CRISPR/Cas9-Based Modeling of JAK2 V617F Mutation in K562 Cells Reveals Enhanced Proliferation and Sensitivity to Therapeutic Agents
Abstract
1. Introduction
2. Results
2.1. Generation and Characterization of K562 Cell Lines Expressing Wild Type and Mutated JAK2 Cells
2.2. JAK2 Gene Expression and Cell Proliferation
2.3. Effects of IFN-α2a and Arsenic Trioxide on Cells with the Mutated JAK2 V617F Gene
2.4. Effect of Phorbol 12 Myristate 13 AcetateInduced Differentiation of Modified Cells to Megakaryocytes
3. Discussion
4. Materials and Methods
4.1. Establishment of the K562 Cell Line with CRISPR/Cas9 Expression of the JAK2V617F Mutation
4.2. Characterization of Genetically Modified K562 Cell Lines
4.3. RT-qPCR Analysis
4.4. Effects of Drugs on Cell Lines in the Presence of the JAK2 V617F Mutation
4.5. PMA-Induced Megakaryocyte Differentiation
4.6. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| JAK2 | Janus kinase 2 |
| MPNs | Myeloproliferative neoplasms |
| IFN-α2a | Interferon α2a |
| PV | Polycythemia vera |
| ET | Essential thrombocythemia |
| PMF | Primary myelofibrosis |
| TPO | Thrombopoietin |
| EPO | Erythropoietin |
| Cas9 | CRISPR-associated protein 9 |
| DSBs | Double-strand breaks |
| RNP | Ribonucleoprotein |
| IC50 | The half-maximal inhibitory concentration |
| ROS | Reactive oxygen species |
| DDPCR | Droplet digital PCR |
| GAPDH | Glyceraldehyde 3 phosphate dehydrogenase |
| PMA | Phorbol 12 Myristate 13 Acetate |
| SD | Standard deviations |
| gRNA | guide RNA |
| IDT | Integrated DNA Technologies |
| HDR | Homology-directed repair |
| RT qPCR | Reverse transcription quantitative polymerase chain reaction |
References
- Vainchenker, W.; Kralovics, R. Genetic basis and molecular pathophysiology of classical myeloproliferative neoplasms. Blood 2017, 129, 667–679. [Google Scholar] [CrossRef] [PubMed]
- Tefferi, A.; Pardanani, A. Myeloproliferative Neoplasms: A Contemporary Review. JAMA Oncol. 2015, 1, 97–105. [Google Scholar] [CrossRef]
- Chen, E.; Mullally, A. How does JAK2V617F contribute to the pathogenesis of myeloproliferative neoplasms? Hematol. Am. Soc. Hematol. Educ. Program 2014, 5, 268–276. [Google Scholar] [CrossRef]
- Skoda, R.C.; Duek, A.; Grisouard, J. Pathogenesis of myeloproliferative neoplasms. Exp. Hematol. 2015, 43, 599–608. [Google Scholar] [CrossRef] [PubMed]
- James, C. The JAK2V617F mutation in polycythemia vera and other myeloproliferative disorders: One mutation for three diseases? Hematol. Am. Soc. Hematol. Educ. Program 2008, 2008, 69–75. [Google Scholar] [CrossRef] [PubMed]
- Levine, R.L.; Pardanani, A.; Tefferi, A.; Gilliland, D.G. Role of JAK2 in the pathogenesis and therapy of myeloproliferative disorders. Nat. Rev. Cancer 2007, 7, 673–683. [Google Scholar] [CrossRef]
- Zhao, W.; Zou, K.; Farasyn, T.; Ho, W.T.; Zhao, Z.J. Generation and characterization of a JAK2V617F-containing erythroleukemia cell line. PLoS ONE 2014, 9, 99017. [Google Scholar] [CrossRef]
- Kobayashi, S.S.; Vali, S.; Kumar, A.; Singh, N.; Abbasi, T.; Sayeski, P.P. Identification of myeloproliferative neoplasm drug agents via predictive simulation modeling: Assessing responsiveness with micro-environment derived cytokines. Oncotarget 2016, 7, 35989–36001. [Google Scholar] [CrossRef]
- Zhan, T.; Rindtorff, N.; Betge, J.; Ebert, M.P.; Boutros, M. CRISPR/Cas9 for cancer research and therapy. Semin. Cancer Biol. 2019, 55, 106–119. [Google Scholar] [CrossRef]
- Nasrallah, A.; Sulpice, E.; Kobaisi, F.; Gidrol, X.; Rachidi, W. CRISPR-Cas9 Technology for the Creation of Biological Avatars Capable of Modeling and Treating Pathologies: From Discovery to the Latest Improvements. Cells 2022, 11, 3615. [Google Scholar] [CrossRef]
