Transcriptomic and Proteomic Analysis of Monkeypox Virus A5L-Expressing HEK293T Cells
Abstract
1. Introduction
2. Results
2.1. Sequence Analysis of MPXV-A5L
2.2. Plasmid Construction and Immunoblot Analyses of MPXV A5L Protein
2.3. Identification of DEGs
2.4. GO and KEGG Analysis of DEGs
2.5. Varification of the RNA-Seq Data Through RT-qPCR
2.6. Interaction of MPXV A5L
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Cell Culture
5.2. Plasmids Construction Transfection
5.3. DNA Transfection
5.4. RNA-Seq and Data Processing
5.5. Real-Time Quantitative PCR (RT-qPCR)
5.6. Immunoblots Analyses
5.7. LC-MS/MS and Data Processing
5.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
MPOX | Monkeypox |
MPXV | Monkeypox virus |
VARV | Variola virus |
CPXV | Cowpox virus |
VACV | Vaccinia virus |
RNA-seq | RNA sequencing |
LC-MS/MS | Liquid chromatography-tandem mass spectrometry |
HEK293T Cell | Human Embryonic Kidney 293 Cells |
GO | Gene Ontology |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
WHO | World Health Organization |
PHEIC | Public Health Emergency of International Concern |
ORFs | open reading frames |
IMV | Intracellular mature virion |
IV | Intracellular virions |
MV | Mature virions |
DEGs | differentially expressed genes |
Co-IP | Co-immunoprecipitation |
WCL | Whole-cell lysate |
BP | biological process |
CC | cellular component |
MF | molecular function |
NDV | Newcastle disease virus |
SARS-CoV | Severe acute respiratory syndrome coronavirus |
DENV | Dengue virus |
ALV | Avian leukosis virus |
WV | Wrapped virions |
EEV | Extracellular enveloped virion |
HSV-1 | Human simplex virus-1 |
SFTSV | Thrombocytopenia syndrome virus |
EBV | Epstein–Barr virus |
PRRSV | Porcine reproductive and respiratory syndrome virus |
FPKM | fragments per kilobase of transcript per million mapped reads |
DTT | dithiothreitol |
NCBI | National Center for Biotechnology Information |
References
- Adler, H.; Gould, S.; Hine, P.; Snell, L.B.; Wong, W.; Houlihan, C.F.; Osborne, J.C.; Rampling, T.; Beadsworth, M.B.; Duncan, C.J.; et al. Clinical features and management of human monkeypox: A retrospective observational study in the UK. Lancet Infect. Dis. 2022, 22, 1153–1162. [Google Scholar] [CrossRef] [PubMed]
- Gong, Q.; Wang, C.; Chuai, X.; Chiu, S. Monkeypox virus: A re-emergent threat to humans. Virol. Sin. 2022, 37, 477–482. [Google Scholar] [CrossRef]
- Lum, F.M.; Torres-Ruesta, A.; Tay, M.Z.; Lin, R.T.P.; Lye, D.C.; Renia, L.; Ng, L.F.P. Monkeypox: Disease epidemiology, host immunity and clinical interventions. Nat. Rev. Immunol. 2022, 22, 597–613. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.A.; Mumin, J.; Haque, M.M.; Haque, M.A.; Khan, A.; Bhattacharya, P.; Haque, M.A. Monkeypox virus (MPXV): A Brief account of global spread, epidemiology, virology, clinical features, pathogenesis, and therapeutic interventions. Infect. Med. 2023, 2, 262–272. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, J.; Li, M.; Jia, M.; Yang, L.; Wang, T.; Wang, Y.; Kang, L.; Li, M.; Kong, L. Transcriptome and proteomic analysis of mpox virus F3L-expressing cells. Front. Cell. Infect. Microbiol. 2024, 14, 1354410. [Google Scholar] [CrossRef]
- Hatmal, M.M.; Al-Hatamleh, M.A.I.; Olaimat, A.N.; Ahmad, S.; Hasan, H.; Ahmad Suhaimi, N.A.; Albakri, K.A.; Abedalbaset Alzyoud, A.; Kadir, R.; Mohamud, R. Comprehensive literature review of monkeypox. Emerg. Microbes Infect. 2022, 11, 2600–2631. [Google Scholar] [CrossRef] [PubMed]
