M.; Segura Cabrera, A.; García Pérez, C.A.; Parra Bracamonte, G.M.; Ambriz Morales, P. Associations of SNPs located at candidate genes to bovine growth traits, prioritized with an interaction networks construction approach. BMC Genet. 2015, 16, 91. [Google Scholar] [CrossRef] [PubMed]
  114. Wang, Y.; Lv, G.; Liu, Z.; Cheng, Y.; Ding, R.; Yang, G.; Yu, T. Whole genome and transcriptome analyses identify genetic markers associated with growth traits in Qinchuan black pig. BMC Genom. 2025, 26, 469. [Google Scholar] [CrossRef]
  115. Ladeira, G.C.; Pilonetto, F.; Fernandes, A.C.; Bóscollo, P.P.; Dauria, B.D.; Titto, C.G.; Coutinho, L.L.; E Silva, F.F.; Pinto, L.F.B.; Mourao, G.B. CNV detection and their association with growth, efficiency and carcass traits in Santa Inês sheep. J. Anim. Breed Genet. 2022, 139, 476–487. [Google Scholar] [CrossRef] [PubMed]
  116. Zhu, Y.; Liu, X.; Wang, Y.; Liu, L.; Wang, Y.; Zhao, G.; Wen, J.; Cui, H. Genome-wide association study revealed the effect of rs312715211 in ZNF652 gene on abdominal fat percentage of chickens. Biology 2022, 11, 1849. [Google Scholar] [CrossRef]
  117. Wu, Y.; Xiao, H.; Pi, J.; Zhang, H.; Pan, A.; Pu, Y.; Liang, Z.; Shen, J.; Du, J. EGFR promotes the proliferation of quail follicular granulosa cells through the MAPK/extracellular signal-regulated kinase (ERK) signaling pathway. Cell Cycle 2019, 18, 2742–2756. [Google Scholar] [CrossRef]
  118. Ji, G.; Zhang, M.; Tu, Y.; Liu, Y.; Shan, Y.; Ju, X.; Zou, J.; Shu, J.; Sheng, Z.; Li, H. Molecular regulatory mechanisms in chicken feather follicle morphogenesis. Genes 2023, 14, 1646. [Google Scholar] [CrossRef]
  119. Reis, H.B.D.; Carvalho, M.E.; Espigolan, R.; Poleti, M.D.; Ambrizi, D.R.; Berton, M.P.; Ferraz, J.B.S.; de Mattos Oliveira, E.C.; Eler, J.P. Genome-wide association (GWAS) applied to carcass and meat traits of Nellore cattle. Metabolites 2024, 14, 6. [Google Scholar] [CrossRef] [PubMed]
  120. Moreira, G.C.M.; Boschiero, C.; Cesar, A.S.M.; Reecy, J.M.; Godoy, T.F.; Trevisoli, P.A.; Cantão, M.E.; Ledur, M.C.; Ibelli, A.M.G.; Peixoto, J.D.O.; et al. A genome-wide association study reveals novel genomic regions and positional candidate genes for fat deposition in broiler chickens. BMC Genom. 2018, 19, 374. [Google Scholar] [CrossRef]
  121. Kogelman, L.J.; Pant, S.D.; Fredholm, M.; Kadarmideen, H.N. Systems genetics of obesity in an F2 pig model by genome-wide association, genetic network, and pathway analyses. Front. Genet. 2014, 5, 214. [Google Scholar] [CrossRef]
  122. Yang, Y.; Yan, J.; Fan, X.; Chen, J.; Wang, Z.; Liu, X.; Yi, G.; Liu, Y.; Niu, Y.; Zhang, L.; et al. The genome variation and developmental transcriptome maps reveal genetic differentiation of skeletal muscle in pigs. PLoS Genet. 2021, 17, e1009910. [Google Scholar] [CrossRef] [PubMed]
  123. Xu, M.; Tang, Q.; Qi, J.; Han, X.; Tao, Q.; Lu, Y.; Bai, Y.; Hu, S.; Li, L.; Bai, L.; et al. Integration of GWAS and transcriptomic analyses reveal candidate genes for duck gonadal development during puberty onset. BMC Genom. 2024, 25, 1151. [Google Scholar] [CrossRef] [PubMed]
  124. Lin, G.W.; Liang, Y.C.; Wu, P.; Chen, C.K.; Lai, Y.C.; Jiang, T.X.; Haung, Y.H.; Chuong, C.M. Regional specific differentiation of integumentary organs: SATB2 is involved in α- and β-keratin gene cluster switching in the chicken. Dev. Dyn. 2022, 251, 1490–1508. [Google Scholar] [CrossRef] [PubMed]
  125. Lü, S.J.; Chen, F.Y.; Jin, L.; Zhang, Z.J.; Zhu, X.T.; Shi, Q.T.; Xin, X.L.; Chu, Q.X.; Bai, Z.L.; Wang, E.Y.; et al. Identification of growth-related genes under selection in Angus cattle using SLAF-seq. Acta Vet. Zootech. Sin. 2020, 51, 713–721. [Google Scholar] [CrossRef]
  126. Park, H.B.; Han, S.H.; Lee, J.B.; Cho, I.C. Rapid Communication: High-resolution quantitative trait loci analysis identifies LTBP2 encoding latent transforming growth factor beta binding protein 2 associated with thoracic vertebrae number in a large F2 intercross between Landrace and Korean native pigs. J. Anim. Sci. 2017, 95, 1957–1962. [Google Scholar] [CrossRef]
  127. Park, J.; Do, K.T.; Park, K.D.; Lee, H.K. Genome-wide association study using a single-step approach for teat number in Duroc, Landrace and Yorkshire pigs in Korea. Anim. Genet. 2023, 54, 743–751. [Google Scholar] [CrossRef]
  128. Lee, Y.; Tjeerdema, E.; Kling, S.; Chang, N.; Hamdoun, A. Solute carrier (SLC) expression reveals skeletogenic cell diversity. Dev. Biol. 2023, 503, 68–82. [Google Scholar] [CrossRef]
  129. Lin, J.; Redies, C.; Luo, J. Regionalized expression of ADAM13 during chicken embryonic development. Dev. Dyn. 2007, 236, 862–870. [Google Scholar] [CrossRef]