- Passamonti, F.; Rumi, E. Clinical relevance of JAK2 (V617F) mutant allele burden. Haematologica 2009, 94, 7–10. [Google Scholar] [CrossRef]
- Kittur, J.; Knudson, R.A.; Lasho, T.L.; Finke, C.M.; Gangat, N.; Wolanskyj, A.P.; Li, C.Y.; Wu, W.; Ketterling, R.P.; Pardanani, A.; et al. Clinical correlates of JAK2V617F allele burden in essential thrombocythemia. Cancer 2007, 109, 2279–2284. [Google Scholar] [CrossRef]
- Vannucchi, A.M.; Pieri, L.; Guglielmelli, P. JAK2 allele burden in the myeloproliferative neoplasms: Effects on phenotype, prognosis and change with treatment. Ther. Adv. Hematol. 2011, 2, 21–32. [Google Scholar] [CrossRef] [PubMed]
- Lee, A.; Kim, S.; Nam, J.Y.; Yun, J.; Ryoo, H.M.; Bae, S.H. Clinical features and outcomes of JAK2 V617F-positive polycythemia vera and essential thrombocythemia according to the JAK2 V617F allele burden. Blood Res. 2021, 56, 259–265. [Google Scholar] [CrossRef] [PubMed]
- La Rocca, F.; Grieco, V.; Ruggieri, V.; Zifarone, E.; Villani, O.; Zoppoli, P.; Russi, S.; Laurino, S.; Falco, G.; Calice, G.; et al. Superiority of Droplet Digital PCR Over Real-Time Quantitative PCR for JAK2 V617F Allele Mutational Burden Assessment in Myeloproliferative Neoplasms: A Retrospective Study. Diagnostics 2020, 10, 143. [Google Scholar] [CrossRef] [PubMed]
- Hasselbalch, H.C.; Holmstrom, M.O. Perspectives on interferon-alpha in the treatment of polycythemia vera and related myeloproliferative neoplasms: Minimal residual disease and cure? Semin. Immunopathol. 2019, 41, 5–19. [Google Scholar] [CrossRef] [PubMed]
- Schubert, C.; Allhoff, M.; Tillmann, S.; Costa, I.G.; Lipka, D.B.; Schemionek, M.; Feldberg, K.; Baumeister, J.; Brümmendorf, T.H.; Chatain, N.; et al. Differential roles of STAT1 and STAT2 in the sensitivity of JAK2V617F- vs. BCR-ABL-positive cells to interferon alpha. J. Hematol. Oncol. 2019, 12, 36. [Google Scholar] [CrossRef]
- Khairul, I.; Wang, Q.Q.; Jiang, Y.H.; Wang, C.; Naranmandura, H. Metabolism, toxicity and anticancer activities of arsenic compounds. Oncotarget 2017, 8, 23905–23926. [Google Scholar] [CrossRef]
- Mu, Y.F.; Chen, Y.H.; Chang, M.M.; Chen, Y.C.; Huang, B.M. Arsenic compounds induce apoptosis through caspase pathway activation in MA-10 Leydig tumor cells. Oncol. Lett. 2019, 18, 944–954. [Google Scholar] [CrossRef]
- Huang, R.; Zhao, L.; Chen, H.; Yin, R.H.; Li, C.Y.; Zhan, Y.Q.; Zhang, J.H.; Ge, C.H.; Yu, M.; Yang, X.M. Megakaryocytic Differentiation of K562 Cells Induced by PMA Reduced the Activity of Respiratory Chain Complex IV. PLoS ONE 2014, 9, e96246. [Google Scholar] [CrossRef]
- Hirose, K.; Monzen, S.; Sato, H.; Sato, M.; Aoki, M.; Hatayama, Y.; Kawaguchi, H.; Narita, Y.; Takai, Y.; Kashiwakura, I. Megakaryocytic differentiation in human chronic myelogenous leukemia K562 cells induced by ionizing radiation in combination with phorbol 12-myristate 13-acetate. J. Radiat. Res. 2013, 54, 438–446. [Google Scholar] [CrossRef]
- Browne, E.; Kavanagh, S.; Devery, S. The Cytotoxicity of Phorbol 12- Myristate 13-Acetate and Lipopolysaccharide on THP-1 Cells and an Optimized Differentiation Protocol. Med. Sci. Forum. 2022, 11, 5. [Google Scholar]
- Lozzio, C.B.; Lozzio, B.B. Human chronic myelogenous leukemia cell-line with positive Philadelphia chromosome. Blood 1975, 45, 321–334. [Google Scholar] [CrossRef]
- Prestipino, A.; Emhardt, A.J.; Aumann, K.; O’Sullivan, D.; Gorantla, S.P.; Duquesne, S.; Melchinger, W.; Braun, L.; Vuckovic, S.; Boerries, M.; et al. Oncogenic JAK2V617F causes PD-L1 expression, mediating immune escape in myeloproliferative neoplasms. Sci. Transl. Med. 2018, 10, eaam7729. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.; Du, Y.; Ho, T.; Fu, X.; Zhao, Z. JAK2V617F and p53 mutations coexist in erythroleukemia and megakaryoblastic leukemic cell lines. Exp. Hematol. Oncol. 2012, 1, 15. [Google Scholar] [CrossRef]
- Quentmeier, H.; MacLeod, R.A.; Zaborski, M.; Drexler, H.G. JAK2 V617F tyrosine kinase mutation in cell lines derived from myeloproliferative disorders. Leukemia 2006, 20, 471–476. [Google Scholar] [CrossRef]
- Uozumi, K.; Otsuka, M.; Ohno, N.; Moriyama, T.; Suzuki, S.; Shimotakahara, S.; Matsumura, I.; Hanada, S.; Arima, T. Establishment and characterization of a new human megakaryoblastic cell line (SET-2) that spontaneously matures to megakaryocytes and produces platelet-like particles. Leukemia 2000, 14, 142–152. [Google Scholar] [CrossRef] [PubMed]
- Zauli, G.; Bassini, A.; Catani, L.; Gibellini, D.; Celeghini, C.; Borgatti, P.; Caramelli, E.; Guidotti, L.; Capitani, S. PMA-induced megakaryocytic differentiation of HEL cells is accompanied by striking modifications of protein kinase C catalytic activity and isoform composition at the nuclear level. Br. J. Haematol. 1996, 92, 530–536. [Google Scholar] [CrossRef]
- Garcia, P.; Calés, C. Endoreplication in megakaryoblastic cell lines is accompanied by sustained expression of G1/S cyclins and downregulation of cdc25C. Oncogene 1996, 15, 695–703. [Google Scholar]
- Pasquier, F.; Tonetti, C.; Besancenot, R.; Cassinat, B.; Kiladjian, J.J.; Herault, O.; Rameau, P.; Lacout, C.; Villeval, J.L.; Vainchenker, W.; et al. Interferon-Alpha Preferentially Targets JAK2V617F-Positive Rather Than Wild-Type Early Progenitor Cells in Myeloproliferative Disorders. Blood 2009, 114, 436. [Google Scholar] [CrossRef]
- Verger, E.; Soret-Dulphy, J.; Maslah, N.; Roy, L.; Rey, J.; Ghrieb, Z.; Kralovics, R.; Gisslinger, H.; Grohmann-Izay, B.; Klade, C.; et al. Ropeginterferon alpha-2b targets JAK2V617F-positive polycythemia vera cells in vitro and in vivo. Blood Cancer J. 2018, 8, 94. [Google Scholar] [CrossRef] [PubMed]
- Nilsri, N.; Jangprasert, P.; Pawinwongchai, J.; Israsena, N.; Rojnuckarin, P. Distinct effects of V617F and exon12-mutated JAK2 expressions on erythropoiesis in a human induced pluripotent stem cell (iPSC)-based model. Sci. Rep. 2021, 11, 5255. [Google Scholar] [CrossRef] [PubMed]




| Gene | Oligonucleotide Sequences |
|---|---|
| Guide RNA target 1 | AATTATGGAGTATGTGTCTG |
| Guide RNA target 2 | ACGAGAGTAAGTAAAACTAC |
| Oligo template | TGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAACTATGGGGTATGTTTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nilsri, N.; Mekchaaum, R.; Kalasin, S.; Jongjitwimol, J.; Daowtak, K. CRISPR/Cas9-Based Modeling of JAK2 V617F Mutation in K562 Cells Reveals Enhanced Proliferation and Sensitivity to Therapeutic Agents. Int. J. Mol. Sci. 2025, 26, 4600. https://doi.org/10.3390/ijms26104600
Nilsri N, Mekchaaum R, Kalasin S, Jongjitwimol J, Daowtak K. CRISPR/Cas9-Based Modeling of JAK2 V617F Mutation in K562 Cells Reveals Enhanced Proliferation and Sensitivity to Therapeutic Agents. International Journal of Molecular Sciences. 2025; 26(10):4600. https://doi.org/10.3390/ijms26104600
Chicago/Turabian StyleNilsri, Nungruthai, Rujira Mekchaaum, Supaporn Kalasin, Jirapas Jongjitwimol, and Krai Daowtak. 2025. "CRISPR/Cas9-Based Modeling of JAK2 V617F Mutation in K562 Cells Reveals Enhanced Proliferation and Sensitivity to Therapeutic Agents" International Journal of Molecular Sciences 26, no. 10: 4600. https://doi.org/10.3390/ijms26104600
APA StyleNilsri, N., Mekchaaum, R., Kalasin, S., Jongjitwimol, J., & Daowtak, K. (2025). CRISPR/Cas9-Based Modeling of JAK2 V617F Mutation in K562 Cells Reveals Enhanced Proliferation and Sensitivity to Therapeutic Agents. International Journal of Molecular Sciences, 26(10), 4600. https://doi.org/10.3390/ijms26104600