- Tiecco, G.; Degli Antoni, M.; Storti, S.; Tomasoni, L.R.; Castelli, F.; Quiros-Roldan, E. Monkeypox, a Literature Review: What Is New and Where Does This concerning Virus Come From? Viruses 2022, 14, 1894. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.; Zou, X.; Deng, Z.; Zhao, M.; Gu, C.; Fu, L.; Xiao, W.; He, M.; He, L.; Yang, Q.; et al. Genome analysis of the mpox (formerly monkeypox) virus and characterization of core/variable regions. Genomics 2024, 116, 110763. [Google Scholar] [CrossRef]
- Shchelkunov, S.N.; Totmenin, A.V.; Safronov, P.F.; Mikheev, M.V.; Gutorov, V.V.; Ryazankina, O.I.; Petrov, N.A.; Babkin, I.V.; Uvarova, E.A.; Sandakhchiev, L.S.; et al. Analysis of the monkeypox virus genome. Virology 2002, 297, 172–194. [Google Scholar] [CrossRef] [PubMed]
- Monzon, S.; Varona, S.; Negredo, A.; Vidal-Freire, S.; Patino-Galindo, J.A.; Ferressini-Gerpe, N.; Zaballos, A.; Orviz, E.; Ayerdi, O.; Munoz-Gomez, A.; et al. Monkeypox virus genomic accordion strategies. Nat. Commun. 2024, 15, 3059. [Google Scholar] [CrossRef]
- Likos, A.M.; Sammons, S.A.; Olson, V.A.; Frace, A.M.; Li, Y.; Olsen-Rasmussen, M.; Davidson, W.; Galloway, R.; Khristova, M.L.; Reynolds, M.G.; et al. A tale of two clades: Monkeypox viruses. J. Gen. Virol. 2005, 86 Pt 10, 2661–2672. [Google Scholar] [CrossRef]
- Damon, I.K. Status of human monkeypox: Clinical disease, epidemiology and research. Vaccine 2011, 29 (Suppl. S4), D54–D59. [Google Scholar] [CrossRef] [PubMed]
- Happi, C.; Adetifa, I.; Mbala, P.; Njouom, R.; Nakoune, E.; Happi, A.; Ndodo, N.; Ayansola, O.; Mboowa, G.; Bedford, T.; et al. Urgent need for a non-discriminatory and non-stigmatizing nomenclature for monkeypox virus. PLoS Biol. 2022, 20, e3001769. [Google Scholar] [CrossRef] [PubMed]
- Faye, O.; Pratt, C.B.; Faye, M.; Fall, G.; Chitty, J.A.; Diagne, M.M.; Wiley, M.R.; Yinka-Ogunleye, A.F.; Aruna, S.; Etebu, E.N.; et al. Genomic characterisation of human monkeypox virus in Nigeria. Lancet Infect. Dis. 2018, 18, 246. [Google Scholar] [CrossRef] [PubMed]
- Antinori, A.; Mazzotta, V.; Vita, S.; Carletti, F.; Tacconi, D.; Lapini, L.E.; D’Abramo, A.; Cicalini, S.; Lapa, D.; Pittalis, S.; et al. Epidemiological, clinical and virological characteristics of four cases of monkeypox support transmission through sexual contact, Italy, May 2022. Eurosurveillance 2022, 27, 2200421. [Google Scholar] [CrossRef] [PubMed]
- Vivancos, R.; Anderson, C.; Blomquist, P.; Balasegaram, S.; Bell, A.; Bishop, L.; Brown, C.S.; Chow, Y.; Edeghere, O.; Florence, I.; et al. Community transmission of monkeypox in the United Kingdom, April to May 2022. Eurosurveillance 2022, 27, 2200422. [Google Scholar] [CrossRef] [PubMed]
- Sahu, A.; Gaur, M.; Mahanandia, N.C.; Subudhi, E.; Swain, R.P.; Subudhi, B.B. Identification of core therapeutic targets for Monkeypox virus and repurposing potential of drugs against them: An in silico approach. Comput. Biol. Med. 2023, 161, 106971. [Google Scholar] [CrossRef]
- Park, C.; Walsh, D. Ribosomes in poxvirus infection. Curr. Opin. Virol. 2022, 56, 101256. [Google Scholar] [CrossRef]
- Seet, B.T.; Johnston, J.B.; Brunetti, C.R.; Barrett, J.W.; Everett, H.; Cameron, C.; Sypula, J.; Nazarian, S.H.; Lucas, A.; McFadden, G. Poxviruses and immune evasion. Annu. Rev. Immunol. 2003, 21, 377–423. [Google Scholar] [CrossRef]
- Upton, C.; Slack, S.; Hunter, A.L.; Ehlers, A.; Roper, R.L. Poxvirus orthologous clusters: Toward defining the minimum essential poxvirus genome. J. Virol. 2003, 77, 7590–7600. [Google Scholar] [CrossRef]
