Sea Anemone Kunitz Peptide HCIQ2c1 Reduces Histamine-, Lipopolysaccharide-, and Carrageenan-Induced Inflammation via the Suppression of Pro-Inflammatory Mediators
Abstract
1. Introduction
2. Results
2.1. Cytotoxicity of HCIQ2c1 on Murine Macrophage RAW264.7 Cells
2.2. HCIQ2c1 Regulates Histamine-Induced Calcium Release from ER in Macrophages
2.3. HCIQ2c1 Regulates LPS-Induced ROS Production and Influences Pro-Inflammatory Factors Secretion
2.4. HCIQ2c1 Reduces Cytokine Gene Expression in LPS-Induced Inflammation in In Vivo Models
2.5. HCIQ2c1 Reduces Carrageenan-Induced Inflammation
3. Discussion
4. Materials and Methods
4.1. Drugs
4.2. Cell Line and Culture Conditions
4.3. Cell Viability Assay (MTT Method)
4.4. [Ca2+]i Measurement
4.5. ROS Formation Assay
4.6. ELISA Assay
4.7. Animal Studies
4.8. Lipopolysaccharide-Induced Systemic Inflammation
4.9. Carrageenan-Induced Paw Edema
4.10. Quantitative Real-Time PCR
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Huang, G.J.; Pan, C.H.; Wu, C.H. Sclareol exhibits anti-inflammatory activity in both lipopolysaccharide-stimulated macrophages and the λ-carrageenan-induced paw edema model. J. Nat. Prod. 2012, 75, 54–59. [Google Scholar] [CrossRef] [PubMed]
- Arfè, A.; Scotti, L.; Varas-Lorenzo, C.; Nicotra, F.; Zambon, A.; Kollhorst, B.; Schink, T.; Garbe, E.; Herings, R.; Straatman, H.; et al. Non-steroidal anti-inflammatory drugs and risk of heart failure in four European countries: Nested case-control study. BMJ 2016, 354, i4857. [Google Scholar] [CrossRef] [PubMed]
- Schweitz, H.; Bruhn, T.; Guillemare, E.; Moinier, D.; Lancelin, J.-M.M.; Béress, L.; Lazdunski, M.; Beress, L.; Lazdunski, M.; Béress, L.; et al. Kalicludines and Kaliseptine: Two different classes of sea anemone toxins for voltage sensitive K+ cannels. J. Biol. Chem. 1995, 270, 25121–25126. [Google Scholar] [CrossRef] [PubMed]
- Chang, L.S.; Wang, J.J.; Cheng, Y.C.; Chou, W.M. Genetic organization of Bungarus multicinctus protease inhibitor-like proteins. Toxicon 2008, 51, 1490–1495. [Google Scholar] [CrossRef] [PubMed]
- Yuan, C.H.; He, Q.Y.; Peng, K.; Diao, J.B.; Jiang, L.P.; Tang, X.; Liang, S.P. Discovery of a distinct superfamily of Kunitz-type toxin (KTT) from tarantulas. PLoS ONE 2008, 3, e3414. [Google Scholar] [CrossRef]
- Inagaki, H.; Kimoto, H.; Yamauchi, Y.; Toriba, M.; Kubo, T. Functional characterization of Kunitz-type protease inhibitor Pr-mulgins identified from New Guinean Pseudechis australis. Toxicon 2012, 59, 74–80. [Google Scholar] [CrossRef]
- Chen, Z.Y.; Hu, Y.T.; Yang, W.S.; He, Y.W.; Feng, J.; Wang, B.; Zhao, R.M.; Ding, J.P.; Cao, Z.J.; Li, W.X.; et al. Hg1, novel peptide inhibitor specific for Kv1.3 channels from first scorpion Kunitz-type potassium channel toxin family. J. Biol. Chem. 2012, 287, 13813–13821. [Google Scholar] [CrossRef]
- Guo, C.; McClean, S.; Shaw, C.; Rao, P.; Ye, M.; Bjourson, A.J. Trypsin and chymotrypsin inhibitor peptides from the venom of Chinese Daboia russellii siamensis. Toxicon 2013, 63, 154–164. [Google Scholar] [CrossRef] [PubMed]