  130. Lin, J.; Yan, X.; Markus, A.; Redies, C.; Rolfs, A.; Luo, J. Expression of seven members of the ADAM family in developing chicken spinal cord. Dev. Dyn. 2010, 239, 1246–1254. [Google Scholar] [CrossRef] [PubMed]
  131. Lin, J.; Luo, J.; Redies, C. Differential regional expression of multiple ADAMs during feather bud formation. Dev. Dyn. 2011, 240, 2142–2152. [Google Scholar] [CrossRef] [PubMed]
  132. Lukic, B.; Curik, I.; Drzaic, I.; Galić, V.; Shihabi, M.; Vostry, L.; Cubric-Curik, V. Genomic signatures of selection, local adaptation and production type characterisation of East Adriatic sheep breeds. J. Anim. Sci. Biotechnol. 2023, 14, 142. [Google Scholar] [CrossRef] [PubMed]
  133. Holgate, S.T.; Davies, D.E.; Powell, R.M.; Holloway, J.W. ADAM33: A newly identified protease involved in airway remodelling. Pulm. Pharmacol. Ther. 2006, 19, 3–11. [Google Scholar] [CrossRef]
  134. Davis, R.V.N. Comparative Transcriptional Profiling and Differential Expression Analysis of Pectoralis Major Muscle in Modern and Legacy Gallus Broiler Lines. Ph.D. Thesis, University of Delaware, Newark, DE, USA, 2017. Available online: https://udspace.udel.edu/server/api/core/bitstreams/509dbb29-d100-4f7f-ae41-bc6ae75466c5/content (accessed on 30 June 2025).
  135. Eydivandi, S.; Roudbar, M.A.; Karimi, M.O.; Sahana, G. Genomic scans for selective sweeps through haplotype homozygosity and allelic fixation in 14 indigenous sheep breeds from Middle East and South Asia. Sci. Rep. 2021, 11, 2834. [Google Scholar] [CrossRef]
  136. Zhang, M.; Wang, Y.; Chen, Q.; Wang, D.; Zhang, X.; Huang, X.; Xu, L. Genome-wide association study on body conformation traits in Xinjiang Brown cattle. Int. J. Mol. Sci. 2024, 25, 10557. [Google Scholar] [CrossRef]
  137. Kschonsak, M.; Chua, H.C.; Weidling, C.; Chakouri, N.; Noland, C.L.; Schott, K.; Chang, T.; Tam, C.; Patel, N.; Arthur, C.P.; et al. Structural architecture of the human NALCN channelosome. Nature 2022, 603, 180–186. [Google Scholar] [CrossRef]
  138. Zhou, L.; Liu, H.; Zhao, Q.; Wu, J.; Yan, Z. Architecture of the human NALCN channelosome. Cell Discov. 2022, 8, 33. [Google Scholar] [CrossRef]
  139. Bayat, A.; Liu, Z.; Luo, S.; Fenger, C.D.; Højte, A.F.; Isidor, B.; Cogne, B.; Larson, A.; Zanus, C.; Faletra, F.; et al. A new neurodevelopmental disorder linked to heterozygous variants in UNC79. Genet. Med. 2023, 25, 100894. [Google Scholar] [CrossRef]
  140. Zhou, X.; Ouyang, M.; Zhang, Y.; Ikhwanuddin, M.; Ma, H.; Ye, S. Whole-genome resequencing provides novel insights into the genetic diversity, population structure, and patterns of runs of homozygosity in mud crab (Scylla paramamosain). SSRN 2025, 5128826. [Google Scholar] [CrossRef]
  141. Murakami, K.; Palermo, J.; Stanhope, B.A.; Gibbs, A.G.; Keene, A.C. A screen for sleep and starvation resistance identifies a wake-promoting role for the auxiliary channel unc79. G3 2021, 11, jkab199. [Google Scholar] [CrossRef]
  142. Albrecht, E.; Komolka, K.; Ponsuksili, S.; Gotoh, T.; Wimmers, K.; Maak, S. Transcriptome profiling of Musculus longissimus dorsi in two cattle breeds with different intramuscular fat deposition. Genom. Data 2016, 7, 109–111. [Google Scholar] [CrossRef] [PubMed]
  143. Liao, L.; Yao, Z.; Kong, J.; Zhang, X.; Li, H.; Chen, W.; Xie, Q. Transcriptomic analysis reveals the dynamic changes of transcription factors during early development of chicken embryo. BMC Genom. 2022, 23, 825. [Google Scholar] [CrossRef] [PubMed]
  144. Cheng, Z.Y.; He, T.T.; Gao, X.M.; Zhao, Y.; Wang, J. ZBTB transcription factors: Key regulators of the development, differentiation and effector function of T cells. Front. Immunol. 2021, 12, 713294. [Google Scholar] [CrossRef] [PubMed]
  145. Mao, A.P.; Ishizuka, I.E.; Kasal, D.N.; Mandal, M.; Bendelac, A. A shared Runx1-bound Zbtb16 enhancer directs innate and innate-like lymphoid lineage development. Nat. Commun. 2017, 8, 863. [Google Scholar] [CrossRef] [PubMed]
  146. Yi, C.; Kitamura, Y.; Maezawa, S.; Namekawa, S.H.; Cairns, B.R. ZBTB16/PLZF regulates juvenile spermatogonial stem cell development through an extensive transcription factor poising network. Nat. Struct. Mol. Biol. 2025, 32, 1213–1226. [Google Scholar] [CrossRef]
  147. Plaisier, C.L.; Bennett, B.J.; He, A.; Guan, B.; Lusis, A.J.; Reue, K.; Vergnes, L. Zbtb16 has a role in brown adipocyte bioenergetics. Nutr. Diabetes 2012, 2, e46. [Google Scholar] [CrossRef]
  148. Ying, F.; Gu, H.; Xiong, Y.; Zuo, B. Analysis of differentially expressed genes in gastrocnemius muscle between DGAT1 transgenic mice and wild-type mice. Biomed. Res. Int. 2017, 2017, 5404682. [Google Scholar] [CrossRef]