- Xu, Z.; Zikos, D.; Tamosiunaite, A.; Klopfleisch, R.; Osterrieder, N.; Tischer, B.K. Identification of 10 cowpox virus proteins that are necessary for induction of hemorrhagic lesions (red pocks) on chorioallantoic membranes. J. Virol. 2014, 88, 8615–8628. [Google Scholar] [CrossRef]
- Williams, O.; Wolffe, E.J.; Weisberg, A.S.; Merchlinsky, M. Vaccinia virus WR gene A5L is required for morphogenesis of mature virions. J. Virol. 1999, 73, 4590–4599. [Google Scholar] [CrossRef]
- Condit, R.C.; Moussatche, N.; Traktman, P. In a nutshell: Structure and assembly of the vaccinia virion. Adv. Virus Res. 2006, 66, 31–124. [Google Scholar] [PubMed]
- Risco, C.; Rodriguez, J.R.; Demkowicz, W.; Heljasvaara, R.; Carrascosa, J.L.; Esteban, M.; Rodriguez, D. The vaccinia virus 39-kDa protein forms a stable complex with the p4a/4a major core protein early in morphogenesis. Virology 1999, 265, 375–386. [Google Scholar] [CrossRef]
- Huang, Y.; Bergant, V.; Grass, V.; Emslander, Q.; Hamad, M.S.; Hubel, P.; Mergner, J.; Piras, A.; Krey, K.; Henrici, A.; et al. Multi-omics characterization of the monkeypox virus infection. Nat. Commun. 2024, 15, 6778. [Google Scholar] [CrossRef]
- Wang, Y.; Li, Y.; Li, M.; Wang, K.; Xiong, J.; Wang, T.; Wang, Y.; Guo, Y.; Kong, L.; Li, M. A Combined Transcriptomic and Proteomic Analysis of Monkeypox Virus A23 Protein on HEK293T Cells. Int. J. Mol. Sci. 2024, 25, 8678. [Google Scholar] [CrossRef]
- Brussow, H. Pandemic potential of poxviruses: From an ancient killer causing smallpox to the surge of monkeypox. Microb. Biotechnol. 2023, 16, 1723–1735. [Google Scholar] [CrossRef]
- Liu, J.; Corroyer-Dulmont, S.; Prazak, V.; Khusainov, I.; Bahrami, K.; Welsch, S.; Vasishtan, D.; Obarska-Kosinska, A.; Thorkelsson, S.R.; Grunewald, K.; et al. The palisade layer of the poxvirus core is composed of flexible A10 trimers. Nat. Struct. Mol. Biol. 2024, 31, 1105–1113. [Google Scholar] [CrossRef]
- Ren, S.; Ur Rehman, Z.; Gao, B.; Yang, Z.; Zhou, J.; Meng, C.; Song, C.; Nair, V.; Sun, Y.; Ding, C. ATM-mediated DNA double-strand break response facilitated oncolytic Newcastle disease virus replication and promoted syncytium formation in tumor cells. PLoS Pathog. 2020, 16, e1008514. [Google Scholar] [CrossRef]
- Hoang, H.D.; Neault, S.; Pelin, A.; Alain, T. Emerging translation strategies during virus-host interaction. Wiley Interdiscip. Rev. RNA 2021, 12, e1619. [Google Scholar] [CrossRef] [PubMed]
- Strnadova, P.; Ren, H.; Valentine, R.; Mazzon, M.; Sweeney, T.R.; Brierley, I.; Smith, G.L. Inhibition of Translation Initiation by Protein 169: A Vaccinia Virus Strategy to Suppress Innate and Adaptive Immunity and Alter Virus Virulence. PLoS Pathog. 2015, 11, e1005151. [Google Scholar] [CrossRef] [PubMed]
- Zhan, Y.; Yu, S.; Yang, S.; Qiu, X.; Meng, C.; Tan, L.; Song, C.; Liao, Y.; Liu, W.; Sun, Y.; et al. Newcastle Disease virus infection activates PI3K/Akt/mTOR and p38 MAPK/Mnk1 pathways to benefit viral mRNA translation via interaction of the viral NP protein and host eIF4E. PLoS Pathog. 2020, 16, e1008610. [Google Scholar] [CrossRef]
- Thoms, M.; Buschauer, R.; Ameismeier, M.; Koepke, L.; Denk, T.; Hirschenberger, M.; Kratzat, H.; Hayn, M.; Mackens-Kiani, T.; Cheng, J.; et al. Structural basis for translational shutdown and immune evasion by the Nsp1 protein of SARS-CoV-2. Science 2020, 369, 1249–1255. [Google Scholar] [CrossRef] [PubMed]