- Sintsova, O.V.; Monastyrnaya, M.M.; Pislyagin, E.A.; Menchinskaya, E.S.; Leychenko, E.V.; Aminin, D.L.; Kozlovskaya, E.P. Anti-inflammatory activity of a polypeptide from the Heteractis crispa sea anemone. Russ. J. Bioorganic Chem. 2015, 41, 657–663. [Google Scholar] [CrossRef] [PubMed]
- Sintsova, O.V.; Pislyagin, E.A.; Gladkikh, I.N.; Monastyrnaya, M.M.; Menchinskaya, E.S.; Leychenko, E.V.; Aminin, D.L.; Kozlovskaya, E.P. Kunitz-type peptides of the sea anemone Heteractis crispa: Potential anti-inflammatory compounds. Russ. J. Bioorganic Chem. 2017, 43, 91–97. [Google Scholar] [CrossRef]
- Lancelin, J.M.; Foray, M.F.; Poncin, M.; Hollecker, M.; Marion, D. Proteinase inhibitor homologues as potassium channel blockers. Struct. Biol. 1994, 1, 246–250. [Google Scholar] [CrossRef] [PubMed]
- Owen, D.G.; Hall, A.; Stephens, G.; Stow, J.; Robertson, B. The relative potencies of dendrotoxins as blockers of the cloned voltage-gated K+ channel, mKv1.1 (MK-1), when stably expressed in Chinese hamster ovary cells. Br. J. Pharmacol. 1997, 120, 1029–1034. [Google Scholar] [CrossRef]
- García-Fernández, R.; Peigneur, S.; Pons, T.; Alvarez, C.; González, L.; Chávez, M.A.; Tytgat, J. The Kunitz-type protein ShPI-1 inhibits serine proteases and voltage-gated potassium channels. Toxins 2016, 8, 110. [Google Scholar] [CrossRef] [PubMed]
- Gladkikh, I.; Peigneur, S.; Sintsova, O.; Pinheiro-Junior, E.L.; Klimovich, A.; Menshov, A.; Kalinovsky, A.; Isaeva, M.; Monastyrnaya, M.; Kozlovskaya, E.; et al. Kunitz-type peptides from the sea anemone Heteractis crispa demonstrate potassium channel blocking and anti-inflammatory activities. Biomedicines 2020, 8, 473. [Google Scholar] [CrossRef] [PubMed]
- Stotz, S.C.; Spaetgens, R.L.; Zamponi, G.W. Block of voltage-dependent calcium channel by the green mamba toxin calcicludine. J. Membr. Biol. 2000, 174, 157–165. [Google Scholar] [CrossRef]
- You, D.; Hong, J.; Rong, M.; Yu, H.; Liang, S.; Ma, Y.; Yang, H.; Wu, J.; Lin, D.; Lai, R. The first gene-encoded amphibian neurotoxin. J. Biol. Chem. 2009, 284, 22079–22086. [Google Scholar] [CrossRef]
- Harvey, A.L. Twenty years of dendrotoxins. Toxicon 2001, 39, 15–26. [Google Scholar] [CrossRef] [PubMed]
- Báez, A.; Salceda, E.; Fló, M.; Graña, M.; Fernández, C.; Vega, R.; Soto, E. α-Dendrotoxin inhibits the ASIC current in dorsal root ganglion neurons from rat. Neurosci. Lett. 2015, 606, 42–47. [Google Scholar] [CrossRef] [PubMed]
- Andreev, Y.A.; Kozlov, S.A.; Koshelev, S.G.; Ivanova, E.A.; Monastyrnaya, M.M.; Kozlovskaya, E.P.; Grishin, E.V. Analgesic compound from sea anemone Heteractis crispa is the first polypeptide inhibitor of vanilloid receptor 1 (TRPV1). J. Biol. Chem. 2008, 283, 23914–23921. [Google Scholar] [CrossRef] [PubMed]
- Andreev, Y.A.; Kozlov, S.A.; Korolkova, Y.V.; Dyachenko, I.A.; Bondarenko, D.A.; Skobtsov, D.I.; Murashev, A.N.; Kotova, P.D.; Rogachevskaja, O.A.; Kabanova, N.V.; et al. Polypeptide modulators of TRPV1 produce analgesia without hyperthermia. Mar. Drugs 2013, 11, 5100–5115. [Google Scholar] [CrossRef] [PubMed]
