Genetic Factors Linking Nucleolar Stress with R2 Retrotransposon Expression in Drosophila melanogaster
Abstract
1. Introduction
2. Results
2.1. R2 Expression in Wild Type Ovaries—A Complex Negative Control
2.2. Udd Mutations Affecting R2 Expression—A Clear Positive Control
2.3. R2 Expression in Tissues Depleted for Nopp140
2.4. Over-Expression of Nopp140-RGG but Not Nopp140-True Induces R2 Expression
2.5. Testing R2 Expression in Minute Genetic Backgrounds
3. Discussion
3.1. An Overview
3.2. R2 Expression in Wild Type Ovaries
3.3. Does a Compensation Mechanism Exist to Activate R2-Inserted rDNA Genes?
3.4. Developing a Hypothesis for R2 Induction
4. Materials and Methods
4.1. Fly Stocks
4.2. HCRTM RNA-FISH Hybridization
4.3. BrUTP Labeling
4.4. RT-qPCR
4.5. Microscopy and Ribosome Counts
4.6. Western Blotting
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dawid, I.B.; Rebbert, M.L. Nucleotide sequences at the boundaries between gene and insertion regions in the rDNA of Drosophila melanogaster. Nucl. Acids Res. 1981, 9, 5011–5020. [Google Scholar] [CrossRef] [PubMed]
- Eickbush, T.H.; Eickbush, D.G. Integration, regulation, and long-term stability of R2 retrotransposons. Microbiol. Spectr. 2014, 3, MDNA3-0011-2014. [Google Scholar] [CrossRef]
- Long, E.O.; Dawid, I.B. Expression of ribosomal DNA insertions in Drosophila melanogaster. Cell 1979, 18, 1185–1196. [Google Scholar] [CrossRef] [PubMed]
- Roiha, H.; Miller, J.R.; Woods, L.C.; Glover, D.M. Arrangements and rearrangements of sequences flanking the two types of rDNA insertion in D. melanogaster. Nature 1981, 290, 749–753. [Google Scholar] [CrossRef]
- Ye, J.; Eickbush, T.H. Chromatin structure and transcription of the R1- and R2-inserted rRNA genes of Drosophila melanogaster. Mol. Cell Biol. 2006, 26, 8781–8790. [Google Scholar] [CrossRef]
- Fefelova, E.A.; Pleshakova, I.M.; Mikhaleva, E.A.; Pirogov, S.A.; Poltorachenko, V.A.; Abramov, Y.A.; Romashin, D.D.; Shatskikh, A.S.; Blokh, R.S.; Gvozdev, V.A.; et al. Impaired function of rDNA transcription initiation machinery leads to derepression of ribosomal genes with insertions of R2 retrotransposon. Nucl. Acids Res. 2022, 50, 867–884. [Google Scholar] [CrossRef]
- Eickbush, D.G.; Eickbush, T.H. R2 retrotransposons encode a self-cleaving ribozyme for processing from the rDNA gene locus of Drosophila melanogaster. Mol. Cell Biol. 2010, 30, 3142–3150. [Google Scholar] [CrossRef]
- Zhang, Q.; Shalaby, N.A.; Buszczak, M. Changes in rDNA transcription influence proliferation and cell fate within a stem cell lineage. Science 2014, 343, 298–301. [Google Scholar] [CrossRef]
- Daiβ, J.L.; Griesenbeck, J.; Tschochner, H.; Engel, C. Synthesis of the ribosomal RNA precursor in human cells: Mechanisms, factors and regulation. Biol. Chem. 2023, 404, 1003–1023. [Google Scholar] [CrossRef]
- He, F.; James, A.; Raje, H.; Ghaffari, H.; DiMario, P. Deletion of Drosophila Nopp140 induces subcellular ribosomopathies. Chromosoma 2015, 124, 191–208. [Google Scholar] [CrossRef]