  149. Wei, S.; Zhang, M.; Zheng, Y.; Yan, P. ZBTB16 overexpression enhances white adipogenesis and induces brown-like adipocyte formation of bovine white intramuscular preadipocytes. Cell Physiol. Biochem. 2018, 48, 2528–2538. [Google Scholar] [CrossRef]
  150. Chen, J.F.; Wang, J.; Chai, J.; Jin, W.; Ren, Q.L.; Ma, Q.; Lu, Q.X.; Sun, J.J.; Mo, D.L.; Zhang, J.Q.; et al. Transcriptome profiling of longissimus dorsi during different prenatal stages to identify genes involved in intramuscular fat deposition in lean and obese pig breeds. Mol. Biol. Rep. 2024, 51, 386. [Google Scholar] [CrossRef]
  151. Liška, F.; Landa, V.; Zídek, V.; Mlejnek, P.; Šilhavý, J.; Šimáková, M.; Strnad, H.; Trnovská, J.; Škop, V.; Kazdová, L.; et al. Downregulation of Plzf gene ameliorates metabolic and cardiac traits in the spontaneously hypertensive rat. Hypertension 2017, 69, 1084–1091. [Google Scholar] [CrossRef]
  152. Bendlová, B.; Vaňková, M.; Hill, M.; Vacínová, G.; Lukášová, P.; Vejražková, D.; Šedová, L.; Šeda, O.; Včelák, J. ZBTB16 gene variability influences obesity-related parameters and serum lipid levels in Czech adults. Physiol. Res. 2017, 66 (Suppl. S3), S425–S431. [Google Scholar] [CrossRef]
  153. Topno, N.A.; Kesarwani, V.; Kushwaha, S.K.; Azam, S.; Kadivella, M.; Gandham, R.K.; Majumdar, S.S. Non-synonymous variants in fat QTL genes among high- and low-milk-yielding indigenous breeds. Animals 2023, 13, 884. [Google Scholar] [CrossRef]
  154. Xu, S.; Donnelly, L.; Kober, D.L.; Mak, M.; Radhakrishnan, A. Development of a monoclonal antibody to study MARCH6, an E3 ligase that regulates proteins that control lipid homeostasis. J. Lipid Res. 2024, 65, 100650. [Google Scholar] [CrossRef]
  155. Scott, N.A.; Sharpe, L.J.; Brown, A.J. The E3 ubiquitin ligase MARCHF6 as a metabolic integrator in cholesterol synthesis and beyond. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2021, 1866, 158837. [Google Scholar] [CrossRef]
  156. Liu, Q.; Yue, J.; Niu, N.; Liu, X.; Yan, H.; Zhao, F.; Hou, X.; Gao, H.; Shi, L.; Wang, L.; et al. Genome-wide association analysis identified BMPR1A as a novel candidate gene affecting the number of thoracic vertebrae in a Large White × Minzhu intercross pig population. Animals 2020, 10, 2186. [Google Scholar] [CrossRef]
  157. Zhang, L.C.; Yue, J.W.; Pu, L.; Wang, L.G.; Liu, X.; Liang, J.; Yan, H.; Zhao, K.B.; Li, N.; Shi, H.B.; et al. Genome-wide study refines the quantitative trait locus for number of ribs in a Large White × Minzhu intercross pig population and reveals a new candidate gene. Mol. Genet. Genom. 2016, 291, 1885–1890. [Google Scholar] [CrossRef] [PubMed]
  158. Ogunbawo, A.R.; Hidalgo, J.; Mulim, H.A.; Carrara, E.R.; Ventura, H.T.; Souza, N.O.; Lourenco, D.; Oliveira, H.R. Applying the Algorithm for Proven and Eoung in GWAS reveals high polygenicity for key traits in Nellore cattle. Front. Genet. 2025, 16, 1549284. [Google Scholar] [CrossRef] [PubMed]
  159. Derežanin, L.; Blažytė, A.; Dobrynin, P.; Duchêne, D.A.; Grau, J.H.; Jeon, S.; Kliver, S.; Koepfli, K.P.; Meneghini, D.; Preick, M.; et al. Multiple types of genomic variation contribute to adaptive traits in the mustelid subfamily Guloninae. Mol. Ecol. 2022, 31, 2898–2919. [Google Scholar] [CrossRef]
  160. Kitakaze, T.; Tatsumi, R.; Yamaguchi, M.; Kubota, M.; Nakatsuji, A.; Harada, N.; Yamaji, R. All-trans retinoic acid-responsive LGR6 is transiently expressed during myogenic differentiation and is required for myoblast differentiation and fusion. Int. J. Mol. Sci. 2023, 24, 9035. [Google Scholar] [CrossRef] [PubMed]
  161. King, J.S.; Wan, M.; Wagley, Y.; Stestiv, M.; Kalajzic, I.; Hankenson, K.D.; Sanjay, A. Signaling pathways associated with Lgr6 to regulate osteogenesis. Bone 2024, 187, 117207. [Google Scholar] [CrossRef] [PubMed]
  162. Podstreshnyi, O.P.; Tereshchenko, O.V.; Katerynych, O.O.; Tkachyk, T.E.; Podstreshna, I.O. Vyrobnytstvo Perepelynykh Yayets’ ta M″yasa: Metodychni Rekomendatsiyi [Production of Quail Eggs and Meat: Methodical Recommendations], 2nd ed.; Tereshchenko, O.V., Ed.; Poultry Research Institute, NAAS of Ukraine: Birky, Ukraine, 2010; Available online: https://www.researchgate.net/publication/342802513 (accessed on 30 June 2025). (In Ukrainian)
  163. Podstreshnyi, O.; Tereshchenko, O. Hodivlya molodnyaka perepeliv [Feeding young quails]. Ahrar. Krayina [Agrar. Country] 2012, 7, 6. Available online: https://www.researchgate.net/publication/342832583 (accessed on 30 June 2025). (In Ukrainian).