- Monastyrnaya, M.; Peigneur, S.; Zelepuga, E.; Sintsova, O.; Gladkikh, I.; Leychenko, E.; Isaeva, M.; Tytgat, J.; Kozlovskaya, E. Kunitz-type peptide HCRG21 from the sea anemone Heteractis crispa is a full antagonist of the TRPV1 receptor. Mar. Drugs 2016, 14, 229. [Google Scholar] [CrossRef]
- Shigetomi, H.; Onogi, A.; Kajiwara, H.; Yoshida, S.; Furukawa, N.; Haruta, S.; Tanase, Y.; Kanayama, S.; Noguchi, T.; Yamada, Y.; et al. Anti-inflammatory actions of serine protease inhibitors containing the Kunitz domain. Inflamm. Res. 2010, 59, 679–687. [Google Scholar] [CrossRef] [PubMed]
- Kozlov, S.; Grishin, E. The mining of toxin-like polypeptides from EST database by single residue distribution analysis. BMC Genom. 2011, 12, 88. [Google Scholar] [CrossRef] [PubMed]
- Madio, B.; Undheim, E.A.B.; King, G.F. Revisiting venom of the sea anemone Stichodactyla haddoni: Omics techniques reveal the complete toxin arsenal of a well-studied sea anemone genus. J. Proteom. 2017, 166, 83–92. [Google Scholar] [CrossRef] [PubMed]
- Sintsova, O.; Gladkikh, I.; Chausova, V.; Monastyrnaya, M.; Anastyuk, S.; Chernikov, O.; Yurchenko, E.; Aminin, D.; Isaeva, M.; Leychenko, E.; et al. Peptide fingerprinting of the sea anemone Heteractis magnifica mucus revealed neurotoxins, Kunitz-type proteinase inhibitors and a new β-defensin α-amylase inhibitor. J. Proteom. 2018, 173, 12–21. [Google Scholar] [CrossRef] [PubMed]
- Gladkikh, I.; Monastyrnaya, M.; Zelepuga, E.; Sintsova, O.; Tabakmakher, V.; Gnedenko, O.; Ivanov, A.; Hua, K.F.; Kozlovskaya, E.; Jacobson, P.B. New Kunitz-type HCRG polypeptides from the sea anemone Heteractis crispa. Mar. Drugs 2015, 13, 6038–6063. [Google Scholar] [CrossRef]
- Sintsova, O.; Gladkikh, I.; Monastyrnaya, M.; Tabakmakher, V.; Yurchenko, E.; Menchinskaya, E.; Pislyagin, E.; Andreev, Y.; Kozlov, S.; Peigneur, S.; et al. Sea anemone Kunitz-type peptides demonstrate neuroprotective activity in the 6-hydroxydopamine induced neurotoxicity model. Biomedicines 2021, 9, 283. [Google Scholar] [CrossRef] [PubMed]
- Logashina, Y.A.; Palikova, Y.A.; Palikov, V.A.; Kazakov, V.A.; Smolskaya, S.V.; Dyachenko, I.A.; Tarasova, N.V.; Andreev, Y.A. Anti-inflammatory and analgesic effects of TRPV1 polypeptide modulator APHC3 in models of osteo- and rheumatoid arthritis. Mar. Drugs 2021, 19, 39. [Google Scholar] [CrossRef]
- Kvetkina, A.; Leychenko, E.; Chausova, V.; Zelepuga, E.; Chernysheva, N.; Guzev, K.; Pislyagin, E.; Yurchenko, E.; Menchinskaya, E.; Aminin, D.; et al. A new multigene HCIQ subfamily from the sea anemone Heteractis crispa encodes Kunitz-peptides exhibiting neuroprotective activity against 6-hydroxydopamine. Sci. Rep. 2020, 10, 4205. [Google Scholar] [CrossRef]
- Kvetkina, A.; Pislyagin, E.; Menchinskaya, E.; Yurchenko, E.; Kalina, R.; Kozlovskiy, S.; Kaluzhskiy, L.; Menshov, A.; Kim, N.; Peigneur, S.; et al. Kunitz-type peptides from sea anemones protect neuronal cells against Parkinson’s disease inductors via inhibition of ROS production and ATP-induced P2X7 receptor activation. Int. J. Mol. Sci. 2022, 23, 5115. [Google Scholar] [CrossRef] [PubMed]