- Baral, S.S.; DiMario, P.J. The Nopp140 gene in Drosophila melanogaster displays length polymorphisms in its large repetitive second exon. Mol. Genet. Genom. 2019, 294, 1073–1083. [Google Scholar] [CrossRef] [PubMed]
- Waggener, J.M.; DiMario, P.J. Two splice variants of Nopp140 in Drosophila melanogaster. Mol. Biol. Cell 2002, 13, 362–381. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Meier, U.T. Comparison of the rat nucleolar protein Nopp140 with its yeast homolog SRP40. J. Biol. Chem. 1996, 271, 19376–19384. Available online: https://pubmed.ncbi.nlm.nih.gov/8702624/ (accessed on 5 June 2024). [CrossRef] [PubMed]
- Ginisty, H.; Amalric, F.; Bouvet, P. Nucleolin functions in the first step of ribosomal RNA processing. EMBO J. 1998, 17, 1476–1486. [Google Scholar] [CrossRef]
- Chowdhury, M.N.; Jin, H. The RGG motif proteins: Interactions, functions, and regulations. WIREs RNA 2023, 14, e1748. [Google Scholar] [CrossRef]
- Ozdilek, B.A.; Thompson, V.F.; Ahmed, N.S.; White, C.I.; Batey, R.T.; Schwartz, J.C. Intrinsically disordered RGG/RG domains mediate degenerate specificity in RNA binding. Nucl. Acids Res. 2017, 45, 7984–7996. [Google Scholar] [CrossRef]
- He, F.; DiMario, P.J. Chapter 11: Structure and Function of Nopp140 and Treacle. In The Nucleolus. Protein Reviews; Olson, M., Ed.; Springer: New York, NY, USA, 2011; Volume 15. [Google Scholar] [CrossRef]
- James, A.; Wang, Y.; Raje, H.; Rosby, R.; DiMario, P.J. Nucleolar stress with and without p53. Nucleus 2014, 5, 1–25. [Google Scholar] [CrossRef]
- Lafita-Navarro, M.C.; Conacci-Sorrell, M. Nucleolar stress: From development to cancer. Semin. Cell Dev. Biol. 2023, 136, 64–74. [Google Scholar] [CrossRef]
- Raje, H.S.; Lieux, M.E.; DiMario, P.J. R1 retrotransposons in the nucleolar organizers of Drosophila melanogaster are transcribed by RNA polymerase I upon heat shock. Transcription 2018, 9, 273–285. [Google Scholar] [CrossRef]
- King, R.C. Ovarian Development in Drosophila melanogaster; Academic Press: New York, NY, USA, 1970. [Google Scholar]
- Iwasaki, Y.W.; Murano, K.; Ishizu, H.; Shibuya, A.; Iyoda, Y.; Siomi, M.; Siomi, H.; Saito, K. Piwi modulates chromatin accessibility by regulating multiple factors including histone H1 to repress transposons. Mol. Cell 2016, 63, 408–419. [Google Scholar] [CrossRef]
- Khurana, J.S.; Theurkauf, W. piRNAs, transposon silencing, and Drosophila germline development. J. Cell Biol. 2010, 191, 905–913. [Google Scholar] [CrossRef] [PubMed]
- Dej, K.J.; Spradling, A.C. The endocycle controls nurse cell polytene chromosome structure during Drosophila oogenesis. Development 1999, 126, 293–303. [Google Scholar] [CrossRef] [PubMed]
- Hammond, M.P.; Laird, C.D. Chromosome structure and DNA replication in nurse and follicle cells of Drosophila melanogaster. Chromosoma 1985, 91, 267–278. [Google Scholar] [CrossRef]
- Berg, C.; Sieber, M.; Sun, J. Finishing the egg. Genetics 2024, 226, iyad183. [Google Scholar] [CrossRef]