  164. Podstreshnyi, O.; Tereshchenko, O. Utrymannya doroslykh perepeliv [Maintenance of adult quails]. Ahrar. Krayina [Agrar. Country] 2012, 6, 8–9. Available online: https://www.researchgate.net/publication/342832587 (accessed on 30 June 2025). (In Ukrainian).
  165. Misztal, I.; Tsuruta, S.; Lourenco, D.; Aguilar, I.; Legarra, A.; Vitezica, Z. Manual for BLUPF90 Family of Programs; University of Georgia: Athens, GA, USA, 2022; Available online: https://nce.ads.uga.edu/html/projects/programs/docs/blupf90_all8.pdf (accessed on 30 June 2025).
  166. Elshire, R.J.; Glaubitz, J.C.; Sun, Q.; Poland, J.A.; Kawamoto, K.; Buckler, E.S.; Mitchell, S.E. A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species. PLoS ONE 2011, 6, e19379. [Google Scholar] [CrossRef]
  167. Dodds, K.G.; McEwan, J.C.; Brauning, R.; Anderson, R.M.; van Stijn, T.C.; Kristjánsson, T.; Clarke, S.M. Construction of relatedness matrices using genotyping-by-sequencing data. BMC Genom. 2015, 16, 1047. [Google Scholar] [CrossRef]
  168. AgResearch. DECONVQC; GitHub, Inc.: San Francisco, CA, USA, 2016; Available online: https://github.com/AgResearch/DECONVQC (accessed on 30 June 2025).
  169. Jacobs, J.; Clarke, S.; Faville, M.; Griffiths, A.; Cao, M.; Tan, R.; Van Stijn, T.; Anderson, R.; Ashby, R.; Rowe, S.; et al. Genotyping-by-sequencing applications in biology. In Proceedings of the Plant and Animal Genome XXV Conference, San Diego, CA, USA, 13–18 January 2017; Scherago International: Surfside, FL, USA, 2017. Abstract P0128. Available online: https://pag.confex.com/pag/xxv/meetingapp.cgi/Paper/24487 (accessed on 30 June 2025).
  170. Andrews, S. FastQC: A Quality Control Tool for High throughput Sequence Data, Version 0.10.1; Bioinformatics Group, Babraham Institute: Cambridge, UK, 2012; Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc (accessed on 30 June 2025).
  171. Morris, K.M.; Hindle, M.M.; Boitard, S.; Burt, D.W.; Danner, A.F.; Eory, L.; Forrest, H.L.; Gourichon, D.; Gros, J.; Hillier, L.W.; et al. The quail genome: Insights into social behaviour, seasonal biology and infectious disease response. BMC Biol. 2020, 18, 14. [Google Scholar] [CrossRef]
  172. Szpak, M. Ensembl 104 Has Been Released. Ensembl Blog. 2021. Available online: https://www.ensembl.info/2021/05/05/ensembl-104-has-been-released/ (accessed on 30 June 2025).
  173. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
  174. Martin, M. Cutadapt, Version 3.4; GitHub, Inc.: San Francisco, CA, USA, 2021. Available online: https://github.com/marcelm/cutadapt (accessed on 30 June 2025).
  175. Langmead, B. bowtie2: A Fast and Sensitive Gapped Read Aligner, Version 2.4.4; GitHub, Inc.: San Francisco, CA, USA, 2021. Available online: https://github.com/BenLangmead/bowtie2 (accessed on 30 June 2025).
  176. Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
  177. AgResearch. snpGBS; GitHub, Inc.: San Francisco, CA, USA, 2021; Available online: https://github.com/AgResearch/snpGBS (accessed on 30 June 2025).
  178. R Core Team. R-4; R Foundation for Statistical Computing: Vienna, Austria, 2020; Available online: https://cran.r-project.org/bin/windows/base/old/4.4.0/NEWS.R-4.4.0.html (accessed on 30 June 2025).
  179. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2018; Available online: https://www.r-project.org/ (accessed on 30 June 2025).
  180. Purcell, S.; Neale, B.; Todd-Brown, K.; Thomas, L.; Ferreira, M.A.; Bender, D.; Maller, J.; Sklar, P.; de Bakker, P.I.; Daly, M.J.; et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 2007, 81, 559–575. [Google Scholar] [CrossRef] [PubMed]
  181. Purcell, S. PLINK 1.9; Center for Human Genetic Research, Massachusetts General Hospital, and the Broad Institute of Harvard & MIT: Boston, MA, USA, 2017; Available online: https://zzz.bwh.harvard.edu/plink/index.shtml (accessed on 30 June 2025).
  182. DataCamp. Principal Component Analysis in R Tutorial; DataCamp, Inc.: New York, NY, USA, 2023; Available online: https://www.datacamp.com/tutorial/pca-analysis-r (accessed on 30 June 2025).
  183. Wickham, H. ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2009; ISBN 978-0-387-98141-3. [Google Scholar] [CrossRef]
  184. GitHub. ggplot2. tidyverse; GitHub, Inc.: San Francisco, CA, USA, 2023; Available online: https://github.com/tidyverse/ggplot2 (accessed on 30 June 2025).