- Kalina, R.S.; Peigneur, S.; Zelepuga, E.A.; Dmitrenok, P.S.; Kvetkina, A.N.; Kim, N.Y.; Leychenko, E.V.; Tytgat, J.; Kozlovskaya, E.P.; Monastyrnaya, M.M.; et al. New insights into the type II toxins from the sea anemone Heteractis crispa. Toxins 2020, 12, 44. [Google Scholar] [CrossRef] [PubMed]
- Kvetkina, A.N.; Oreshkov, S.D.; Mironov, P.A.; Zaigraev, M.M.; Klimovich, A.A.; Deriavko, Y.V.; Men’shov, A.S.; Kulbatskii, D.S.; Logashina, Y.A.; Andreev, Y.A.; et al. Sea anemone Kunitz-type peptide modulates TRPA1 channel and suppresses a nociceptive reaction in vivo. Mar. Drugs 2024, in press. [Google Scholar] [CrossRef] [PubMed]
- Facchin, B.M.; dos Reis, G.O.; Vieira, G.N.; Mohr, E.T.B.; da Rosa, J.S.; Kretzer, I.F.; Demarchi, I.G.; Dalmarco, E.M. Inflammatory biomarkers on an LPS-induced RAW 264.7 cell model: A systematic review and meta-analysis. Inflamm. Res. 2022, 71, 741–758. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef] [PubMed]
- Macedo, M.H.; Dias Neto, M.; Pastrana, L.; Gonçalves, C.; Xavier, M. Recent advances in cell-based in vitro models to recreate human intestinal inflammation. Adv. Sci. 2023, 10, 2301391. [Google Scholar] [CrossRef] [PubMed]
- Branco, A.C.C.C.; Yoshikawa, F.S.Y.; Pietrobon, A.J.; Sato, M.N. Role of histamine in modulating the immune response and inflammation. Mediat. Inflamm. 2018, 2018, 9524075. [Google Scholar] [CrossRef] [PubMed]
- O’Mahony, L.; Akdis, M.; Akdis, C.A. Regulation of the immune response and inflammation by histamine and histamine receptors. J. Allergy Clin. Immunol. 2011, 128, 1153–1162. [Google Scholar] [CrossRef] [PubMed]
- Thangam, E.B.; Jemima, E.A.; Singh, H.; Baig, M.S.; Khan, M.; Mathias, C.B.; Church, M.K.; Saluja, R. The role of histamine and histamine receptors in mast cell-mediated allergy and inflammation: The hunt for new therapeutic targets. Front. Immunol. 2018, 9, 1873. [Google Scholar] [CrossRef]
- Jung, S.; Pfeiffer, F.; Deitmer, J.W. Histamine-induced calcium entry in rat cerebellar astrocytes: Evidence for capacitative and non-capacitative mechanisms. J. Physiol. 2000, 527, 549–561. [Google Scholar] [CrossRef] [PubMed]
- Triggiani, M.; Gentile, M.; Secondo, A.; Granata, F.; Oriente, A.; Taglialatela, M.; Annunziato, L.; Marone, G. Histamine induces exocytosis and IL-6 production from human lung macrophages through interaction with H1 receptors. J. Immunol. 2001, 166, 4083–4091. [Google Scholar] [CrossRef] [PubMed]
- Nayak, B.N.; Kaur, G.; Buttar, H.S. TNF-α modulation by natural bioactive molecules in mouse RAW 264.7 macrophage cells. J. Complement. Integr. Med. 2016, 13, 1–7. [Google Scholar] [CrossRef]
- Ren, K.; Torres, R. Role of interleukin-1β during pain and inflammation. Brain Res. Rev. 2009, 60, 57–64. [Google Scholar] [CrossRef] [PubMed]
- Serio, K.J.; Reddy, K.V.; Bigby, T.D. Lipopolysaccharide induces 5-lipoxygenase-activating protein gene expression in THP-1 cells via a NF-κB and C/EBP-mediated mechanism. Am. J. Physiol.—Cell Physiol. 2005, 288, C1125–C1133. [Google Scholar] [CrossRef] [PubMed]