- Mahowald, A.P.; Kambysellis, M.P. Oogenesis. In The Genetics and Biology of Drosophila; Ashburner, M., Wright, T.R.F., Eds.; Academic Press: London, UK, 1980; Volume 2c, pp. 141–224. [Google Scholar]
- Dapples, C.C.; King, R.C. The development of the nucleolus of the ovarian nurse cell of Drosophila melanogaster. Z. Zellforsch. 1970, 103, 34–47. [Google Scholar] [CrossRef]
- Chen, H.-K.; Pai, C.-Y.; Huang, J.-Y.; Yeh, N.-H. Human Nopp140, which interacts with RNA Polymerase I: Implications for rRNA gene transcription and nucleolar structural organization. Mol. Cell Biol. 1999, 19, 8536–8546. [Google Scholar] [CrossRef]
- Miau, L.-H.; Chang, C.-J.; Tsai, W.-H.; Lee, S.-C. Identification and characterization of a nucleolar phosphoprotein, Nopp140, as a transcription factor. Mol. Cell Biol. 1997, 17, 230–239. [Google Scholar] [CrossRef]
- Tsai, Y.-T.; Lin, C.-I.; Chen, H.-K.; Lee, K.-M.; Hsu, C.-Y.; Yang, S.-J.; Yeh, N.-H. Chromatin tethering effects of hNopp140 are involved in the spatial organization of nucleolus and the rRNA gene transcription. J. Biomed. Sci. 2008, 15, 471–486. [Google Scholar] [CrossRef]
- Marygold, S.J.; Roote, J.; Reuter, G.; Lambertsson, A.; Ashburner, M.; Millburn, G.H.; Harrison, P.M.; Yu, Z.; Kenmochi, N.; Kaufman, T.C.; et al. The ribosomal protein genes and minute loci of Drosophila melanogaster. Genome Biol. 2007, 8, R216. [Google Scholar] [CrossRef]
- Nelson, J.O.; Slicko, A.; Yamashita, Y.M. The retrotransposon R2 maintains Drosophila ribosomal DNA repeats. Proc. Natl. Acad. Sci. USA 2023, 120, e2221613120. [Google Scholar] [CrossRef]
- Khipple, P.; King, R.C. Oogenesis in the female sterile(1)1304 mutant of Drosophila melanogaster Meigen (Diptera: Drosophilidae). Int. J. Insect Morphol. Embryol. 1976, 5, 127–135. [Google Scholar] [CrossRef]
- Jankovics, F.; Bence, M.; Sinka, R.; Faragó, A.; Bodai, L.; Pettkó-Szandtner, A.; Ibrahim, K.; Takács, Z.; Szarka-Kovács, A.B.; Erdélyi, M. Drosophila small ovary is required for transposon silencing and heterochromatin organization, and ensures germline stem cell maintenance and differentiation. Development 2018, 145, dev170639. [Google Scholar] [CrossRef] [PubMed]
- Chong, P.A.; Vernon, R.M.; Forman-Kay, J.D. RGG/RG motif regions in RNA binding and phase separation. J. Mol. Biol. 2018, 430, 4650–4665. [Google Scholar] [CrossRef] [PubMed]
- Prasanth, K.V.; Rajendra, T.K.; Lal, A.K.; Lakhotia, S.C. Omega speckles—A novel class of nuclear speckles containing hnRNPs associated with noncoding hsr-omega RNA in Drosophila. J. Cell Sci. 2000, 113, 2485–2497. [Google Scholar] [CrossRef]
- Cui, Z.; DiMario, P.J. RNAi knockdown of Nopp140 induces Minute-like phenotypes in Drosophila. Mol. Biol. Cell 2007, 18, 2175–2191. Available online: https://www.molbiolcell.org/doi/10.1091/mbc.e07-01-0074 (accessed on 5 June 2024). [CrossRef]