  185. GitHub. qqman; GitHub, Inc.: San Francisco, CA, USA, 2025; Available online: https://github.com/qqman (accessed on 30 June 2025).
  186. Turner, S.D. qqman: An R package for visualizing GWAS results using Q-Q and Manhattan plots. J. Open Source Softw. 2018, 3, 731. [Google Scholar] [CrossRef]
Figure 1. Principal component analysis (PCA) for the F2 quail resource population structure: (a) PCA performed in the plane of the first (PC1; x-axis) and second (PC2; y-axis) components; (b) PCA performed in the plane of PC1 (x-axis) and the third (PC3; y-axis) components. (c) PCA performed in the plane of PC2 (x-axis) and PC3 (y-axis). Individuals from different groups are marked with different colors.
Figure 1. Principal component analysis (PCA) for the F2 quail resource population structure: (a) PCA performed in the plane of the first (PC1; x-axis) and second (PC2; y-axis) components; (b) PCA performed in the plane of PC1 (x-axis) and the third (PC3; y-axis) components. (c) PCA performed in the plane of PC2 (x-axis) and PC3 (y-axis). Individuals from different groups are marked with different colors.
Ijms 26 08243 g001
Figure 2. Manhattan plots based on the GWAS data for the studied body weight (BW) parameters in the F2 resource population of quails at the ages of 1 (a), 14 (b), 21 (c), 28 (d), 35 (e), 42 (f), 49 (g) and 56 (h) days. Manhattan plots show distribution of single nucleotide polymorphisms (SNPs) in quail chromosomes according to the significance level (−log10 (p)) based on the expected Bonferronni probability value of p < 6.72 × 10−7 (lower dotted line) and p < 1.05 × 10−8 (upper solid line) for the respective BW traits. SNP dots are color-coded to visualize significant values. SNPs that have significant associations with the studied traits at the level of established reliability values from p < 6.72 × 10−7 to p > 1.05 × 10−8 are highlighted in green; SNPs that are significantly associated with the traits at the level of p < 1.05 × 10−8 are highlighted in red. The diagram along the x-axis shows the density of established SNPs on individual chromosomes.
Figure 2. Manhattan plots based on the GWAS data for the studied body weight (BW) parameters in the F2 resource population of quails at the ages of 1 (a), 14 (b), 21 (c), 28 (d), 35 (e), 42 (f), 49 (g) and 56 (h) days. Manhattan plots show distribution of single nucleotide polymorphisms (SNPs) in quail chromosomes according to the significance level (−log10 (p)) based on the expected Bonferronni probability value of p < 6.72 × 10−7 (lower dotted line) and p < 1.05 × 10−8 (upper solid line) for the respective BW traits. SNP dots are color-coded to visualize significant values. SNPs that have significant associations with the studied traits at the level of established reliability values from p < 6.72 × 10−7 to p > 1.05 × 10−8 are highlighted in green; SNPs that are significantly associated with the traits at the level of p < 1.05 × 10−8 are highlighted in red. The diagram along the x-axis shows the density of established SNPs on individual chromosomes.
Ijms 26 08243 g002aIjms 26 08243 g002b
Figure 3. Associations of candidate genes in SNP positions with body weight (BW) of quails at different age periods. x-axis: BW indicators at the age of 1, 14, 21, 28, 35, 49 and 56 days; y-axis: SNPs and genes in which the SNPs are localized.
Figure 3. Associations of candidate genes in SNP positions with body weight (BW) of quails at different age periods. x-axis: BW indicators at the age of 1, 14, 21, 28, 35, 49 and 56 days; y-axis: SNPs and genes in which the SNPs are localized.
Ijms 26 08243 g003
Figure 4. Dynamics of body weight (BW) in F2 quails of the resource population depending on the genotype for the ADAM33 gene at the following loci (chromosome:position): (a) 4:81160836, (b) 4:81160722, (c) 4:81171150, (d) 4:81160897 and (e) 4:81160888. Along the x-axis is BW of quails at the age of 1, 7, 14, 21, 28, 35, 42, 49 and 56 days, and along the y-axis is the BW indicator value (in g). BW1, BW7, BW14, BW21, BW28, BW35, BW42, BW49 and BW56 conform to BW in birds aged 1, 7, 14, 21, 28, 35, 42, 49 and 56 days, respectively. Two-letter superscripts (ab, bc, etc.) mean significant differences (at p < 0.05) between the following quail groups (for each locus): a, quails with the CC genotype; b, quails with the CT genotype; c, quails with the TT genotype; d, quails with the GG genotype; e, quails with the GT genotype.
Figure 4. Dynamics of body weight (BW) in F2 quails of the resource population depending on the genotype for the ADAM33 gene at the following loci (chromosome:position): (a) 4:81160836, (b) 4:81160722, (c) 4:81171150, (d) 4:81160897 and (e) 4:81160888. Along the x-axis is BW of quails at the age of 1, 7, 14, 21, 28, 35, 42, 49 and 56 days, and along the y-axis is the BW indicator value (in g). BW1, BW7, BW14, BW21, BW28, BW35, BW42, BW49 and BW56 conform to BW in birds aged 1, 7, 14, 21, 28, 35, 42, 49 and 56 days, respectively. Two-letter superscripts (ab, bc, etc.) mean significant differences (at p < 0.05) between the following quail groups (for each locus): a, quails with the CC genotype; b, quails with the CT genotype; c, quails with the TT genotype; d, quails with the GG genotype; e, quails with the GT genotype.
Ijms 26 08243 g004
Figure 5. Visualization of the functional annotation of 394 candidate genes for gene ontology (GO) terms according to three main GO aspects: (a) biological process, (b) cellular component, and (c) molecular function. x-axis, number of PCGs per GO term.