- Britt, R.D., Jr.; Locy, M.L.; Tipple, T.E.; Nelin, L.D.; Rogers, L.K. Lipopolysaccharide-induced cyclooxygenase-2 expression in mouse transformed Clara cells. Cell. Physiol. Biochem. 2012, 29, 213–222. [Google Scholar] [CrossRef]
- Ju, Z.; Li, M.; Xu, J.; Howell, D.C.; Li, Z.; Chen, F.E. Recent development on COX-2 inhibitors as promising anti-inflammatory agents: The past 10 years. Acta Pharm. Sin. B 2022, 12, 2790–2807. [Google Scholar] [CrossRef] [PubMed]
- Kittaka, H.; Tominaga, M. The molecular and cellular mechanisms of itch and the involvement of TRP channels in the peripheral sensory nervous system and skin. Allergol. Int. 2017, 66, 22–30. [Google Scholar] [CrossRef] [PubMed]
- Rossbach, K.; Nassenstein, C.; Gschwandtner, M.; Schnell, D.; Sander, K.; Seifert, R.; Stark, H.; Kietzmann, M.; Bäumer, W. Histamine H1, H3 and H4 receptors are involved in pruritus. Neuroscience 2011, 190, 89–102. [Google Scholar] [CrossRef] [PubMed]
- Han, S.K.; Mancino, V.; Simon, M.I. Phospholipase Cβ 3 mediates the scratching response activated by the histamine H1 receptor on C-fiber nociceptive neurons. Neuron 2006, 52, 691–703. [Google Scholar] [CrossRef]
- Jian, T.; Yang, N.; Yang, Y.; Zhu, C.; Yuan, X.; Yu, G.; Wang, C.; Wang, Z.; Shi, H.; Tang, M.; et al. TRPV1 and PLC participate in histamine H4 receptor-induced itch. Neural Plast. 2016, 2016, 1682972. [Google Scholar] [CrossRef]
- Kajihara, Y.; Murakami, M.; Imagawa, T.; Otsuguro, K.; Ito, S.; Ohta, T. Histamine potentiates acid-induced responses mediating transient receptor potential V1 in mouse primary sensory neurons. Neuroscience 2010, 166, 292–304. [Google Scholar] [CrossRef] [PubMed]
- Kim, B.M.; Lee, S.H.; Shim, W.S.; Oh, U. Histamine-induced Ca2+ influx via the PLA2/lipoxygenase/TRPV1 pathway in rat sensory neurons. Neurosci. Lett. 2004, 361, 159–162. [Google Scholar] [CrossRef] [PubMed]
- Shim, W.S.; Tak, M.H.; Lee, M.H.; Kim, M.; Kim, M.; Koo, J.Y.; Lee, C.H.; Kim, M.; Oh, U. TRPV1 mediates histamine-induced itching via the activation of phospholipase A2 and 12-lipoxygenase. J. Neurosci. 2007, 27, 2331–2337. [Google Scholar] [CrossRef] [PubMed]
- Story, G.M.; Peier, A.M.; Reeve, A.J.; Eid, S.R.; Mosbacher, J.; Hricik, T.R.; Earley, T.J.; Hergarden, A.C.; Andersson, D.A.; Hwang, S.W.; et al. ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures. Cell 2003, 112, 819–829. [Google Scholar] [CrossRef] [PubMed]
- Staruschenko, A.; Jeske, N.A.; Akopian, A.N. Contribution of TRPV1-TRPA1 interaction to the single channel properties of the TRPA1 channel. J. Biol. Chem. 2010, 285, 15167–15177. [Google Scholar] [CrossRef] [PubMed]
- Roberson, D.P.; Gudes, S.; Sprague, J.M.; Patoski, H.A.W.; Robson, V.K.; Blasl, F.; Duan, B.; Oh, S.B.; Bean, B.P.; Ma, Q.; et al. Activity-dependent silencing reveals functionally distinct itch-generating sensory neurons. Nat. Neurosci. 2013, 16, 910–918. [Google Scholar] [CrossRef] [PubMed]
- Wilzopolski, J.; Kietzmann, M.; Mishra, S.K.; Stark, H.; Bäumer, W.; Rossbach, K. TRPV1 and TRPA1 channels are both involved downstream of histamine-induced itch. Biomolecules 2021, 11, 1166. [Google Scholar] [CrossRef] [PubMed]
- Michot, B.; Casey, S.M.; Lee, C.S.; Erdogan, O.; Basu, H.; Chiu, I.; Gibbs, J.L. Lipopolysaccharide-Induced TRPA1 upregulation in trigeminal neurons is dependent on TLR4 and vesicular exocytosis. J. Neurosci. 2023, 43, 6731–6744. [Google Scholar] [CrossRef] [PubMed]
- Lind, M.; Hayes, A.; Caprnda, M.; Petrovic, D.; Rodrigo, L.; Kruzliak, P.; Zulli, A. Inducible nitric oxide synthase: Good or bad? Biomed. Pharmacother. 2017, 93, 370–375. [Google Scholar] [CrossRef]
- Lee, S.J.; Cheong, S.H.; Kim, Y.S.; Hwang, J.W.; Kwon, H.J.; Kang, S.H.; Moon, S.H.; Jeon, B.T.; Park, P.J. Antioxidant activity of a novel synthetic hexa-peptide derived from an enzymatic hydrolysate of duck skin by-products. Food Chem. Toxicol. 2013, 62, 276–280. [Google Scholar] [CrossRef] [PubMed]
- Rocha, A.C.C.; Fernandes, E.S.; Quintão, N.L.M.; Campos, M.M.; Calixto, J.B. Relevance of tumour necrosis factor-α for the inflammatory and nociceptive responses evoked by carrageenan in the mouse paw. Br. J. Pharmacol. 2006, 148, 688–695. [Google Scholar] [CrossRef] [PubMed]
- Halici, Z.; Dengiz, G.O.; Odabasoglu, F.; Suleyman, H.; Cadirci, E.; Halici, M. Amiodarone has anti-inflammatory and anti-oxidative properties: An experimental study in rats with carrageenan-induced paw edema. Eur. J. Pharmacol. 2007, 566, 215–221. [Google Scholar] [CrossRef]
- Sintsova, O.; Gladkikh, I.; Klimovich, A.; Palikova, Y.; Palikov, V.; Styshova, O.; Monastyrnaya, M.; Dyachenko, I.; Kozlov, S.; Leychenko, E. TRPV1 blocker HCRG21 suppresses TNF-α production and prevents the development of edema and hypersensitivity in carrageenan-induced acute local inflammation. Biomedicines 2021, 9, 283. [Google Scholar] [CrossRef] [PubMed]
- Moilanen, L.J.; Laavola, M.; Kukkonen, M.; Korhonen, R.; Leppänen, T.; Högestätt, E.D.; Zygmunt, P.M.; Nieminen, R.M.; Moilanen, E. TRPA1 contributes to the acute inflammatory response and mediates carrageenan-induced paw edema in the mouse. Sci. Rep. 2012, 2, 380. [Google Scholar] [CrossRef]
- Watanabe, M.; Ueda, T.; Shibata, Y.; Kumamoto, N.; Ugawa, S. The role of TRPV1 channels in carrageenan-induced mechanical hyperalgesia in mice. NeuroReport 2015, 26, 173–178. [Google Scholar] [CrossRef] [PubMed]
- Mello, P.D.A.; Filippi-Chiela, E.C.; Nascimento, J.; Beckenkamp, A.; Santana, D.B.; Kipper, F.; Casali, E.A.; Bruno, A.N.; Paccez, J.D.; Zerbini, L.F.; et al. Adenosine uptake is the major effector of extracellular ATP toxicity in human cervical cancer cells. Mol. Biol. Cell 2014, 25, 2905–2918. [Google Scholar] [CrossRef] [PubMed]
- Yurchenko, E.A.; Menchinskaya, E.S.; Pislyagin, E.A.; Trinh, P.T.H.; Ivanets, E.V.; Smetanina, O.F.; Yurchenko, A.N. Neuroprotective activity of some marine fungal metabolites in the 6-hydroxydopamin- and paraquat-induced Parkinson’s disease models. Mar. Drugs 2018, 16, 457. [Google Scholar] [CrossRef] [PubMed]
- Hsu, H.Y.; Wen, M.H. Lipopolysaccharide-mediated reactive oxygen species and signal transduction in the regulation of interleukin-1 gene expression. J. Biol. Chem. 2002, 277, 22131–22139. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Isaeva, M.P.; Chausova, V.E.; Zelepuga, E.A.; Guzev, K.V.; Tabakmakher, V.M.; Monastyrnaya, M.M.; Kozlovskaya, E.P. A new multigene superfamily of Kunitz-type protease inhibitors from sea anemone Heteractis crispa. Peptides 2012, 34, 88–97. [Google Scholar] [CrossRef]
- Mangal, D.; Uboh, C.E.; Jiang, Z.; Soma, L.R. Interleukin-1β inhibits synthesis of 5-lipooxygenase in lipopolysaccharide-stimulated equine whole blood. Prostaglandins Other Lipid Mediat. 2014, 108, 9–22. [Google Scholar] [CrossRef] [PubMed]





| Gene Names | Forward | Reverse | Annealing Temperature, °C | Fragment Length | 
|---|---|---|---|---|
| TNF-α | 5′−GTGGAACTGGCAGAAGA−3′ | 5′−ACTGATGAGAGGGAGGC−3′ | 59 | 192 | 
| IL-1β | 5′−AACCTTTGACCTGGGCTGTC−3′ | 5′−AAGGTCCACGGGAAAGACAC−3′ | 56 | 144 | 
| COX2 | 5′−TGAGTACCGCAAACGCTTCT−3′ | 5′−ACGAGGTTTTTCCACCAGCA−3′ | 55 | 148 | 
| iNOS | 5′−ATGTGCTGCCTCTGGTCTTGC−3′ | 5′−GAACCACTCGTACTTGGGATGC−3′ | 53 | 110 | 
| β-actin | 5′−AGGGAAATCGTGCGTGACAT−3′ | 5′−AACCGCTCGTTGCCAATAGT−3′ | 52–60 | 149 | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kvetkina, A.N.; Klimovich, A.A.; Deriavko, Y.V.; Pislyagin, E.A.; Menchinskaya, E.S.; Bystritskaya, E.P.; Isaeva, M.P.; Lyukmanova, E.N.; Shenkarev, Z.O.; Aminin, D.L.; et al. Sea Anemone Kunitz Peptide HCIQ2c1 Reduces Histamine-, Lipopolysaccharide-, and Carrageenan-Induced Inflammation via the Suppression of Pro-Inflammatory Mediators. Int. J. Mol. Sci. 2025, 26, 431. https://doi.org/10.3390/ijms26010431
Kvetkina AN, Klimovich AA, Deriavko YV, Pislyagin EA, Menchinskaya ES, Bystritskaya EP, Isaeva MP, Lyukmanova EN, Shenkarev ZO, Aminin DL, et al. Sea Anemone Kunitz Peptide HCIQ2c1 Reduces Histamine-, Lipopolysaccharide-, and Carrageenan-Induced Inflammation via the Suppression of Pro-Inflammatory Mediators. International Journal of Molecular Sciences. 2025; 26(1):431. https://doi.org/10.3390/ijms26010431
Chicago/Turabian StyleKvetkina, Aleksandra N., Anna A. Klimovich, Yulia V. Deriavko, Evgeniy A. Pislyagin, Ekaterina S. Menchinskaya, Evgenia P. Bystritskaya, Marina P. Isaeva, Ekaterina N. Lyukmanova, Zakhar O. Shenkarev, Dmitriy L. Aminin, and et al. 2025. "Sea Anemone Kunitz Peptide HCIQ2c1 Reduces Histamine-, Lipopolysaccharide-, and Carrageenan-Induced Inflammation via the Suppression of Pro-Inflammatory Mediators" International Journal of Molecular Sciences 26, no. 1: 431. https://doi.org/10.3390/ijms26010431
APA StyleKvetkina, A. N., Klimovich, A. A., Deriavko, Y. V., Pislyagin, E. A., Menchinskaya, E. S., Bystritskaya, E. P., Isaeva, M. P., Lyukmanova, E. N., Shenkarev, Z. O., Aminin, D. L., & Leychenko, E. V. (2025). Sea Anemone Kunitz Peptide HCIQ2c1 Reduces Histamine-, Lipopolysaccharide-, and Carrageenan-Induced Inflammation via the Suppression of Pro-Inflammatory Mediators. International Journal of Molecular Sciences, 26(1), 431. https://doi.org/10.3390/ijms26010431
 
        





 
       