- Jenkins, V.K.; Larkin, A.; Thurmond, J. The FlyBase Consortium Using FlyBase: A Database of Drosophila Genes Genetics. In Drosophila: Methods in Molecular Biology; Dahmann, C., Ed.; Humana: New York, NY, USA, 2022; Volume 2540, pp. 1–34. [Google Scholar] [CrossRef]
- Choi, H.M.T.; Schwarzkopf, M.; Fornace, M.E.; Acharya, A.; Artavanis, G.; Stegmaier, J.; Cunha, A.; Pierce, N.A. Third-generation in situ hybridization chain reaction: Multiplexed, quantitative, sensitive, versatile, robust. Development 2018, 145, dev165753. [Google Scholar] [CrossRef]
- de Cuevas, M.; Spradling, A.C. Morphogenesis of the Drosophila fusome and its implications for oocyte specification. Development 1988, 125, 2781–2789. [Google Scholar] [CrossRef]
- DiMario, P.J.; Mahowald, A.P. Female sterile (1) yolkless: A recessive female sterile mutation in Drosophila melanogaster with depressed numbers of coated pits and coated vesicles within the developing oocytes. J. Cell Biol. 1987, 105, 199–206. [Google Scholar] [CrossRef]









| X Chromosome Pairs | a | b | c | d | e | f | g | h | i | j | k |
|---|---|---|---|---|---|---|---|---|---|---|---|
| a | w1118 | ||||||||||
| b | RpS3/+ | RpS3/TM2 | |||||||||
| c | TM2/+ | ||||||||||
| d | RpL38/+ | RpL38/CyO | |||||||||
| e | |||||||||||
| f | udd0683-G4/+ | udd0683-G4/udd0683-G4 | udd0683-G4/CyO | udd0683-G4/uddNull | udd0683-G4/CyO-GFP | ||||||
| g | CyO/+ | ||||||||||
| h | uddNull/+ | uddNull/CyO | uddNull/CyO-GFP | ||||||||
| i | CyO-GFP/+ | RpL14/TM2 | |||||||||
| j | KO121/+ | KO121/TM3-GFP |
| Gene | Primer Sequences (5′-3′) | Product Length (bps) |
|---|---|---|
| GAPDH-Forward | AATTCCGATCTTCGACATGG | 91 |
| GAPDH-Reverse | GAAAAAGCGGCAGTCGTAAT | |
| Tubulin-Forward | TGTCGCGTGTGAAACACTTC | 96 |
| Tubulin-Reverse | AGCAGGCGTTTCCAATCTG | |
| Nopp140-Exon 1-Forward | TTTTGTGGGACAAGCGGCTA | 154 |
| Nopp140-Exon 1-Reverse | TCTGCTGGAAAACCTTGGCT | |
| R2-Forward | AATAGATACGACAGACCGGACATAC | 186 |
| R2-Reverse | CATAACCTGGACGCTAATGATATGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pandey, S.; Nguyen, A.T.; Maricle, A.K.; DiMario, P.J. Genetic Factors Linking Nucleolar Stress with R2 Retrotransposon Expression in Drosophila melanogaster. Int. J. Mol. Sci. 2025, 26, 5480. https://doi.org/10.3390/ijms26125480
Pandey S, Nguyen AT, Maricle AK, DiMario PJ. Genetic Factors Linking Nucleolar Stress with R2 Retrotransposon Expression in Drosophila melanogaster. International Journal of Molecular Sciences. 2025; 26(12):5480. https://doi.org/10.3390/ijms26125480
Chicago/Turabian StylePandey, Shova, An Tri Nguyen, Audrey K. Maricle, and Patrick J. DiMario. 2025. "Genetic Factors Linking Nucleolar Stress with R2 Retrotransposon Expression in Drosophila melanogaster" International Journal of Molecular Sciences 26, no. 12: 5480. https://doi.org/10.3390/ijms26125480
APA StylePandey, S., Nguyen, A. T., Maricle, A. K., & DiMario, P. J. (2025). Genetic Factors Linking Nucleolar Stress with R2 Retrotransposon Expression in Drosophila melanogaster. International Journal of Molecular Sciences, 26(12), 5480. https://doi.org/10.3390/ijms26125480