Figure 5. Visualization of the functional annotation of 394 candidate genes for gene ontology (GO) terms according to three main GO aspects: (a) biological process, (b) cellular component, and (c) molecular function. x-axis, number of PCGs per GO term.
Ijms 26 08243 g005
Table 1. Descriptive statistics for body weight (BW) indices (in g) in quails of the F2 resource population and the original parent breeds.
Table 1. Descriptive statistics for body weight (BW) indices (in g) in quails of the F2 resource population and the original parent breeds.
Traits 1F2 (n = 240)Japanese Breed (n = 30)Texas White Breed (n = 20)
MeanSD 2CV 3, %MeanSDCV, %MeanSDCV, %
BW18.80.910.58.50.44.29.3 0.88.6
BW731.76.321.728.93.210.140.03.79.4
BW1477.412.117.469.37.49.693.24.24.5
BW21116.419.616.8103.818.417.7157.825.716.3
BW28158.522.113.9125.524.819.8204.932.115.6
BW35191.725.213.2164.522.413.6255.729.311.5
BW42218.929.613.5174.518.110.4275.637.313.5
BW49241.430.112.5205.832.015.5301.041.213.7
BW56249.333.213.3
1 BW1, BW7, BW14, BW21, BW28, BW35, BW42, BW49 and BW56 conform to BW in birds aged 1, 7, 14, 21, 28, 35, 42, 49 and 56 days, respectively. 2 SD, standard deviation. 3 CV, coefficient of variation.
Table 2. Heritability, genetic and residual variance indices for body weight of the F2 resource population quails of different ages.
Table 2. Heritability, genetic and residual variance indices for body weight of the F2 resource population quails of different ages.
Traits 1Genetic Variance (VarA)Residual Variance (VarE)Heritability (h2)
BW10.3950.3040.565
BW713.4924.690.353
BW1448.22106.20.312
BW2187.44226.40.279
BW28122.9310.40.284
BW35207.8500.40.293
BW42234.9577.30.289
BW49246.2627.30.282
BW56281.0732.00.277
1 BW1, BW7, BW14, BW21, BW28, BW35, BW42, BW49 and BW56 conform to BW in birds aged 1, 7, 14, 21, 28, 35, 42, 49 and 56 days, respectively.
Table 3. Genetic correlations between body weight (BW) indicators in quails of the F2 resource population.
Table 3. Genetic correlations between body weight (BW) indicators in quails of the F2 resource population.
Traits 1BW1BW7BW14BW21BW28BW35BW42BW49BW56
BW1
BW70.039
BW140.0740.518
BW210.0490.4270.680
BW280.0260.3860.6590.665
BW350.0260.3360.5700.6280.702
BW420.0080.3140.5420.5430.6680.711
BW49−0.0020.3140.4870.4940.5800.6290.744
BW560.0090.3080.4280.4360.4920.5080.6010.751
1 BW1, BW7, BW14, BW21, BW28, BW35, BW42, BW49 and BW56 conform to BW in birds aged 1, 7, 14, 21, 28, 35, 42, 49 and 56 days, respectively.
Table 4. Distribution of significant single nucleotide polymorphisms (SNPs; at p < 6.72 × 10−7) associated with body weight (BW) on chromosomes in F2 quails of the resource population.
Table 4. Distribution of significant single nucleotide polymorphisms (SNPs; at p < 6.72 × 10−7) associated with body weight (BW) on chromosomes in F2 quails of the resource population.
Traits 1No. of SNPsChromosomes
BW13CJA5, CJA25
BW148CJA4, CJA7, CJA26, CJA28
BW218CJA4, CJA7, CJA10
BW2823CJA2, CJA4, CJA7, CJA8, CJA10, CJA11, CJA14, CJA15, CJA22
BW3515CJA1, CJA2, CJA3, CJA4, CJA15, CJA24
BW4250CJA1, CJA3-CJA6, CJA8, CJA10, CJA12, CJA15, CJA17, CJA18, CJA20, CJA22, CJA24, CJA26
BW4931CJA1, CJA5, CJA8, CJA12, CJA17, CJA20, CJA22, CJA23, CJA26
BW5642CJA1-CJA4, CJA8, CJA14, CJA15, CJA18, CJA20, CJA25, CJA26
1 BW1, BW7, BW14, BW21, BW28, BW35, BW42, BW49 and BW56 conform to BW in birds aged 1, 7, 14, 21, 28, 35, 42, 49 and 56 days, respectively.
Table 5. List of significant single nucleotide polymorphisms (SNPs; at p < 6.72 × 10−7) associated with body weight (BW) indices in F2 quails of the resource population in two or more age periods and prioritized candidate genes (PCGs).
Table 5. List of significant single nucleotide polymorphisms (SNPs; at p < 6.72 × 10−7) associated with body weight (BW) indices in F2 quails of the resource population in two or more age periods and prioritized candidate genes (PCGs).
ChromosomeSNP Position (in bp)Traits 1PCG (at SNP Position)
CJA1151,007,527BW42, BW49ITM2B
CJA1151,084,995BW42, BW49
CJA334,595,032BW35, BW42SLC35F3
CJA481,160,722BW14, BW21, BW28, BW35, BW42ADAM33
CJA481,160,836BW14, BW21, BW28ADAM33
CJA481,160,888BW14, BW21, BW28, BW35ADAM33
CJA481,160,897BW14, BW21, BW28, BW35ADAM33
CJA481,171,150BW14, BW21, BW28, BW35ADAM33
CJA540,981,270BW42, BW49UNC79
CJA824,869,812BW28, BW42
CJA825,524,051BW42, BW49LEPR
CJA825,548,415BW42, BW49
CJA1010,505,840BW21, BW28
CJA129,300,025BW42, BW49RPP14
CJA129,302,400BW42, BW49
CJA155,904,595BW35, BW42MVK
CJA1511,552,880BW42, BW56
CJA1511,552,881BW42, BW49, BW56
CJA1511,622,693BW49, BW56
CJA172,261,513BW42, BW49ASTN2
CJA204,345,582BW49, BW56
CJA243,829,762BW35, BW42ZBTB16
CJA2668,898BW49, BW56
CJA26243,899BW42, BW49, BW56
CJA26243,912BW42, BW49, BW56
1 BW1, BW7, BW14, BW21, BW28, BW35, BW42, BW49 and BW56 conform to BW in birds aged 1, 7, 14, 21, 28, 35, 42, 49 and 56 days, respectively.