- Meade, N.; DiGiuseppe, S.; Walsh, D. Translational control during poxvirus infection. Wiley Interdiscip. Rev. RNA 2019, 10, e1515. [Google Scholar] [CrossRef]
- Park, C.; Walsh, D. RACK1 Regulates Poxvirus Protein Synthesis Independently of Its Role in Ribosome-Based Stress Signaling. J. Virol. 2022, 96, e0109322. [Google Scholar] [CrossRef] [PubMed]
- Stern-Ginossar, N.; Thompson, S.R.; Mathews, M.B.; Mohr, I. Translational Control in Virus-Infected Cells. Cold Spring Harb. Perspect. Biol. 2019, 11, a033001. [Google Scholar] [CrossRef]
- Brugier, A.; Hafirrassou, M.L.; Pourcelot, M.; Baldaccini, M.; Kril, V.; Couture, L.; Kummerer, B.M.; Gallois-Montbrun, S.; Bonnet-Madin, L.; Vidalain, P.O.; et al. RACK1 Associates with RNA-Binding Proteins Vigilin and SERBP1 to Facilitate Dengue Virus Replication. J. Virol. 2022, 96, e0196221. [Google Scholar] [CrossRef]
- Cui, N.; Han, X.; Yang, X.; Zhao, X.; Huang, Q.; Xu, C.; Su, S. Avian leukosis virus usurps the cellular SERBP1 protein to enhance its transcription and promote productive infections in avian cells. Poult. Sci. 2024, 103, 103755. [Google Scholar] [CrossRef]
- Jha, S.; Rollins, M.G.; Fuchs, G.; Procter, D.J.; Hall, E.A.; Cozzolino, K.; Sarnow, P.; Savas, J.N.; Walsh, D. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase. Nature 2017, 546, 651–655. [Google Scholar] [CrossRef] [PubMed]
- Kosti, A.; de Araujo, P.R.; Li, W.Q.; Guardia, G.D.A.; Chiou, J.; Yi, C.; Ray, D.; Meliso, F.; Li, Y.M.; Delambre, T.; et al. The RNA-binding protein SERBP1 functions as a novel oncogenic factor in glioblastoma by bridging cancer metabolism and epigenetic regulation. Genome Biol. 2020, 21, 195. [Google Scholar] [CrossRef]
- Muto, A.; Sugihara, Y.; Shibakawa, M.; Oshima, K.; Matsuda, T.; Nadano, D. The mRNA-binding protein Serbp1 as an auxiliary protein associated with mammalian cytoplasmic ribosomes. Cell Biochem. Funct. 2018, 36, 312–322. [Google Scholar] [CrossRef] [PubMed]
- Ahn, J.W.; Kim, S.; Na, W.; Baek, S.J.; Kim, J.H.; Min, K.; Yeom, J.; Kwak, H.; Jeong, S.; Lee, C.; et al. SERBP1 affects homologous recombination-mediated DNA repair by regulation of CtIP translation during S phase. Nucleic Acids Res. 2015, 43, 6321–6333. [Google Scholar] [CrossRef] [PubMed]
- Brown, A.; Baird, M.R.; Yip, M.C.; Murray, J.; Shao, S. Structures of translationally inactive mammalian ribosomes. eLife 2018, 7, e40486. [Google Scholar] [CrossRef]
- Greseth, M.D.; Traktman, P. The Life Cycle of the Vaccinia Virus Genome. Annu. Rev. Virol. 2022, 9, 239–259. [Google Scholar] [CrossRef] [PubMed]
- Coulibaly, F. Structure of the poxvirus core. Nat. Struct. Mol. Biol. 2024, 31, 1001–1003. [Google Scholar] [CrossRef] [PubMed]
- Moss, B. Poxvirus membrane biogenesis. Virology 2015, 479–480, 619–626. [Google Scholar] [CrossRef] [PubMed]
- Hollinshead, M.; Rodger, G.; Van Eijl, H.; Law, M.; Hollinshead, R.; Vaux, D.J.; Smith, G.L. Vaccinia virus utilizes microtubules for movement to the cell surface. J. Cell Biol. 2001, 154, 389–402. [Google Scholar] [CrossRef]
- Cudmore, S.; Blasco, R.; Vincentelli, R.; Esteban, M.; Sodeik, B.; Griffiths, G.; Krijnse Locker, J. A vaccinia virus core protein, p39, is membrane associated. J. Virol. 1996, 70, 6909–6921. [Google Scholar] [CrossRef]
- Letafati, A.; Sakhavarz, T. Monkeypox virus: A review. Microb. Pathog. 2023, 176, 106027. [Google Scholar] [CrossRef]
- Xue, B.; Hou, G.; Zhang, G.; Huang, J.; Li, L.; Nan, Y.; Mu, Y.; Wang, L.; Zhang, L.; Han, X.; et al. MYH9 Aggregation Induced by Direct Interaction With PRRSV GP5 Ectodomain Facilitates Viral Internalization by Permissive Cells. Front. Microbiol. 2019, 10, 2313. [Google Scholar] [CrossRef]
- Arii, J.; Goto, H.; Suenaga, T.; Oyama, M.; Kozuka-Hata, H.; Imai, T.; Minowa, A.; Akashi, H.; Arase, H.; Kawaoka, Y.; et al. Non-muscle myosin IIA is a functional entry receptor for herpes simplex virus-1. Nature 2010, 467, 859–862. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Cheng, C.; Huang, J.; Yan, W.; Wen, Y.; Liu, Z.; Zhou, B.; Guo, S.; Fang, W. MYH9: A key protein involved in tumor progression and virus-related diseases. Biomed. Pharmacother. 2024, 171, 116118. [Google Scholar] [CrossRef] [PubMed]
- Liang, J.; Ruthel, G.; Freedman, B.D.; Harty, R.N. WWOX-Mediated Degradation of AMOTp130 Negatively Affects Egress of Filovirus VP40 Virus-Like Particles. J. Virol. 2022, 96, e0202621. [Google Scholar] [CrossRef]
- Mercenne, G.; Alam, S.L.; Arii, J.; Lalonde, M.S.; Sundquist, W.I. Angiomotin functions in HIV-1 assembly and budding. eLife 2015, 4, e03778. [Google Scholar] [CrossRef]
Gene | Sequence |
---|---|
(Human) HIF1α-F | TTTTGGCAGCAACGACACAG |
(Human) HIF1α-R | GCGTTTCAGCGGTGGGTAAT |
(Human) CCL2-F | TCAAACTGAAGCTCGCACTCT |
(Human) CCL2-R | GGGGCATTGATTGCATCTGG |
(Human) FAS-F | GTACGGAGTTGGGGAAGCTC |
(Human) FAS-R | TTGATGTCAGTCACTTGGGCA |
(Human) IGSF11-F | CTCTCTCTGCACGGTGTTGC |
(Human) IGSF11-R | CATTGGAGAGAGGAGTGACCA |
(Human) IFIH1-F | TCCATCGTTTGAGAACGCTCAT |
(Human) IFIH1-R | CTGCAGCAGCAATCCGGT |
(Human) RAB3A-F | AAAAGTCACCGCCGCTAGG |
(Human) RAB3A-R | CTGCTGTTGCCGATGATGAG |
(Human) H2AC17-F | TAGGCCACAGGTCGTTTTACC |
(Human) H2AC17-R | CGTAGTTGCCCTTGCGGA |
(Human) L1CAM-F | AGGTCCCTGGAGAGTGACAA |
(Human) L1CAM-R | TACTGGCCAATGAACGAACCA |
(Human) AKT-F | CCACACACTCACCGAGAACC |
(Human) AKT-R | ACAGGTGGAAGAACAGCTCG |
(Human) profilin1-F | ACGCCTACATCGACAACCTC |
(Human) profilin1-R | CCTCAGCTGGCGTGATGT |
Accession | Score Sequest | Gene Symbol | Abundances (Control) | Abundances (A5L) | Fold |
---|---|---|---|---|---|
P55795 | 54.53 | HNRNPH2 | 23,845,270.8 | ||
Q9NSB2 | 31.28 | KRT84 | 70,055,553.6 | ||
P14649 | 21.06 | MYL6B | 53,201,279.2 | ||
P62879 | 15.98 | GNB2 | 21,537,638.7 | ||
P12814 | 10.43 | ACTN1 | 12,930,232 | ||
Q9UHB6 | 7.13 | LIMA1 | 54,735,281.5 | ||
Q15027 | 6.55 | ACAP1 | 78,746,156.2 | ||
Q9BY77 | 5.8 | POLDIP3 | 24,037,837.6 | ||
Q96EY4 | 5.36 | TMA16 | 17,209,636 | ||
P35611 | 4.67 | ADD1 | 22,683,268.1 | ||
P22695 | 4.57 | UQCRC2 | 7,952,299.99 | ||
Q02241 | 4.16 | KIF23 | 17,128,696.1 | ||
O00159 | 3.82 | MYO1C | 30,334,815.4 | ||
P08758 | 2.96 | ANXA5L | 11,660,744.3 | ||
P34897 | 2.82 | SHMT2 | 18,363,483.3 | ||
O75251 | 2.74 | NDUFS7 | 15,064,159.9 | ||
Q13523 | 2.72 | PRPF4B | 10,888,648 | ||
Q9BXS6 | 2.67 | NUSAP1 | 18,715,571.1 | ||
Q01650 | 2.62 | SLC7A5L | 16,038,306.4 | ||
O15479 | 2.55 | MAGEB2 | 38,857,514.5 | ||
Q9UBM7 | 2.55 | DHCR7 | 25,483,125.7 | ||
Q13823 | 2.41 | GNL2 | 20,441,894.6 | ||
O94973 | 2.32 | AP2A2 | 22,010,896.8 | ||
P17028 | 2.32 | ZNF24 | 7,071,781.83 | ||
Q52LG2 | 2.29 | KRTAP13-2 | 22,968,729.9 | ||
P60953 | 2.2 | CDC42 | 12,173,080.3 | ||
P08174 | 2.2 | CD55 | 47,053,652.5 | ||
P27797 | 2.18 | CALR | 22,827,932.9 | ||
Q9UHI6 | 2.13 | DDX20 | 7,576,214.22 | ||
Q9NWT1 | 2.06 | PAK1IP1 | 11,007,573.8 | ||
Q8WXE9 | 1.99 | STON2 | 24,510,051.4 | ||
Q9BQG1 | 1.98 | SYT3 | 18,873,985.1 | ||
P14210 | 1.94 | HGF | 19,177,626.6 | ||
P49257 | 1.93 | LMAN1 | 24,788,012.4 | ||
Q9UQ88 | 1.91 | CDK11A | 8,636,393.03 | ||
Q15005 | 1.9 | SPCS2 | 5,468,154.27 | ||
Q15323 | 1.88 | KRT31 | 60,750,663.2 | ||
P62330 | 1.88 | ARF6 | 28,647,802.5 | ||
P33992 | 1.87 | MCM5 | 7,625,153.14 | ||
Q96S97 | 1.86 | MYADM | 20,177,422.3 | ||
Q15046 | 1.86 | KARS1 | 9,191,269.95 | ||
O00178 | 1.83 | GTPBP1 | 26,055,539.3 | ||
Q9Y490 | 1.79 | TLN1 | 5,969,742.46 | ||
Q96M91 | 1.77 | CFAP53 | 76,472,193.3 | ||
Q15654 | 1.76 | TRIP6 | 17,252,038.1 | ||
Q9P2M7 | 1.73 | CGN | 12,664,620.7 | ||
O75915 | 1.68 | ARL6IP5 | 31,787,231.5 | ||
Q93008 | 1.68 | USP9X | 7,286,550.55 | ||
P35241 | 1.65 | RDX | 19,958,722.5 | ||
Q9H307 | 1.63 | PNN | 6,374,994.83 | ||
P48200 | 1.63 | IREB2 | 11,872,727.6 | ||
Q96QK1 | 1.61 | VPS35 | 13,607,837.2 | ||
Q96A26 | 1.61 | FAM162A | 19,597,430.9 | ||
Q15056 | 1.61 | EIF4H | 6,669,397.13 | ||
P35579 | 1106.8 | MYH9 | 7.6 × 109 | 3.8008 × 1010 | 4.997828 |
P19338 | 393.64 | NCL | 4.32 × 109 | 2.1659 × 1010 | 5.010884 |
P35580 | 718.97 | MYH10 | 2.3 × 109 | 1.0792 × 1010 | 4.686061 |
Q4VCS5 | 320.95 | AMOT | 1.7 × 109 | 7,871,429,678 | 4.636524 |
P62917 | 185.85 | RPL8 | 1.78 × 109 | 7,114,210,016 | 4.003225 |
P62906 | 121.24 | RPL10A | 8.49 × 108 | 5,080,928,660 | 5.987087 |
P18124 | 119.19 | RPL7 | 7.35 × 108 | 5,258,908,054 | 7.157648 |
P62424 | 118.83 | RPL7A | 5.53 × 108 | 3,868,490,859 | 6.998979 |
Q13813 | 109.9 | SPTAN1 | 3.8 × 108 | 1,852,745,858 | 4.874794 |
P39023 | 105.74 | RPL3 | 4.8 × 108 | 4,126,009,236 | 8.593177 |
P36578 | 104.96 | RPL4 | 5.6 × 108 | 3,130,805,766 | 5.590338 |
Q8NC51 | 100.27 | SERBP1 | 5.29 × 108 | 2,247,852,488 | 4.252472 |
P62241 | 85.38 | RPS8 | 9.77 × 108 | 6,094,990,507 | 6.237919 |
P62266 | 84.37 | RPS23 | 3.6 × 108 | 1,797,616,211 | 4.998203 |
Q07065 | 71.21 | CKAP4 | 1.68 × 108 | 794,929,264 | 4.719978 |
P62753 | 70.84 | RPS6 | 5.11 × 108 | 2,638,295,624 | 5.158366 |
Q07020 | 69.52 | RPL18 | 4.68 × 108 | 3,943,925,150 | 8.431103 |
P61313 | 66.41 | RPL15 | 4.07 × 108 | 3,923,911,952 | 9.630158 |
P26373 | 65.09 | RPL13 | 2.44 × 108 | 3,306,516,447 | 13.55998 |
Q02878 | 63.03 | RPL6 | 3.75 × 108 | 1,579,582,645 | 4.213828 |
P46777 | 62.53 | RPL5 | 3.06 × 108 | 1,550,140,466 | 5.058458 |
P61353 | 62.24 | RPL27 | 3.83 × 108 | 3,286,606,950 | 8.57408 |
P62888 | 55.07 | RPL30 | 3.32 × 108 | 1,832,429,225 | 5.517408 |
Q9UNX3 | 52.15 | RPL26L1 | 4,933,386 | 23,405,671.6 | 4.744343 |
P27635 | 51.33 | RPL10 | 2.26 × 108 | 943,176,519 | 4.177723 |
Q02543 | 51.22 | RPL18A | 4.56 × 108 | 2,303,106,278 | 5.051142 |
Q9Y3U8 | 49.59 | RPL36 | 5.96 × 108 | 3,349,708,990 | 5.618173 |
P62854 | 45.66 | RPS26 | 1.99 × 108 | 1,494,638,724 | 7.527102 |
Q9UM54 | 45.24 | MYO6 | 63,204,009 | 734,670,570 | 11.6238 |
Q92522 | 44.99 | H1-10 | 1.63 × 108 | 678,302,362 | 4.173634 |
P46776 | 43.04 | RPL27A | 3.6 × 108 | 1,757,091,613 | 4.884333 |
Q01082 | 42.52 | SPTBN1 | 70771524 | 566,802,222 | 8.008902 |
P62910 | 41.13 | RPL32 | 2.87 × 108 | 1,269,884,943 | 4.431853 |
P53621 | 41.12 | COPA | 1.46 × 108 | 724,068,452 | 4.953142 |
P46087 | 36.96 | NOP2 | 1.07 × 108 | 1,173,149,722 | 10.98216 |
Q08170 | 32.18 | SRSF4 | 2.52 × 108 | 1,535,299,732 | 6.084086 |
Q16643 | 30.41 | DBN1 | 31,211,853 | 767,446,859 | 24.58831 |
P61513 | 28.38 | RPL37A | 2.3 × 108 | 1,238,388,622 | 5.394924 |
P31946 | 27.98 | YWHAB | 7,652,528 | 77,359,209.5 | 10.10898 |
O94832 | 25.9 | MYO1D | 2,752,137 | 357,771,870 | 129.9978 |
Q9NQ29 | 25.17 | LUC7L | 5,746,320 | 23,316,664.9 | 4.057669 |
O43795 | 25.12 | MYO1B | 47,966,804 | 449,804,703 | 9.377417 |
P12277 | 23.32 | CKB | 79,100,780 | 350,631,774 | 4.432722 |
E9PAV3 | 22.7 | NACA | 54,653,562 | 494,198,804 | 9.04239 |
P46779 | 21.98 | RPL28 | 97,888,915 | 544,056,692 | 5.557899 |
Q8N3R9 | 19.26 | PALS1 | 20,378,481 | 154,737,012 | 7.593157 |
P08754 | 19.24 | GNAI3 | 60,146,303 | 479,782,974 | 7.976932 |
P50914 | 19.15 | RPL14 | 1.78 × 108 | 1,393,870,977 | 7.83708 |
P40429 | 19.01 | RPL13A | 1.89 × 108 | 1,509,570,649 | 7.967573 |
P49207 | 18.93 | RPL34 | 3.87 × 108 | 2,066,637,763 | 5.346116 |
Q9UMS4 | 17.92 | PRPF19 | 1.35 × 108 | 661,151,564 | 4.913278 |
P42766 | 16.42 | RPL35 | 1.73 × 108 | 828,704,701 | 4.791414 |
O95793 | 16.04 | STAU1 | 34,599,041 | 146,473,177 | 4.233446 |
Q9P2E9 | 15.7 | RRBP1 | 36,221,922 | 171,298,674 | 4.729144 |
Q15149 | 14.76 | PLEC | 13,070,259 | 222,413,318 | 17.01675 |
Q9H7B2 | 14.29 | RPF2 | 12565969 | 145,092,561 | 11.54647 |
P61006 | 14.02 | RAB8A | 2,400,302 | 16,719,589.6 | 6.965618 |
Q13610 | 13.96 | PWP1 | 18,865,848 | 141,208,069 | 7.484852 |
P62633 | 13.76 | CNBP | 23,925,131 | 176,695,010 | 7.385331 |
O43707 | 13.27 | ACTN4 | 24,205,268 | 136,102,708 | 5.622855 |
P47914 | 13.01 | RPL29 | 5.9 × 108 | 2,512,280,276 | 4.256594 |
P13987 | 12.93 | CD59 | 33,261,676 | 215,455,509 | 6.47759 |
Q8TDN6 | 12.65 | BRIX1 | 10,376,578 | 168,688,087 | 16.25662 |
Q04637 | 10.76 | EIF4G1 | 29,253,382 | 146,869,232 | 5.02059 |
P08621 | 9.91 | SNRNP70 | 23,918,842 | 160,794,203 | 6.722491 |
Q9BZE4 | 9.69 | GTPBP4 | 30,334,456 | 218,282,534 | 7.195861 |
Q9Y678 | 9.66 | COPG1 | 14,504,055 | 58,685,143.1 | 4.04612 |
Q8NE71 | 9.47 | ABCF1 | 9,205,467 | 48,876,803.4 | 5.309541 |
Q07157 | 9.45 | TJP1 | 9,895,750 | 53,372,921.9 | 5.39352 |
Q9BQG0 | 8.69 | MYBBP1A | 26,923,852 | 147,077,400 | 5.462718 |
O43242 | 8.51 | PSMD3 | 24,866,727 | 121,259,423 | 4.876372 |
P49756 | 8.1 | RBM25 | 12,400,093 | 88,151,215.8 | 7.108916 |
O75400 | 7.98 | PRPF40A | 27,402,617 | 116,759,966 | 4.260906 |
Q14684 | 7.93 | RRP1B | 69,654,704 | 353,008,391 | 5.067976 |
P08243 | 7.75 | ASNS | 16,356,520 | 223,274,864 | 13.65051 |
Q9Y2X3 | 7.6 | NOP58 | 3,452,465 | 59,794,539.1 | 17.31938 |
P05455 | 7.34 | SSB | 13,230,934 | 94,151,395.8 | 7.116005 |
Q01105 | 7.24 | SET | 32,879,772 | 135,036,667 | 4.106983 |
Q9NW13 | 7 | RBM28 | 8,323,326 | 100,335,155 | 12.05469 |
P42696 | 6.65 | RBM34 | 8,732,097 | 40,401,561.4 | 4.626788 |
Q5JWF2 | 6.47 | GNAS | 4,735,516 | 74,347,665.1 | 15.70001 |
Q8IY81 | 6.47 | FTSJ3 | 3,963,930 | 44,935,915.6 | 11.3362 |
Q9NX58 | 6.36 | LYAR | 11718590 | 65,237,865.7 | 5.567041 |
P63000 | 5.98 | RAC1 | 18,650,276 | 99,502,685.4 | 5.335186 |
P61221 | 5.79 | ABCE1 | 15,830,286 | 150,435,816 | 9.503039 |
P62891 | 5.71 | RPL39 | 29,916,276 | 163,424,396 | 5.462725 |
Q96CW1 | 5.68 | AP2M1 | 13,251,519 | 61,822,112 | 4.665285 |
P40939 | 5.47 | HADHA | 13,623,453 | 67,584,883.9 | 4.960922 |
Q9BRJ6 | 5.46 | C7orf50 | 19,859,188 | 95,007,628.2 | 4.784064 |
Q9H9B4 | 5.06 | SFXN1 | 9,005,179 | 216,387,269 | 24.0292 |
Q86VP6 | 5.04 | CAND1 | 8,920,870 | 66,555,261.6 | 7.460625 |
Q6P2Q9 | 5.03 | PRPF8 | 2,161,177 | 38,374,317.9 | 17.75621 |
P46940 | 4.91 | IQGAP1 | 7,938,699 | 109,080,082 | 13.7403 |
Q9Y295 | 4.81 | DRG1 | 4747110 | 19,024,856.7 | 4.007671 |
Q13642 | 4.8 | FHL1 | 2,702,271 | 45,495,752.3 | 16.83612 |
Q9BUJ2 | 4.76 | HNRNPUL1 | 9,271,129 | 58,503,614.9 | 6.310301 |
O14654 | 4.56 | IRS4 | 6,215,177 | 50,639,493.4 | 8.147716 |
O60763 | 4.52 | USO1 | 4,183,194 | 24,127,383.2 | 5.767694 |
O75643 | 4.44 | SNRNP200 | 9,569,121 | 70,538,432.2 | 7.371464 |
O43592 | 4.27 | XPOT | 5,525,361 | 30,283,421.8 | 5.480805 |
Q86UP2 | 4.24 | KTN1 | 12,269,741 | 77,750,053.4 | 6.336731 |
Q9P2J5 | 4.2 | LARS1 | 18,835,668 | 82,710,799.8 | 4.39118 |
Q86VM9 | 3.96 | ZC3H18 | 2,471,121 | 24,366,387.4 | 9.860458 |
O76094 | 3.95 | SRP72 | 9,620,050 | 41,076,561.6 | 4.269891 |
Q9UKD2 | 3.95 | MRTO4 | 7,057,619 | 78,872,065.8 | 11.17545 |
Q14697 | 3.56 | GANAB | 9,795,123 | 61,834,988.6 | 6.312834 |
P53396 | 3.37 | ACLY | 6,139,189 | 28,311,705.6 | 4.611636 |
Q01780 | 2.86 | EXOSC10 | 3,204,284 | 16,656,062.6 | 5.198061 |
Q86UE4 | 2.71 | MTDH | 8,321,409 | 35,187,694.4 | 4.228574 |
P63151 | 2.62 | PPP2R2A | 5,711,416 | 36,989,877.6 | 6.476481 |
Q9NZM5 | 2.61 | NOP53 | 5,430,802 | 30,995,616 | 5.707374 |
O75369 | 2.57 | FLNB | 2,276,534 | 61,851,286.7 | 27.16906 |
Q8NI35 | 2.39 | PATJ | 3,567,723 | 48,585,809.7 | 13.61816 |
Q03701 | 2.18 | CEBPZ | 4,374,025 | 17,743,194.8 | 4.056491 |
Q92896 | 2.18 | GLG1 | 800,199.9 | 4,717,955.06 | 5.89597 |
Q9Y4P3 | 2.17 | TBL2 | 5,922,978 | 43,983,036.8 | 7.425832 |
Q16630 | 2.16 | CPSF6 | 11,481,576 | 50,123,009.6 | 4.365517 |
Q9H4G4 | 2.15 | GLIPR2 | 5,717,304 | 30,078,632.4 | 5.260982 |
O95831 | 2.13 | AIFM1 | 3,878,012 | 45,361,458.8 | 11.69709 |
P20290 | 2.08 | BTF3 | 6,736,184 | 28,957,538.5 | 4.298805 |
Q92558 | 2.01 | WASF1 | 1,504,043 | 7,875,298.01 | 5.236086 |
P13010 | 1.96 | XRCC5 | 1,067,594 | 24,486,127.9 | 22.93581 |
Q8NB91 | 1.91 | FANCB | 4.13 × 109 | 1.7678 × 1010 | 4.283121 |
Q9H0A0 | 1.9 | NAT10 | 5,435,425 | 42,088,224.7 | 7.743318 |
P78347 | 1.9 | GTF2I | 4,062,462 | 57,972,505.3 | 14.27029 |
P06493 | 1.83 | CDK1 | 9,830,338 | 97,019,514.9 | 9.869398 |
O00231 | 1.76 | PSMD11 | 6,285,229 | 36,586,283.9 | 5.820995 |
Q8TEX9 | 1.74 | IPO4 | 3,142,446 | 18,886,047 | 6.009983 |
Q14839 | 1.73 | CHD4 | 5,117,228 | 22,926,902 | 4.480337 |
Q5T8P6 | 1.63 | RBM26 | 3,233,657 | 14,625,610.8 | 4.522932 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, M.; Xiong, J.; Zhou, H.; Liu, J.; Wang, C.; Jia, M.; Wang, Y.; Zhang, N.; Chen, Y.; Zhong, T.; et al. Transcriptomic and Proteomic Analysis of Monkeypox Virus A5L-Expressing HEK293T Cells. Int. J. Mol. Sci. 2025, 26, 398. https://doi.org/10.3390/ijms26010398
Li M, Xiong J, Zhou H, Liu J, Wang C, Jia M, Wang Y, Zhang N, Chen Y, Zhong T, et al. Transcriptomic and Proteomic Analysis of Monkeypox Virus A5L-Expressing HEK293T Cells. International Journal of Molecular Sciences. 2025; 26(1):398. https://doi.org/10.3390/ijms26010398
Chicago/Turabian StyleLi, Mingzhi, Jiaqi Xiong, Hao Zhou, Jing Liu, Chenyi Wang, Mengle Jia, Yihao Wang, Nannan Zhang, Yanying Chen, Tao Zhong, and et al. 2025. "Transcriptomic and Proteomic Analysis of Monkeypox Virus A5L-Expressing HEK293T Cells" International Journal of Molecular Sciences 26, no. 1: 398. https://doi.org/10.3390/ijms26010398
APA StyleLi, M., Xiong, J., Zhou, H., Liu, J., Wang, C., Jia, M., Wang, Y., Zhang, N., Chen, Y., Zhong, T., Zhang, Z., Li, R., Zhang, Y., Guo, Y., Peng, Q., & Kong, L. (2025). Transcriptomic and Proteomic Analysis of Monkeypox Virus A5L-Expressing HEK293T Cells. International Journal of Molecular Sciences, 26(1), 398. https://doi.org/10.3390/ijms26010398