Table 6. Prioritized candidate genes (PCGs) colocalized with more than one single nucleotide polymorphism (SNP) and associated with body weight (BW) in F2 quails of the resource population.
Table 6. Prioritized candidate genes (PCGs) colocalized with more than one single nucleotide polymorphism (SNP) and associated with body weight (BW) in F2 quails of the resource population.
ChromosomePCGSNP Position (in bp)Traits 1p-Value
CJA2MARCHF652,281,470BW355.35 × 10−7
52,281,495BW355.35 × 10−7
52,281,496BW355.35 × 10−7
52,281,497BW355.35 × 10−7
EGFR73,896,881BW562.12 × 10−11
73,896,952BW561.32 × 10−9
CJA4ADGRL343,060,269BW286.18 × 10−7
43,060,333BW286.18 × 10−7
43,060,345BW286.18 × 10−7
ADAM3381,160,722BW149.46 × 10−8
BW211.59 × 10−8
BW281.36 × 10−8
BW358.27 × 10−8
BW427.96 × 10−8
81,160,836BW144.46 × 10−8
BW213.39 × 10−7
BW284.27 × 10−8
81,160,888BW141.20 × 10−7
BW215.73 × 10−8
BW289.55 × 10−9
BW352.64 × 10−7
81,160,897BW141.20 × 10−7
BW215.73 × 10−8
BW289.55 × 10−9
BW352.64 × 10−7
81,171,150BW146.12 × 10−8
BW211.35 × 10−7
BW288.41 × 10−8
BW354.58 × 10−7
CJA5NPC234,403,827BW428.89 × 10−8
34,403,875BW428.89 × 10−8
LTBP234,409,135BW421.70 × 10−7
34,409,184BW423.45 × 10−7
34,411,616BW421.70 × 10−7
34,412,981BW423.07 × 10−7
34,417,379BW422.75 × 10−7
ZC2HC1C34,609,626BW422.72 × 10−7
34,610,313BW426.96 × 10−8
CJA7SATB29,470,112BW283.91 × 10−7
9,470,188BW281.30 × 10−7
9,470,245BW281.30 × 10−7
CJA17ASTN22,218,419BW495.83 × 10−8
2,261,513BW426.15 × 10−8
BW492.61 × 10−8
CJA24ZBTB163,829,762BW351.05 × 10−8
BW422.36 × 10−7
3,847,375BW355.43 × 10−7
CJA25ADAR1,503,153BW12.82 × 10−7
1,503,237BW13.14 × 10−9
CJA26LGR6798,927BW493.76 × 10−7
850,193BW492.94 × 10−7
1 BW1, BW7, BW14, BW21, BW28, BW35, BW42, BW49 and BW56 conform to BW in birds aged 1, 7, 14, 21, 28, 35, 42, 49 and 56 days, respectively.
Table 7. Body weight (BW) values (mean ± standard error of the mean) in F2 quails of the resource population depending on the genotype at five single nucleotide polymorphism (SNP) loci (chromosome:position) of the ADAM33 gene.
Table 7. Body weight (BW) values (mean ± standard error of the mean) in F2 quails of the resource population depending on the genotype at five single nucleotide polymorphism (SNP) loci (chromosome:position) of the ADAM33 gene.
SNP Geno-typen 1Traits 2
BW1BW7BW14BW21BW28BW35BW42BW49BW56
4:81160722
CC139.2 ± 0.239.7 ± 1.291.9 ± 1.0
ab, ac
167.0 ± 3.8
ab, ac
228.8 ± 5.5
ab, ac
249.0 ± 5.2
ab, ac
296.2 ± 9.7
ab, ac
302.8 ± 9.7328.0 ± 8.2
ab, ac
CT478.8 ± 0.129.4 ± 1.078.5 ± 1.8
ab, bc
127.3 ± 3.7
bc
169.7 ± 4.1
ab, bc
206.4 ± 4.4
ab, bc
231.5 ± 4.9
ab, bc
249.4 ± 5.4262.4 ± 5.7
ab
TT1738.5 ± 0.129.1 ± 0.569.5 ± 0.9
ac
114.5 ± 1.5
ac
153.6 ± 1.9
ac
188.0 ± 2.1
ac
214.1 ± 2.4
ac
236.8 ± 2.2246.8 ± 2.4
ac
4:81160836
GG119.0 ± 0.242.0 ± 1.492.7 ± 1.4
de, cd
169.3 ± 5.5
de, cd
237.3 ± 5.9
de, cd
252.0 ± 5.8
de, cd
290.7 ± 10.4
de, cd
292.3 ± 10.9
de, cd
294.8 ± 8.9
cd
GT508.7 ± 0.129.4 ± 1.078.7 ± 1.8
ce, de
127.3 ± 3.8
ce, de
169.5 ± 4.0
ce, de
206.4 ± 4.3
ce, de
233.6 ± 5.0
ce, de
253.1 ± 5.5
ce
265.1 ± 5.8
ce, de
TT1728.5 ± 0.129.3 ± 0.569.5 ± 0.9
cd, ce
115.1 ± 1.5
cd, ce
154.4 ± 1.9
cd, ce
188.6 ± 2.2
cd, ce
214.6 ± 2.4
cd, ce
237.9 ± 2.5
cd
246.4 ± 2.3
cd, ce
4:81160888
CC1718.5 ± 0.129.2 ± 1.469.4 ± 0.9
ab, ac
114.9 ± 1.5
ab, ac
154.1 ± 1.9
ab, ac
188.3 ± 2.1
ab, ac
214.2 ± 2.4
ab, ac
237.6 ± 2.5
ab, ac
246.7 ± 2.5
ab, ac
TC518.8 ± 0.129.7 ± 1.079.1 ± 1.8
ab, bc
128.5 ± 3.8
ab, bc
170.7 ± 4.0
ab, bc
208.1 ± 4.4
ab, bc
235.3 ± 5.1
ab, bc
254.4 ± 5.5
ab, bc
266.1 ± 5.4
ab
TT119.0 ± 0.242.0 ± 0.292.7 ± 1.4
ac, bc
169.3 ± 5.5
ac, bc
237.3 ± 5.9
ac, bc
252.0 ± 5.8
ac, bc
290.7 ± 10.4
ac, bc
292.3 ± 10.9
ac, bc
294.8 ± 8.9
ac
4:81160897
CC119.0 ± 0.242.0 ± 1.492.7 ± 1.4
ab, ac
169.3 ± 5.5
ab, ac
237.3 ± 5.9
ab, ac
252.0 ± 5.8
ab, ac
290.7 ± 10.4
ab, ac
292.3 ± 10.9
ab, ac
294.8 ± 8.9
ac
CT518.8 ± 0.129.7 ± 1.079.1 ± 1.8
ab, bc
128.5 ± 3.8
ab, bc
170.7 ± 4.0
ab, bc
208.1 ± 4.4
ab, bc
235.3 ± 5.1
ab, bc
254.4 ± 5.5
ab, bc
266.1 ± 5.4
bc
TT1718.5 ± 0.129.2 ± 0.569.4 ± 0.9
ac, bc
114.9 ± 1.5
ac, bc
154.1 ± 1.9
ac, bc
188.3 ± 2.1
ac, bc
214.2 ± 2.4
ac, bc
237.6 ± 2.5
ac, bc
246.7 ± 2.5
ac, bc
4:81171150
CC1748.5 ± 0.1
ac
29.2 ± 0.569.5 ± 0.9
ab, ac
115.2 ± 1.5
ab, ac
154.8 ± 1.9
ab, ac
189.0 ± 2.1
ab, ac
214.8 ± 2.4
ab, ac
238.4 ± 2.5
ac
247.6 ± 2.5
ab, ac
TC458.7 ± 0.129.0 ± 1.077.9 ± 1.8
ab, bc
127.4 ± 4.0
ab, bc
169.1 ± 4.4
ab, bc
205.0 ± ±4.4
ab, bc
232.1 ± 5.3
ab, bc
249.7 ± 5.5
bc
267.0 ± 5.9
ab, bc
TT149.3 ± 0.2
ac
41.8 ± 1.294.3 ± 1.4
ac, bc
164.8 ± 4.6
ac, bc
221.5 ± 6.2
ac, bc
251.8 ± 5.5
ac, bc
288.3 ± 10.8
ac, bc
300.3 ± 10.0
ac, bc
319.1 ± 8.7
ac, bc
1 n, number of birds; 2 BW1, BW7, BW14, BW21, BW28, BW35, BW42, BW49 and BW56 conform to BW in birds aged 1, 7, 14, 21, 28, 35, 42, 49 and 56 days, respectively. Two-letter superscripts (ab, bc, etc.) mean significant differences (at p < 0.05) between the following quail groups (for each locus): a, quails with the CC genotype; b, quails with the CT genotype; c, quails with the TT genotype; d, quails with the GG genotype; e, quails with the GT genotype.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Volkova, N.A.; Romanov, M.N.; German, N.Y.; Larionova, P.V.; Vetokh, A.N.; Volkova, L.A.; Sermyagin, A.A.; Shakhin, A.V.; Griffin, D.K.; Sölkner, J.; et al. Genome-Wide Association Studies in Japanese Quails of the F2 Resource Population Elucidate Molecular Markers and Candidate Genes for Body Weight Parameters. Int. J. Mol. Sci. 2025, 26, 8243. https://doi.org/10.3390/ijms26178243

AMA Style

Volkova NA, Romanov MN, German NY, Larionova PV, Vetokh AN, Volkova LA, Sermyagin AA, Shakhin AV, Griffin DK, Sölkner J, et al. Genome-Wide Association Studies in Japanese Quails of the F2 Resource Population Elucidate Molecular Markers and Candidate Genes for Body Weight Parameters. International Journal of Molecular Sciences. 2025; 26(17):8243. https://doi.org/10.3390/ijms26178243

Chicago/Turabian Style

Volkova, Natalia A., Michael N. Romanov, Nadezhda Yu. German, Polina V. Larionova, Anastasia N. Vetokh, Ludmila A. Volkova, Alexander A. Sermyagin, Alexey V. Shakhin, Darren K. Griffin, Johann Sölkner, and et al. 2025. "Genome-Wide Association Studies in Japanese Quails of the F2 Resource Population Elucidate Molecular Markers and Candidate Genes for Body Weight Parameters" International Journal of Molecular Sciences 26, no. 17: 8243. https://doi.org/10.3390/ijms26178243

APA Style

Volkova, N. A., Romanov, M. N., German, N. Y., Larionova, P. V., Vetokh, A. N., Volkova, L. A., Sermyagin, A. A., Shakhin, A. V., Griffin, D. K., Sölkner, J., McEwan, J., Brauning, R., & Zinovieva, N. A. (2025). Genome-Wide Association Studies in Japanese Quails of the F2 Resource Population Elucidate Molecular Markers and Candidate Genes for Body Weight Parameters. International Journal of Molecular Sciences, 26(17), 8243. https://doi.org/10.3390/ijms26178243

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop