Next Article in Journal
Resting-State EEG Alpha Rhythms Are Related to CSF Tau Biomarkers in Prodromal Alzheimer’s Disease
Next Article in Special Issue
Phylogenetic Analysis of Chandipura virus: Insights from a Preliminary Genomic Study
Previous Article in Journal
The Putative Antidiabetic Effect of Hypericum perforatum on Diabetes Mellitus
Previous Article in Special Issue
Development of Primer Panels for Amplicon Sequencing of Human Parainfluenza Viruses Type 1 and 2
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nosocomial Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus: Sensitivity to Chlorhexidine-Based Biocides and Prevalence of Efflux Pump Genes

by
Marina V. Kuznetsova
1,2,
Larisa Y. Nesterova
3,
Veronika S. Mihailovskaya
1,
Polina A. Selivanova
1,
Darja A. Kochergina
1,
Marina O. Karipova
2,
Igor V. Valtsifer
4,
Anastasia S. Averkina
4 and
Marjanca Starčič Erjavec
5,6,*
1
Laboratory of Molecular Biotechnology, Institute of Ecology and Genetics of Microorganisms Ural Branch Russian Academy of Sciences, Perm Federal Research Centre of Ural Branch of RAS, 614081 Perm, Russia
2
Department of Microbiology and Virology, Perm State Medical University Named After Academician E. A. Wagner, 614000 Perm, Russia
3
Laboratory of Microorganisms’ Adaptation, Institute of Ecology and Genetics of Microorganisms Ural Branch Russian Academy of Sciences, Perm Federal Research Centre of Ural Branch of RAS, 614081 Perm, Russia
4
Department of Multiphase Dispersed System, Institute of Technical Chemistry Ural Branch Russian Academy of Sciences, Perm Federal Research Centre of Ural Branch of RAS, 614013 Perm, Russia
5
Department of Microbiology, Biotechnical Faculty, University of Ljubljana, 1000 Ljubljana, Slovenia
6
Department of Biology, Faculty of Natural Sciences and Mathematics, University of Maribor, 2000 Maribor, Slovenia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(1), 355; https://doi.org/10.3390/ijms26010355
Submission received: 6 December 2024 / Revised: 30 December 2024 / Accepted: 31 December 2024 / Published: 3 January 2025
(This article belongs to the Special Issue New Advances in Medical Microbiology)

Abstract

The widespread use of disinfectants and antiseptics has led to the emergence of nosocomial pathogens that are less sensitive to these agents, which in combination with multidrug resistance (MDR) can pose a significant epidemiologic risk. We investigated the susceptibility of nosocomial Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus to a 0.05% chlorhexidine (CHX) solution and a biocidal S7 composite solution based on CHX (0.07%) and benzalkonium chloride (BAC, 0.055%). The prevalence of efflux pump genes associated with biocide resistance and their relationship to antibiotic resistance was also determined. Both biocides were more effective against Gram-positive S. aureus than Gram-negative bacteria. The most resistant strains were P. aeruginosa strains, which were mainly killed by 0.0016% CHX and by 0.0000084% (CHX)/0.0000066% (BAC) S7. The S7 bactericidal effect was observed on P. aeruginosa and S. aureus after 10 min, while the bactericidal effect of CHX was only observed after 30 min. qacEΔ1 and qacE efflux pump genes were prevalent among E. coli and K. pneumoniae, while mexB was more often detected in P. aeruginosa. norA, norB, mepA, mdeA, and sepA were prevalent in S. aureus. The observed prevalence of efflux pump genes highlights the potential problem whereby the sensitivity of bacteria to biocides could decline rapidly in the future.

1. Introduction

In recent years, the problem of increasing antimicrobial resistance among opportunistic and pathogenic microorganisms has become acute, as the prevalence of multidrug resistant (MDR) strains has increased [1,2,3]. An official World Health Organization multicenter study on the prevalence of nosocomial infections conducted in 50 clinics in 14 countries, representing four WHO regions (Europe, Eastern Mediterranean, South-East Asia and Western Pacific) found that 8.7% of hospitalized patients, i.e., over 1.4 million people worldwide, had nosocomial infections [4]. The treatment of such infections requires additional diagnostic and therapeutic measures, prolonging the duration of the patient’s hospital stay and leading to significant economic costs. In addition, nosocomial infections lead to a significant deterioration in the quality of life and increase the risk of an unfavorable course of the disease [5,6]. According to the WHO recommendations from 2024, the list of microorganisms that pose the greatest threat to society has expanded considerably. However, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus remain with high priority, since infections caused by multi- and pan-resistant forms of these bacteria are associated with high patient mortality [7].
The problem of nosocomial infections of patients due to contaminated environmental surfaces is of utmost importance for hospitals, especially for intensive care units [5,8]. Therefore, the treatment of biotic (hands of medical staff) and abiotic (medical equipment) surfaces with various antiseptics and disinfectants is a necessary part of the infection control program and prevention of nosocomial infections [9,10]. The WHO Model List of Essential Medicines (EML) 2021 [11] includes essential products as disinfectants, most of which contain chlorhexidine (CHX), a biguanide derivative. In addition, many other products, such as alcohols, iodine, povidone iodine, and quaternary ammonium compounds (QACs) are used. CHX is a lipophilic and positively charged compound and can therefore interact with negatively charged phospholipids and lipopolysaccharides of the bacterial cell wall and outer membrane. Low concentrations of this compound impair membrane integrity, whereas high concentrations cause the congealing of cytoplasm, which ultimately leads to cell death [12]. QACs, which are often used as disinfectants, can attach to the bacterial cell wall due to their positive charge, which causes cell lysis. However, the widespread use of antiseptics and disinfectants (including in public facilities and healthcare settings during the COVID-19 pandemic) has led to the emergence of resistant strains of microorganisms, which, combined with multidrug resistance, can pose a significant threat [13].
One of the main mechanisms of bacterial resistance to biocides is the expression of efflux pumps. There are six families of efflux systems: major facilitator superfamily (MFS), multidrug and toxic compound extrusion (MATE) superfamily, ATP-binding cassette (ABC) superfamily, small multidrug resistance (SMR) superfamily, resistance nodulation and cell division (RND) superfamily, and the proteobacterial antimicrobial compound efflux (PACE) superfamily [14]. Most of them are able to transport various antibacterial substances out of the cell. For example, the AcrAB-TolC multidrug RND efflux pump system controls the efflux of antibiotics and biocides, including CHX [15]. The QacE and QacEΔ1 efflux pumps (SMR superfamily) can efflux QACs and CHX, and their overexpression has been associated with increased CHX MIC in E. coli biofilms [16]. The MFS family includes EmrAB-TolC and QacA/B, the latter of which can mediate the transport of antibiotics and biocides such as CHX and QACs in staphylococci [17]. Importantly, efflux pump genes associated with biocide resistance can be located not only on the chromosome (emrE, mdfA, sugE, ydgE, and ydgF), but also on mobile genetic elements such as plasmids, integrons, and transposons (oqxA, oqxB, qacEΔ1, qacE, qacF/H/I, qacG, and sugE) [18]. Moreover, efflux pump genes can be localized on the same mobile elements as antibiotic resistance genes, leading to cross- or co-resistance to antiseptics, disinfectants, and antimicrobials [18]. In addition, bacteria form biofilms on surfaces, making them more resistant to biocides [19].
The aim of this study was to evaluate the susceptibility of nosocomial strains of E. coli, K. pneumoniae, P. aeruginosa, and S. aureus to CHX and to S7, a biocidal composition based on CHX and the cationic surfactant benzalkonium chloride (BAC), and to assess the prevalence of efflux pump genes associated with biocide resistance and to determine their association with the MDR bacterial phenotype.

2. Results

2.1. Assessment of Sensitivity to Biocidal Compositions and Detection of Efflux Pump Genes in Nosocomial E. coli

2.1.1. Sensitivity of E. coli Strains to Chlorhexidine-Based Biocidal Compositions

For the analyzed E. coli strains, in the case of the CHX standard solution, the median MICCHX and MBCCHX were 0.78% of the initial 0.05% CHX solution (which corresponded to a final concentration of CHX 0.00039%, i.e., 3.9 µg/mL) and 1.56% (0.00078%, i.e., 7.8 µg/mL), respectively. In the case of the S7 composite solution, the MICS7 and MBCS7 values were 0.00019% (or 0.00000013/0.00000010%, i.e., 0.0013/0.0010 µg/mL CHX/BAC) and 0.00038% (or 0.00000027/0.00000021%, i.e., 0.0027/0.0021 µg/mL CHX/BAC) of the initial solution, respectively (Figure 1a). Consequently, E. coli strains were more sensitive to the S7 composite solution than to the CHX solution.
When evaluating the effect of the CHX standard solution and the S7 composite solution on the one-day old biofilm (the median biomass of the daily biofilm was 0.123 OD570 units), 80.8% (21/26) of the E. coli strains (in the range from 3.6 × 102 to 2.8 × 105 CFU/mL) in the biofilm survived after CHX, while S7 had a bactericidal effect on all strains in the biofilm (Figure 1c). There was no correlation between biofilm biomass and survival after exposure to CHX (r = 0.04). No significant correlations were found between the MDR phenotype and the sensitivity to chlorhexidine-based biocidal compositions.

2.1.2. Efflux Pump Genes in E. coli Strains

The prevalence of the efflux pump genes qacE, qacEΔ1, oqxA, oqxB, and acrAB was 53.8 (14/26), 30.8 (8/26), 11.5 (3/26), 0, and 100%, respectively. In general, nosocomial E. coli more often carried either one (11/26, 42.3%) or three (10/26, 38.4%) of the listed genes, less often two (5/26, 19.2%). To assess the associations of efflux pump gene presence with the sensitivity to tested biocides, the E. coli strains were divided into two groups: strains with MBCCHX ≥ 1% of the initial solution and strains with MBCCHX < 1%. With the exception of oqxA, which was only found in the group of strains with MBCCHX ≥ 1%, the presence of efflux pump genes did not differ significantly between the two groups of strains (Figure 1d,e). MDR and non-MDR strains did not differ significantly in the total number of efflux pump genes (p = 0.27, t-test); however, MDR strains more frequently contained three efflux pump genes (Figure 1d). Among the MDR E. coli, qacEΔ1 was significantly more often detected (p < 0.05, Fisher’s exact test).

2.2. Assessment of Sensitivity to Biocidal Compositions and Detection of Efflux Pump Genes in Nosocomial K. pneumoniae

2.2.1. Sensitivity of K. pneumoniae Strains to Chlorhexidine-Based Biocidal Compositions

K. pneumoniae was characterized by high heterogeneity in sensitivity to biocidal compositions. The ranges of MICCHX and MBCCHX of the K. pneumoniae studied were 0.012–6.25% and 0.195–12.5% of the initial 0.05% CHX solution, respectively (which corresponded to the range of final concentrations of CHX 0.000006–0.00313%, i.e., 0.06–31.3 µg/mL and 0.000098–0.0625%, i.e., 0.98–625 µg/mL). MICS7 varied in the range of 0.003–0.25% (the median was 0.0000084/0.0000066% CHX/BAC, i.e., 0.084/0.066 µg/mL), MBCS7 varied in the range of 0.006–1.56% of the initial solution (the median MBCS7 was equal to MICS7) (Figure 2a).
K. pneumoniae strains differed in their ability to form biofilms. The range of OD570 values was 0.01–0.995. Most strains, 49.1%, were assigned to the group of moderate biofilm-forming (MBF) strains, while 42.1% of strains were assigned to the group of strong biofilm-forming (SBF) strains. One strain did not form a biofilm, and the remaining 7% of strains were classified as weak biofilm-forming (WBF) strains (Figure 3b). Only 5.3% (3/57) of K. pneumoniae strains were able to survive in biofilms after exposure to CHX, while S7 had a bactericidal effect on all strains in biofilms (Figure 2c). In our study, the formation of more massive biofilms did not correlate with the survival of bacteria in biofilms exposed to CHX. It was found that strains resistant to cefotaxime and strains with the MDR phenotype had higher values of MICCHX and MBCCHX (p < 0.05, t-test).

2.2.2. Efflux Pump Genes in K. pneumoniae Strains

The prevalence of nosocomial K. pneumoniae containing various efflux pumps was high. Specifically, 87.7% of strains carried cepA and acrAB genes, 82.5% carried oqxB, 77.2% carried oqxA, 47.4% carried qacEΔ1, and 42.1% carried qacE. Strains with four efflux pump genes (38.6%), as well as strains with all studied efflux pump genes (31.6%), were detected more often. The strains were divided into two groups: strains with MBCCHX ≥ 1% of the initial solution and strains with MBCCHX < 1%. There was no correlation between the number of efflux pump genes or the presence of a particular efflux pump gene and the ability to survive the addition of CHX in concentrations exceeding 1% of the initial solution. However, it is important to note that an association with multidrug resistance was found. MDR strains contained more efflux pump genes per strain than non-MDR K. pneumoniae (p = 0.042, t-test) (Figure 1d). The qacE gene was only found among MDR K. pneumoniae, and qacEΔ1 was also significantly more often detected in this group (p < 0.05, Fisher’s exact test). The prevalence of other efflux pump genes did not differ between these groups.

2.3. Assessment of Sensitivity to Biocidal Compositions and Detection of Efflux Pump Genes in Nosocomial P. aeruginosa

2.3.1. Sensitivity of P. aeruginosa Strains to Chlorhexidine-Based Biocidal Compositions

For P. aeruginosa strains, the MICCHX values were in the range of 0.39–6.25% for the initial 0.05% CHX solution (which corresponded to the range of final concentrations of CHX 0.000195–0.003125, i.e., 1.95–31.3 µg/mL). To achieve a bactericidal effect, the CHX concentration had to be increased by an average of 2-fold: MBCCHX ranged from 3.125 to 12.5% for the initial CHX solution (0.000195–0.00625%, i.e., 1.95–62.5 µg/mL). Similar, to previous results, the P. aeruginosa strains showed greater sensitivity to the S7 composite solution than to CHX: the medians MICS7 and MBCS7 corresponded to 0.024% of the initial solution (or 0.000017/0.000013% CHX/BAC, i.e., 0.17/0.13 µg/mL) (p < 0.001, t-test) (Figure 3a).
P. aeruginosa strains were characterized by high variability in their ability to form biofilms (OD570 values ranged from 0.106 to 3.125), while most strains were classified as SBF (Figure 3b). Here, 32% (9/28) of P. aeruginosa remained viable when exposed to CHX on the formed biofilms, and the average survival rate was (5.6 ± 10) × 102 CFU/mL. S7 had a bactericidal effect on all strains in biofilms (Figure 3c). No significant correlation was found between the ability to form biofilms and survival in biofilms after exposure to biocides (r = 0.15). No significant correlation was found between MDR phenotype and sensitivity to chlorhexidine-based biocidal compositions.

2.3.2. Efflux Pump Genes in P. aeruginosa Strains

Among the studied efflux pump genes, membrane multidrug exporter gene mexB was the most common, being present in 50% of strains. The efflux pump genes qacE, qacEΔ1, and oqxA were detected in 28.6%, 21.4%, and 3.6% of strains, respectively. oqxB and acrAB were not identified. P. aeruginosa strains were divided into the following groups according to their sensitivity to CHX: strains with MBCCHX < 2% and strains with MBCCHX ≥ 2%. The strains with MBCCHX ≥ 2% contained more efflux pump genes (p < 0.001, t-test) and carried the qacE gene significantly more often (p < 0.05, Fisher’s exact test). The qacEΔ1 gene was only detected in this group. The latter efflux pump gene was only detected in the group of strains with MBCCHX ≥ 2%. Among the MDR P. aeruginosa strains, the qacE gene was significantly more often detected (p < 0.05, Fisher’s exact test). The prevalence of other genes did not differ between MDR and non-MDR strains; however, three efflux pump genes were more often harbored in MDR strains (Figure 3d).

2.4. Assessment of Sensitivity to Biocidal Compositions and Detection of Efflux Pump Genes in Nosocomial S. aureus

2.4.1. Sensitivity of S. aureus Strains to Chlorhexidine-Based Biocidal Compositions

The MICCHX and MBCCHX S. aureus strains were in the range of 0.012–0.049% and 0.049–0.195% of the initial 0.05% CHX solution (the medians in terms of final CHX concentrations were 0.000006 and 0.000025%, i.e., 0.06–0.25 µg/mL), respectively. S. aureus showed significantly greater sensitivity to S7 than to CHX. The MICS7 value ranged from 0.000188 to 0.000375% (median was 0.000000132%/0.000000103 CHX/BAC, i.e., 0.0013/0.001 µg/mL) (p = 0.002, t-test) from the original composition, and the MBCS7 value ranged from 0.000188 to 0.0015% (median was 0.000000263/0.000000206% CHX/BAC, i.e., 0.0026/0.0021 µg/mL) (p < 0.001, t-test) (Figure 4a).
The majority of S. aureus strains were characterized by a weak ability to form biofilms (median OD570 was 0.158), and only two strains were classified as MBF (Figure 4b). After exposure to CHX, 15 S. aureus strains remained viable in the biofilm at (8.4 ± 14) × 102 CFU/mL. The use of S7 had a bactericidal effect on all strains (Figure 4c). The biofilm biomass and the survival rate of S. aureus in biofilms after exposure to CHX were weakly correlated (r = 0.278). No significant correlation was found between the MDR phenotype and sensitivity to chlorhexidine-based biocidal compositions.

2.4.2. Efflux Pump Genes in S. aureus Strains

Most S. aureus strains contained the multidrug efflux pump gene sepA (28/29, 96.6%) and MATE family efflux pump gene mepA (27/29, 93.1%). The norA, norB, and mdeA efflux pump genes were detected in 68.9 (20/29), 58.6, and 58.6% (17/29) of strains, respectively. The norC gene was detected in 6.9% (2/29), whereas the smr and qacA/B genes were not detected. The strains were divided into two groups: strains with MBCCHX = 0.03% and strains with MBCCHX < 0.03% of the initial solution. No correlation was found between the number of efflux pump genes or the presence of a particular efflux pump gene and the ability to survive the addition of CHX at concentrations exceeding 0.03% of the initial solution. Furthermore, no correlation with the MDR phenotype was found (Figure 4d).

2.5. Comparison of the Sensitivity of Nosocomial E. coli, K. pneumoniae, P. aeruginosa, and S. aureus to Chlorhexidine-Based Biocidal Compositions in Plankton and Biofilm

Gram-positive bacteria S. aureus had the greatest sensitivity to CHX and S7. CHX had a bactericidal effect at its final concentration of 0.000025%, while the effective concentration of CHX decreased by 100-fold when the S7 composite solution was used (Table 1). The bactericidal effect of CHX against E. coli and K. pneumoniae was similar, averaging 0.0008% (1.56% of the native solution). The most resistant microorganisms were P. aeruginosa. Cells were lysed in most cases in 0.0016% CHX (3.125% of the native solution), while the MBCCHX value for a number of strains was 0.003 (6.25% of the native solution). Evaluation of the effect of the biocidal compositions on the formed biofilms showed that bacteria of all species studied were able to survive in biofilms under the action of CHX: 21 of 26 strains of E. coli (80.8%), 3 of 57 K. pneumoniae (5.3%), 9 of 28 P. aeruginosa (32.1%), and 10 of 25 S. aureus (34.5%). After exposure to S7, the bacteria did not survive in the biofilms. In our study, the oqxA and oqxB genes were also detected in a large percentage of cases in K. pneumoniae strains (77.2% and 82.5%, respectively), while they were practically absent in E. coli (11.5 and 0%, respectively).

2.6. Sensitivity of Nosocomial E. coli, K. pneumoniae, P. aeruginosa, and S. aureus to Chlorhexidine-Based Biocidal Compositions on the Surface

The sensitivity of nosocomial bacterial strains to CHX and S7 was tested using an in situ model on “ceramic tiles” and “plastic” surfaces with two variants: those with immediate exposure to biocides (after application and drying of the bacterial suspension on the surface) and those with exposure of biofilms that have formed on the surfaces (a day after application of the bacterial suspension). The contact times of bacteria with biocides in the first variant was 10 min, 30 min and 1 h. In the second variant, the contact times were 1 h and 2 h. When evaluating the immediate effect of biocides, the bactericidal effect of CHX and S7 on E. coli, K. pneumoniae, and S. aureus, applied to the surface of “ceramic tiles” and “plastic”, was observed after a 10-min exposure to the biocide (Table 2). With regard to P. aeruginosa, the bactericidal effect of CHX on both surfaces occurred only after 30 min.
After daily exposure of bacterial suspensions on the surfaces, we recorded a high survival rate for K. pneumoniae, while E. coli, S. aureus and, surprisingly, P. aeruginosa died during the day when drying on the surface, and their numbers did not exceed 100 CFU/100 cm2. Nevertheless, treatment with biocides led to the complete removal of bacteria from the surface (Table 3).

3. Discussion

The widespread occurrence of biocide-tolerant bacteria is one of the main problems in the healthcare. In recent years, nosocomial infections associated with contaminated disinfectant solutions have been reported in all regions of the world. Most cases have been associated with water-based CHX, QACs, and the combination of CHX and a quaternary ammonium compound (QAC) [20]. Resistance of microorganisms to disinfectants in combination with resistance to antibiotics can lead to the spread of epidemically dangerous strains. In this regard, such microorganisms have been actively monitored recently, although not on a permanent basis [2,3]. One of the main mechanisms of bacterial defense against biocides are multidrug efflux pumps, which reduce the intracellular concentration of substances by removing them from the cell. Efflux pumps have specific substrates; however, some can pump out several different types of antimicrobial drugs, resulting in multidrug resistance [21]. Efflux pumps are involved in the modulation of bacterial behavior and virulence as well as in the maintenance of bacterial homeostasis under various stress factors in the host [22]. Therefore, it is essential to characterize the susceptibility of the ESKAPEE pathogens (E. coli, K. pneumoniae, P. aeruginosa, and S. aureus) to disinfectants and antiseptics (chlorhexidine bigluconate and a composite solution of chlorhexidine and a cationic surfactant) and antibiotics (beta-lactams, fluoroquinolones, and aminoglycosides) and to determine the prevalence of efflux pump genes associated with biocide resistance.
CHX is a broad-spectrum biocide that is effective against bacteria, fungi, and some protozoa. It is more effective against Gram-positive than Gram-negative bacteria, as the later have an outer membrane that restricts biocide penetration [17,23]. In addition, reduced biocidal efficacy may be related to a decrease in porin expression, changes in the composition of the bacterial cell membrane (proteins, fatty acids, and phospholipids), as well as changes in membrane potential [24]. Morrissey et al. reported the highest MIC values of CHX for E. coli, E. faecalis, and K. pneumoniae compared to other bacterial species [25]. However, Gram-positive bacteria can also be resistant to CHX. In a recent study, four S. aureus isolates were found to be tolerant to CHX with an MIC = 4 mg/mL (0.4%) [26]. In our study, CHX inhibited the growth of most nosocomial strains of E. coli, K. pneumoniae, P. aeruginosa, and S. aureus at low concentrations (MICCHX < 0.0008%). The same concentrations had a bactericidal effect, and the MIC was 0.0008% in most cases. The most resistant were P. aeruginosa, which were killed in most cases at 0.0016%. Gram-positive staphylococci were the most sensitive with an MBCCHX 100 times lower than that of pseudomonads. These data are consistent with the results of other studies in which CHX inhibited the growth of all microorganisms tested (E. coli, S. aureus, and P. aeruginosa, including MRSA, etc.) at a concentration of 0.0004%, and lower MICs were also found for Gram-positive bacteria [27]. According to another study, CHX completely lysed cells of E. coli and S. epidermidis at a higher concentration of 0.0031% [28]. The difference in concentrations is probably not only due to the different sensitivity of the cultures, but also to differences in the media and cultivation conditions, as well as the duration of exposure to the biocide. The 0.05% CHX solutions retain their efficacy against most nosocomial strains of various bacterial species even when diluted more than 50-fold. QAC has also been shown to have better activity against Gram-positive S. aureus than against Gram-negative E. coli [29]. However, tolerance to BAC was observed in almost 30% of S. aureus isolates, with a MIC of 0.0032% [26]. Our study showed that S7, which contains a higher concentration of CHX and BAC, effectively suppressed the growth of most microorganisms tested even at a 4000-fold dilution.
It is known that bacteria in biofilms are less sensitive to disinfectants than in the planktonic state [30,31]. In our study, the planktonic bacteria were killed when the biocides were diluted 50- to 1000-fold, while the cells of some strains in biofilms remained alive after one hour exposure to CHX, but not to S7. The greater resistance of Gram-negative bacteria to biocides compared to Gram-positive bacteria is not only due to the presence of an outer membrane, but also to the formation of more massive biofilms [32]. In a recent study, highly biofilm-forming isolates K. pneumoniae and P. aeruginosa were obtained from CHX-based handwash during microbiological surveillance of “in-use disinfectants” in a hospital in Varanasi (India) [19]. In our study, biofilms formed by P. aeruginosa were the most massive (OD570 = 0.958 ± 0.879), while most strains were categorized as SBF and were the most tolerant to CHX compared to other species. K. pneumoniae biofilms were less massive (OD570 = 0.430 ± 0.204). E. coli and S. aureus biofilm biomasses were similar (OD570 = 0.154 ± 0.107 and OD570 = 0.154 ± 0.033, respectively), but this parameter was more variable in E. coli. P. aeruginosa was identified as a strong biofilm producer [33]. CHX has been shown to stimulate the expression of the psl operon, which encodes an exopolysaccharide important for biofilm formation in P. aeruginosa via the LadS/GacSA pathway (c-di-GMP independence) [31]. It should be noted that most studies on the effect of CHX and CHX-containing biocides on biofilm formation and degradation are based on the assessment of biofilm biomass after staining with 0.1% crystal violet, measured spectrophotometrically at λ = 570 nm. Coles et al. reported that CHX can lead to a significant decrease in the massiveness of the total biofilm [27]. To assess the effect of biocides on biofilms, we counted the number of viable cells in the biofilm after one hour of exposure to biocides. The complete bactericidal effect of S7 on cells in biofilms was demonstrated for bacteria of all species. In the case of CHX, viable cells were preserved, but their number decreased by 3–6 orders of magnitude, which also corresponds to a biocidal effect or “sterilizing” effect [34]. Results by Fink et al. demonstrated that CHX in concentration of 3 MIC (0.06 mg mL−1) decreased viability of E. coli (3.5 log CFU cm−2) and S. aureus (3.8 log CFU cm−2) in biofilm [35]. As nosocomial bacteria frequently come into contact with CHX, bacterial adaptations are possible. It has already been shown that CHX in very low concentrations can reduce the viability of planktonic cells and protect against plankton growth. Since CHX in sub-MIC doses can stimulate biofilm formation, concern over the inappropriate use of cationic disinfectants is important [31]. It should be noted that statistical analysis did not reveal statistically significant correlations between biofilm biomass and bacterial survival following exposure to biocides for any species tested.
The most common mechanism of bacterial resistance to disinfectants and antiseptics is the expression of efflux systems. The disinfectant resistance genes qacE, qacEΔ1, and cepA have been detected in Gram-negative multidrug-resistant bacteria. Qac efflux pumps belong to the SMR superfamily and are named for their ability to confer resistance to QAC-based antiseptics [16]. These pumps have been shown to be important genetic biomarkers for predicting the presence of class 1 integrons, antiseptic tolerance, and environmental QAC contamination [36]. The qacE and qacEΔ1 genes were first described in K. pneumoniae in the 3′-conserved segment of an integron on plasmid R751 [37]. The qacEΔ1 gene is a modified form of qacE resulting from the insertion of a DNA segment containing the sulfonamide resistance gene near the 3′ end of the qacE gene. The cepA gene, which encodes a cation efflux pump, is known to be associated with CHX resistance in K. pneumoniae [38]. In a study on the resistance of clinical K. pneumoniae strains to BAC, the qacΔE1 gene was detected in 53–87.5% of bacteria [39,40]. Kosyakova et al. reported that the frequencies of qacE, qacEΔ1, and cepA in K. pneumoniae were 33.3, 23.3, and 83.3%, respectively [41]. In our study, similar results were obtained. Specifically, qacE, qacEΔ1, and cepA were prevalent in nosocomial K. pneumoniae with frequencies of 42.1%, 47.4%, and 87.7%, respectively. In P. aeruginosa, qacE and qacEΔ1 were not very common (28.6% and 21.4%, respectively). Low frequencies of the genes qacE (2.7%) and qacEΔ1 (10%) in P. aeruginosa were previously documented in Germany [42]. In multidrug-resistant P. aeruginosa, the qacE and qacEΔ1 genes were amplified in 1 (1.1%) and 34 (36.9%) isolates, respectively, in a recent study [43]. Other studies report higher prevalence of these genes. For example, qacEΔ1 was detected in 213 of 331 (64.4%) clinical isolates of P. aeruginosa in China [44]. In the work of Radmeh et al., the qacE and qacEΔ1 genes were detected simultaneously in 66% of isolates [45]. Previously, Kazama et al. identified the qacEΔ1 and qacE genes in 41 (65.1%) and 15 (23.8%) strains of clinical P. aeruginosa, respectively, while 14 of 15 strains with the qacE gene also possessed the qacEΔ1 gene [46]. In our study, 62.5% of qacE+ cultures also had qacEΔ1. In silico PCR showed that the primer for qacE does not anneal in the qacEΔ1 region, so we assume that these genes are indeed located in the 3′ segment of various integrons in the strains studied, as previously suggested by Kazama et al. [46]. Genes of the qac group have been shown to be frequently detected in association with genes for resistance to antibiotics of various groups, including β-lactams [42]. In our study, the qacE gene was only found among MDR K. pneumoniae and significantly more often among MDR P. aeruginosa. In MDR E. coli and K. pneumoniae, qacEΔ1 was also significantly more frequent.
The three-component pumps OqxAB, AcrAB-TolC, and MexAB-OprM belong to the RND superfamily, the most important family of efflux pumps in Gram-negative bacteria. Recently, the role of the OqxA and OqxB pumps has increased. The oqxA and oqxB genes can be located on plasmids and are often associated with resistance to fluoroquinolones, tigecycline, QACs, and biguanide disinfectants [38,46]. Previously, Yuan et al. found oqxAB genes in all K. pneumoniae strains studied, but only in 6.6% of E. coli [47]. A lower frequency of these determinants in K. pneumoniae was reported by Dehnamaki et al. Specifically, 57% and 56% of isolates (n = 100) had the oqxA and oqxB genes, respectively [48]. In the study by Ni et al., the frequency of oqxA and oqxB in K. pneumoniae was 60.9% and 17.2%, respectively [49]. In our study, these genes were also detected in many of K. pneumoniae strains, with 77.2% harboring oqxA and 82.5% harboring oqxB. However, these genes were rarely found in E. coli (11.5% and 0%, respectively), while oqxA was only found in strains with MBC CHX ≥ 2%. The differences in the reported prevalence could be due to methodological differences (e. g. different sample sizes, isolates from different sources, clonality of isolates), but also to geographical factors. The AcrAB-TolC multidrug efflux pump system controls the release of antibiotics, oil solvents, and biocides, including CHX [50]. Several studies have found that the presence of the AcrAB-TolC pump, along with other resistance mechanisms, contributed to a reduction in the MIC of antibiotics and the emergence of multidrug resistance [51,52]. We detected AcrAB-TolC pump determinants in 87.7% of K. pneumoniae and 100% of E. coli strains. This pump is indeed a widespread resistance mechanism in E. coli [53]. Mutations in genes encoding RND efflux pumps such as marA lead to upregulation of the AcrAB-TolC RND protein pumps by overexpression of the MarA protein in E. coli [54]. The presence of acrA, which encodes a protein that links two integral membrane proteins of the AcrAB-TolC pump, provides tolerance of K. pneumoniae to various antibiotics, including fluoroquinolones, as well as to biocides, including ethanol, chlorhexidine, and benzalkonium bromide [55]. The AcrAB efflux pump not only contributes to the multidrug resistance phenotype, but may also be a novel virulence factor required by K. pneumoniae to resist immune defense mechanisms in the lung, contributing to the development of pneumonia [56]. The pleiotropic role of AcrAB-TolC in K. pneumoniae pathobiology has been demonstrated. In addition to targeting antimicrobial resistance, TolC plays a regulatory role in capsule biosynthesis, iron homeostasis, adherence to host cells, sensitivity to serum, and virulence (the tolC mutant displayed reduced virulence compared to the wild type in the Galleria mellonella infection model) [57]. In our study, all K. pneumoniae strains contained acrA, while other studies reported that only 19% of carbapenem-resistant K. pneumoniae possessed this gene [55]. In our study oqxA was detected only in one P. aeruginosa strain, while oqxB, acrA, and acrB were not detected. In contrast, the MexAB-OprM pump was detected in 50% of P. aeruginosa strains and was not found in other Gram-negative bacteria. The obtained data are consistent with literature sources. Aparna et al. describe the antibiotic resistance of E. coli and P. aeruginosa due to the work of the efflux pumps AcrAB-TolC and MexAB-OprM, respectively [58]. A structural correlation has been demonstrated between MexAB P. aeruginosa and AcrAB E. coli, which are integral membrane proteins that are part of three-component efflux systems [58]. The high degree of homology between MexAB and AcrAB (57.7% identity MexA-AcrA; 69.8% identity MexB-AcrB) enabled cloning and provision of MexAB-OprM function in E. coli without a significant decrease in the activity spectrum. Nevertheless, the resistance level of E. coli was significantly lower than that of P. aeruginosa, even to the agents to which resistance is provided by MexAB-OprM, probably reflecting the higher permeability of the outer membrane of E. coli compared to P. aeruginosa [59].
All 29 S. aureus isolates were analyzed for the presence of six chromosomally encoded genes (norA, norB, norC, sepA, mepA, and mdeA) and two plasmid encoded genes (qacA/B and smr) encoding efflux pumps in S. aureus. The removal of disinfectants and antiseptics from the cell is mediated by the qacA/B and smr genes in Gram-positive bacteria, particularly in staphylococci [60]. The qacA/B gene is responsible for resistance to various organic cations, including BAC, ethidium bromide, cetrimide, and CHX. The spread of qacA/B among S. aureus and other members of the genus Staphylococcus is facilitated by horizontal gene transfer between strains via the conjugative plasmid [61]. Small genes of multidrug resistance, including smr (staphylococcal multidrug resistance, known as qacC/D), are also responsible for resistance to antiseptics in staphylococci [62]. According to various authors, the qacA/B and smr genes were detected in 0–95% of clinical S. aureus strains, indicating heterogeneity in the presence of these genes in the population. Damavandi et al. reported 12.5% of S. aureus isolates carried the qacA/B gene and 31.7% of isolates carried the smr gene [62]. According to Schlett et al., only 1.6% of 615 isolates were qacA/B-positive [63]. In the study of McClure et al., none of the 296 screened S. aureus isolates contained both the qac and smr genes [64]. According to Ghasemzadeh-Moghaddam et al., the qacA/B gene was present in 68% of methicillin-resistant S. aureus (MRSA) and 58.2% of methicillin-sensitive S. aureus (MSSA), and the smr gene was present in 39% and 29.3% of strains, respectively [65]. The efflux pump genes described above are frequently identified in Staphylococcus isolates that exhibit reduced susceptibility to CHX; however, none of these genes have been detected in MRSA strains with BAC resistance [66]. The absence of qacA/B and smr genes in CHX-susceptible strains is quite understandable; however, these genes were found by us in some strains of other Staphylococcus species.
The proteins NorA, NorB, NorC, and MdeA belong to the MFS family; MepA belongs to the MATE family; and SepA belongs to the SMR family [67]. Reduced susceptibility to antibiotics, biocides, and dyes can be indirectly associated with increased expression of these pumps in staphylococci. NorA enables efflux of a wide range of biocides, including QACs and antibiotics, with some fluoroquinolones being among the best substrates for transport [14,68]. Expression of Nor efflux pumps in S. aureus is controlled by the global regulator MgrA (multiple gene regulator). MgrA can be phosphorylated post-translationally by the putative serine/threonine kinase PknB, and the phosphorylated MgrA-P can be dephosphorylated by RsbU, which alters the ability of MgrA to bind to the norA/B promoters. Phosphorylation of MgrA results in loss of binding to the norA promoter and binding to the norB promoter. Loss of the ability to phosphorylate MgrA resulted in increased repression of norA expression and decreased susceptibility to NorA substrates, including antibiotics and disinfectants [69,70]. It should also be noted that NorA can contribute to the export of siderophores [71]. Exposure of S. aureus isolates to low concentrations of biocides resulted in increased expression of the norA, norC, mepA, and mdeA genes and increased resistance to biocides and antibiotics, including CHX [17]. Overexpression of norB leads to resistance to fluoroquinolones, tetracycline, and even disinfectants and dyes, while overexpression of mepA leads to resistance to fluoroquinolones and disinfectants [68]. The prevalence of norA/norB/norC genes in S. aureus isolates often exceeds 50% [72]. The multidrug resistance efflux pump SepA (antiseptic resistance protein SepA/staphylococcal efflux pump A) is involved in multicomponent efflux in staphylococci. It provides low resistance to drugs such as acriflavine, BAC, chlorhexidine gluconate, and ethidium bromide [73]. The protein SepA, encoded by the chromosomal gene sepA, is a transporter consisting of 157 amino acids and four putative transmembrane segments, which is typical for transporters of the SMR family. However, SepA lacks conserved motifs of this family. Although some residues important for H+:drug transport specificity and antiport are present elsewhere, SepA may belong to an as of yet unidentified transporter family. Antiabong et al. assessed the diversity of all above genes in clinical S. aureus isolates obtained at Pretoria hospital (South Africa) and the prevalence of all multidrug efflux pump genes in S. aureus was very high at 79–99% [74]. In strains analyzed in our study, efflux pump genes were prevalent at the level of other studies.
Microbial adhesion on abiotic surfaces and thus biofilm formation are considered a serious problem, both in terms of economic and public health consequences. In recent decades, the healthcare environment (medical devices and surfaces, commonly referred to as “fomites”) has been increasingly recognized as a reservoir of bacteria that cause healthcare-associated infections [75,76]. These bacteria can be transmitted from fomites to patients through direct contact, through contact with (semi-)critical object, and via the hands [8]. Indeed, representatives of all the taxa studied were preserved for 24 h on the surface of “ceramic tiles” and “plastic”. Nevertheless, under conditions close to the in situ situation, the complete bactericidal effect of CHX and S7 on the cells of all tested strains was demonstrated on the surface in the immediate (except for P. aeruginosa) and daily exposure variants of the experiment.
Today, mechanisms that reduce the sensitivity of microorganisms to disinfectants and antibiotics are known, e.g., the release of biocides from the cell [50,77], the mucoid phenotype, and biofilm formation [78]. We found no correlation between biofilm biomass and bacterial survival after exposure of daily biofilms to biocides. The presence of individual efflux pump genes differed significantly in the groups of strains with different MBCCHX: oqxA was found only in E. coli strains with MBCCHX ≥ 1%; qacE, qacEΔ1, and a larger number of efflux pump genes were more often contained in P. aeruginosa strains with MBCCHX ≥ 2%. We found no significant correlations between antibiotic resistance and tolerance to chlorhexidine-based biocidal compositions. However, in our study, MDR strains contained more efflux pump genes per strain (K. pneumoniae) or more often contained three efflux pump genes simultaneously than non-MDR strains of E. coli and P. aeruginosa.
It is known that subinhibitory concentrations of disinfectants can also contribute to the horizontal transfer of antibiotic resistance genes [79]. There is evidence that the use of QACs and sulfonamides since the 1930s has contributed to the spread of class 1 integrons and, thus, to the development of antibiotic resistance in clinically significant bacteria [80]. After testing K. pneumoniae strains for their resistance to antibiotics and biocides and finding the presence of integrons in them, Samir et al. concluded that the presence of class 1 integrons in MDR K. pneumoniae isolates may only contribute to some biocide resistance, but does not appear to be the only factor important for multiple drug resistance [81]. However, some authors find no evidence of combined resistance to disinfectants and antibiotics [82]. In this regard, additional data and studies are needed to confirm that the use of disinfectants in hospitals contributes to the emergence of bacterial resistance to biocides.

4. Materials and Methods

4.1. Bacterial Strains

In this study, non-clonal bacterial strains of E. coli (n = 26), K. pneumoniae (n = 57), P. aeruginosa (n = 23), and S. aureus (n = 29) isolated from sputum, bronchopulmonary lavage, blood, wound, and urine of hospitalized patients of surgical departments of multidisciplinary hospitals in Perm, Russia (n = 6), during the period of 2018–2023 were used. For microbial identification, traditional culture-based methods and mass spectrometry, including MALDI TOF SM, were used in the laboratories of local hospitals. All strains were stored in the departmental collection of Perm State Medical University Named After Academician E. A. Wagner. The reference strains of E. coli ATCC®25922, K. pneumoniae ATCC®700603, P. aeruginosa ATCC®27853, and S. aureus ATCC®25923 used in this study were obtained from the collection of the State Research Institute for Standardization and Control of Medical Biological Preparations, named after L.A. Tarasevich (Moscow) [83].

4.2. Antimicrobial Susceptibility Testing

The antimicrobial susceptibility of the bacterial strains was determined according the clinical guidelines outlined in the “Determination of the sensitivity of microorganisms to antimicrobial drugs” of the Interregional Association for Clinical Microbiology and Antimicrobial Chemotherapy (IACMAC, Version-2018-03). The strains were tested on Muller–Hinton agar (“FBIS SRCAMB”, Obolensk, Russia) using the disc diffusion method with discs (“NICF”, St. Petersburg, Russia). Bacterial strains that were resistant to at least one antibiotic from three or more antibiotic groups were defined as multidrug resistant (MDR) strains [84].

4.3. Biocidal Compositions

In this study, a 0.05% chlorhexidine bigluconate (CHX) solution (Samaramedprom OJSC, Russia) and the biocidal composite solution S7 (S7) with 0.07% chlorhexidine and 0.055% cationic surfactant benzalkonium chloride (BAC), also known as alkyldimethylbenzylammonium chloride (ADBAC) (Institute of Technical Chemistry, Perm, Russia), were used (certificate of state registration № RU 77.99.88.002.E.004217.12.20, date 10.12.2020: Eurasian Economic Union Federal Service for Supervision of Consumer Rights Protection and Human Wellbeing).

4.4. Assessment of the Effect of Biocides on Planktonic Cells (MIC, MBC)

The MICs of the biocidal compositions were determined using the broth dilution method. Cells were grown overnight at 37 °C in a glass tube containing 5 mL Muller–Hinton broth. The next day, overnight cultures were diluted 1:100 in fresh medium and cultured for 5 h. The cultures were then adjusted to an OD of 0.1 (A625), diluted 1:100, and added to serial dilutions of the biocidal compositions in 96-well plates. The plates were incubated for 24 h at 37 °C without shaking. After the 24-h incubation, the MIC was determined. To determine the MBC, 10 µL from each well used for the MIC determination was inoculated on a Petri dish with Muller–Hinton agar and incubated for 24 h at 37 °C. The MBC was determined as the lowest concentration of an antimicrobial agent required to prevent colony growth. The concentration of the initial biocidal solution (CHX or S7) was taken as 100%, and a series of two-fold serial dilutions was prepared. MIC and MBC were calculated as % of the initial solution.

4.5. Biofilm Biomass

Overnight cultures of the strains were diluted 100-fold in LB broth (Amresco, Solon, OH, USA), and 200 μL was added to the wells of a 96-well flat bottom polystyrene plate (Medpolimer, Saint Petersburg, Russia) and incubated for 24 h at 37 °C without shaking. The biofilm biomass was determined according to Merritt et al. [85]. The biofilms formed were washed twice with NaCl (0.9%), stained with 0.1% crystal violet for 30 min, and washed three times with distilled water. The dye was extracted with 200 μL of 96% ethanol to determine the biofilm biomass by optical density (OD570) using an Infinite M1000 (TECAN, Grödig, Austria). The experiments were repeated three times with six technological replicates. Based on the OD of the negative control, the cutoff value (ODc) was calculated as the OD of the negative control plus 3 × standard deviation (SD) of the negative control. Based on ODc, the strains were divided into four groups, including strains without biofilm formation (NBF) (ODo < ODc), strains with weak biofilm formation (WBF) (ODc < OD < 2ODc), strains with moderate biofilm formation (MBF) (2ODc < OD < 4ODc), and strains with strong biofilm formation (SBF) (4Odc < OD) [86].

4.6. Evaluation of the Effect of Biocidal Compositions on the Cells in a Biofilm

Overnight cultures of nosocomial strains were adjusted with fresh LB broth to OD of 0.1 at 600 nm (UV-1680 spectrophotometer, Shimadzu, Kyoto, Japan). This cell suspension was diluted 10-fold with LB broth, and 100 μL was added to the wells of 96-well plates. The plates were incubated for 24 h at 37 °C without shaking. Then, the liquid culture was removed, and 150 μL of CHX/S7/NaCl was added to the wells and incubated for 1 h at 37 °C. The solutions were then removed. The wells were washed three times with sterile saline, and 100 μL of saline was added. Then, the plates were then sonicated (5 times for 1 min at 37 kHz) in an Elma Ultrasonic 30S ultrasonic bath (Elma, Berlin, Germany). Ten-fold dilutions of the sonicated culture were then plated on an agar nutrient medium and incubated for 24 h at 37 °C. After incubation, the CFU was determined, and the effectiveness of the disinfectant against biofilm was assessed according to [34]. The term “disinfectant” refers to a biocidal effect that results in a reduction in the titer/number of CFU by at least three orders of magnitude (99.9%). The term “sterilizing” refers to either the complete destruction of microorganisms or a reduction in the titer/CFU by six orders of magnitude or more.

4.7. Evaluation of Antimicrobial Activity of Biocidal Compositions on Surfaces

The antimicrobial activity of biocidal compositions on surfaces was evaluated in accordance with GOST R 58151.4-2018 and methodological recommendations of Nizhny Novgorod, 2010 [87,88]. Bacterial cultures were grown for 18–24 h at 37 °C in LB broth and then diluted 100-fold in 0.9% NaCl. The surfaces to be tested were pre-cleaned and sterilized with 70% ethanol. Then, 0.1 mL of bacterial suspension was applied to the surface (10 × 10 cm2) and spread evenly with a sterile spatula for 1 min. Then, 0.9 mL of CHX/S7/NaCl was applied, spread evenly with a sterile spatula, and incubated (10, 30, and 60 min). Then, 0.5 mL of neutralizer was added, and the mixture was immediately seeded on an agar nutrient medium with a sterile cotton swab. The surface contamination, the completeness of neutralizer action, and the purity of disinfectant solutions and the neutralizer were monitored. The plates were incubated at 37 °C for 24 h. In the second series of experiments, the bacterial suspension was applied to the selected surface and left for 24 h. Then, the biocidal compositions were applied as described above. The sensitivity of the strains and the efficacy of the biocide were evaluated in a similar manner. The evaluation of the antimicrobial activity of the biocidal compositions was performed on the surfaces of “ceramic tiles” and “plastic” (polystyrene) without additional treatment. From nosocomial strains of E. coli, K. pneumoniae, P. aeruginosa, and S. aureus, one random strain with average values of the main parameters (E. coli EC8, K. pneumoniae KP20, P. aeruginosa PA5, and S. aureus SA12) was selected to evaluate the effect of biocidal compositions on surfaces.
The susceptibility of the strain was evaluated by determining the CFU number. The strain was considered resistant to the disinfectant with a growth of 300 CFU/mL or more. The strain was considered susceptible when no growth or a growth of no more than 300 CFU/mL was observed, which corresponds to the required efficacy of the disinfectant (killing of 99.99% of microorganisms). Strains with less than 300 CFU/mL were grouped according the degree of susceptibility: (1) complete sensitivity—with no growth; and (2) incomplete sensitivity: (i) 1–99 CFU/mL—incomplete bactericidal action, and (ii) 100–299 CFU/mL—sub-bactericidal action.

4.8. PCR Detection of Efflux Pump Genes

To obtain matrix DNA for PCR amplification, a loop of bacterial biomass was resuspended in 100 µL ultrapure water, heated for 15 min at 97 °C in a solid-state thermostat with a timer TT-2 “Termit” (Moscow, Russia), and centrifuged for 5 min at 13,000 rpm in a microcentrifuge 5415R (“Eppendorf”, Hamburg, Germany). The supernatants were transferred to fresh Eppendorf tubes and stored at –20 °C until further use. Gram-negative bacteria were analyzed by PCR for the presence of the following efflux pump genes: qacEΔ1, qacE, acrAB, oqxA, oqxB, and mexA/B. In addition, K. pneumoniae strains were analyzed for the presence of the cepA gene encoding the chlorhexidine efflux pump. All staphylococci were analyzed for the presence of efflux pump genes: qacA/B, norA, mepA, mdeA, norB, norC, and sepA.
All primers used were synthesized at the LLC “Sintol” (Moscow, Russia). The nucleotide sequences of the primers, the PCR programs, and the amplicon sizes are given in Table 4. Amplifications were carried out in PCR mixtures containing 3 μL DNA template, 0.4 μL 5 U/mL Taq-polymerase, 2.5 μL 10× PCR buffer, 2.5 μL 25 μM MgCl2, 0.25 μL 25 μM dNTPs, and 2.5 μL 10 µM forward and reverse primers (LLC “Sintol”, Moscow, Russia) in a total volume of 25 μL in a thermal cycler DNA Engine Dyad Thermal Cycler (“Bio-Rad”, Foster City, CA, USA). After amplification, 10 µL of each PCR reaction was separated on a 1.2% agarose gel electrophoresis using Agarose E (“diaGene”, Novosibirsk, Russia), and stained with ethidium bromide (0.5 mg/mL). Band visualization and data documentation were performed with the gel documentation system Gel-DocXR (“Bio-Rad”, Foster City, CA, USA).

4.9. Statistical Analysis

Data were expressed as mean and standard deviation (mean ± SEM) or median (Me). Statistical analysis was performed using Student’s t-test or Fisher’s exact test to compare qualitative characteristics. Spearman’s rank correlation test was used to evaluate the correlation between phenotypic and genotypic characteristics. A p-value of less than 0.05 was considered significant. Statistical analysis was performed using Excel or GraphPad Prism 8 Version 8.0.1 (GraphPad Software, Boston, MA, USA). The GraphPad Prism 8 software package was used for plotting graphs.

5. Conclusions

The activity of CHX and the biocidal composite solution based on CHX and QAC (S7) on nosocomial strains of E. coli, K. pneumoniae, P. aeruginosa, and S. aureus was investigated in several models. It was shown that CHX and S7 in low concentrations have a bacteriostatic and bactericidal effect on planktonic cells of most nosocomial strains. S. aureus strains were the least resistant to biocides, while P. aeruginosa showed the highest resistance. A study of the effect on biofilms showed high activity of both biocides, with S7 being more effective than the standard 0.05% CHX. Determinants of four families (RND, SMR, MFS, and MATE) of efflux pumps were identified. MDR Gram-negative bacteria (E. coli, K. pneumoniae and P. aeruginosa) contained more efflux pump genes. Although the biocide concentrations used are still well above the MIC or MBC for biocides in bacteria with reduced susceptibility to biocides, this should not lead to a decrease in attention to this problem.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26010355/s1.

Author Contributions

Conceptualization, M.V.K. and M.S.E.; methodology, L.Y.N., P.A.S., D.A.K. and M.O.K.; software, V.S.M.; validation, V.S.M., M.V.K. and M.S.E.; formal analysis, V.S.M.; investigation, L.Y.N., P.A.S., D.A.K., M.O.K. and A.S.A.; resources, M.V.K. and I.V.V.; data curation, V.S.M., M.V.K. and M.S.E.; writing—original draft preparation, V.S.M., L.Y.N., P.A.S., D.A.K. and M.V.K.; writing—review and editing, M.S.E.; visualization, V.S.M.; supervision, M.V.K. and M.S.E.; project administration, M.V.K. and I.V.V.; funding acquisition, M.V.K. and I.V.V. All authors have read and agreed to the published version of the manuscript.

Funding

The research of M.V.K., L.Y.N., P.A.S. and D.A.K. was carried out within the Ministry of Science and Higher Education of the Russian Federation (state task 124020500028-4). The work of scientists M.O.K., A.S.A. and I.V.V. was supported by municipal contract No. C-26/542 from 18.03.2021 (2021–2023) “Development of new detergent-disinfectant compositions/solutions that are promising for use in a complex of sanitary and anti-epidemic measures in medical organizations”.

Institutional Review Board Statement

The Ethical Committee at Institute of Ecology and Genetics of Microorganisms, the Ural Branch of the Russian Academy of Sciences (Russia, Perm) approved the study.

Informed Consent Statement

All patients whose strains were used in the study signed an informed consent in the hospitals where they were treated.

Data Availability Statement

Data are contained within the article or Supplementary Materials.

Acknowledgments

We are grateful to the Head of the “Pro-Med” Microbiological Laboratory (Perm, Russia) Provorova S.V. for providing the nosocomial strains.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Nowakiewicz, A.; Zięba, P.; Gnat, S.; Matuszewski, Ł. Last Call for Replacement of Antimicrobials in Animal Production: Modern Challenges, Opportunities, and Potential Solutions. Antibiotics 2020, 9, 883. [Google Scholar] [CrossRef] [PubMed]
  2. Urban-Chmiel, R.; Marek, A.; Stępień-Pyśniak, D.; Wieczorek, K.; Dec, M.; Nowaczek, A.; Osek, J. Antibiotic Resistance in Bacteria-A Review. Antibiotics 2022, 11, 1079. [Google Scholar] [CrossRef] [PubMed]
  3. Salam, M.A.; Al-Amin, M.Y.; Salam, M.T.; Pawar, J.S.; Akhter, N.; Rabaan, A.A.; Alqumber, M.A.A. Antimicrobial Resistance: A Growing Serious Threat for Global Public Health. Healthcare 2023, 11, 1946. [Google Scholar] [CrossRef] [PubMed]
  4. World Health Organization (WHO). Prevention of Hospital-Acquired Infections. A Practical Guide, 2nd ed.; World Health Organization: Geneva, Switzerland, 2002. [Google Scholar]
  5. Khan, H.A.; Baig, F.K.; Mehboob, R. Nosocomial infections. Epidemiology, prevention, control and surveillance. Asian Pac. J. Trop. Biomed. 2017, 7, 478–482. [Google Scholar] [CrossRef]
  6. Lemiech-Mirowska, E.; Kiersnowska, Z.M.; Michałkiewicz, M.; Depta, A.; Marczak, M. Nosocomial infections as one of the most important problems of healthcare system. Ann. Agric. Environ. Med. 2021, 28, 361–366. [Google Scholar] [CrossRef] [PubMed]
  7. WHO Bacterial Priority Pathogens List, 2024: Bacterial Pathogens of Public Health Importance to Guide Research, Development and Strategies to Prevent and Control Antimicrobial Resistance; World Health Organization: Geneva, Switzerland, 2024.
  8. Otter, J.A.; Yezli, S.; Salkeld, J.A.; French, G.L. Evidence that contaminated surfaces contribute to the transmission of hospital pathogens and an overview of strategies to address contaminated surfaces in hospital settings. Am. J. Infect. Control. 2013, 41, 6–11. [Google Scholar] [CrossRef]
  9. Robakowska, M.; Bronk, M.; Tyrańska-Fobke, A.; Ślęzak, D.; Kraszewski, J.; Balwicki, Ł. Patient Safety Related to Microbiological Contamination of the Environment of a Multi-Profile Clinical Hospital. Int. J. Environ. Res. Public. Health. 2021, 18, 3844. [Google Scholar] [CrossRef]
  10. Shineh, G.; Mobaraki, M.; Perves Bappy, M.J.; Mills, D.K. Biofilm Formation, and Related Impacts on Healthcare, Food Processing and Packaging, Industrial Manufacturing, Marine Industries, and Sanitation–A Review. Appl. Microbiol. 2023, 3, 629–665. [Google Scholar] [CrossRef]
  11. World Health Organization (WHO). WHO Model List of Essential Medicine. Available online: https://www.who.int/publications/i/item/WHO-MHP-HPS-EML-2021.02 (accessed on 1 June 2022).
  12. McDonnell, G.; Russell, A.D. Antiseptics and disinfectants: Activity, action, and resistance. Clin. Microbiol. Rev. 1999, 12, 147–179. [Google Scholar] [CrossRef]
  13. Chen, B.; Han, J.; Dai, H.; Jia, P. Biocide-tolerance and antibiotic-resistance in community environments and risk of direct transfers to humans: Unintended consequences of community-wide surface disinfecting during COVID-19? Environ. Pollut. 2021, 283, 117074. [Google Scholar] [CrossRef]
  14. Huang, L.; Wu, C.; Gao, H.; Xu, C.; Dai, M.; Huang, L.; Hao, H.; Wang, X.; Cheng, G. Bacterial Multidrug Efflux Pumps at the Frontline of Antimicrobial Resistance: An Overview. Antibiotics 2022, 11, 520. [Google Scholar] [CrossRef] [PubMed]
  15. Alibert, S.; N’gompaza Diarra, J.; Hernandez, J.; Stutzmann, A.; Fouad, M.; Boyer, G.; Pages, J.-M. Multidrug efflux pumps and their role in antibiotic and antiseptic resistance: A pharmacodynamic perspective. Expert Opin. Drug Metab. Toxicol. 2017, 13, 301–309. [Google Scholar] [CrossRef] [PubMed]
  16. Slipski, C.; Jamieson-Datzkiw, T.; Zhanel, G.; Bay, D. Characterization of proteobacterial plasmid integron-encoded qac efflux pump sequence diversity and quaternary ammonium compound antiseptic selection in E. coli grown planktonically and as biofilms. Antimicrob. Agents Chemother. 2021, 65, AAC0106921. [Google Scholar] [CrossRef]
  17. Abbood, H.M.; Hijazi, K.; Gould, I.M. Chlorhexidine Resistance or Cross-Resistance, That Is the Question. Antibiotics 2023, 12, 798. [Google Scholar] [CrossRef]
  18. Hrovat, K.; Zupančič, J.Č.; Seme, K.; Avguštin, J.A. QAC Resistance Genes in ESBL-Producing E. coli Isolated from Patients with Lower Respiratory Tract Infections in the Central Slovenia Region—A 21-Year Survey. Trop. Med. Infect. Dis. 2023, 8, 273. [Google Scholar] [CrossRef]
  19. Rakshit, P.; Singh, A.; Singh, R.; Banerjee, T. An in-depth study on survival mechanism of bacterial isolates in disinfectants within the hospital environment. Front. Cell. Infect. Microbiol. 2024, 14, 1442914. [Google Scholar] [CrossRef]
  20. Lompo, P.; Heroes, A.-S.; Agbobli, E.; Kühne, V.; Tinto, H.; Affolabi, D.; Jacobs, J. Bacterial Contamination of Antiseptics, Disinfectants and Hand Hygiene Products in Healthcare Facilities in High-Income Countries: A Scoping Review. Hygiene 2023, 3, 136–175. [Google Scholar] [CrossRef]
  21. Hernando-Amado, S.; Blanco, P.; Alcalde-Rico, M.; Corona, F.; Reales-Calderon, J.A.; Sanchez, M.B.; Martinez, J.L. Multidrug efflux pumps as main players in intrinsic and acquired resistance to antimicrobials. Drug Resist. Updates 2016, 28, 13–27. [Google Scholar] [CrossRef]
  22. Laborda, P.; Molin, S.; Johansen, H.K.; Martínez, J.L.; Hernando-Amado, S. Role of bacterial multidrug efflux pumps during infection. World J. Microbiol. Biotechnol. 2024, 40, 226. [Google Scholar] [CrossRef]
  23. Cheung, H.-Y.; Wong, M.M.-K.; Cheung, S.-H.; Liang, L.Y.; Lam, Y.-W.; Chiu, S.-K. Differential Actions of Chlorhexidine on the Cell Wall of Bacillus subtilis and Escherichia coli. PLoS ONE 2012, 7, e36659. [Google Scholar] [CrossRef]
  24. Maillard, J. Resistance of Bacteria to Biocides. Microbiol. Spectr. 2018, 6, 2. [Google Scholar] [CrossRef] [PubMed]
  25. Morrissey, I.; Oggioni, M.R.; Knight, D.; Curiao, T.; Coque, T.; Kalkanci, A.; Martinez, J.L.; the BIOHYPO Consortium. Evaluation of Epidemiological Cut-Off Values Indicates that Biocide Resistant Subpopulations Are Uncommon in Natural Isolates of Clinically-Relevant Microorganisms. PLoS ONE 2014, 9, e86669. [Google Scholar] [CrossRef] [PubMed]
  26. Allaion, J.R.; Barrionuevo, K.G.; Grande Burgos, M.J.; Gálvez, A.; Franco, B. Staphylococcus aureus from Minas Artisanal Cheeses: Biocide Tolerance, Antibiotic Resistance and Enterotoxin Genes. Appl. Sci. 2022, 12, 1019. [Google Scholar] [CrossRef]
  27. Coles, V.E.; Puri, L.; Bhandari, M.; Wood, T.J.; Burrows, L.L. The effects of chlorhexidine, povidone-iodine and vancomycin on growth and biofilms of pathogens that cause prosthetic joint infections: An in-vitro model. J. Hosp. Infect. 2024, 151, 99e108. [Google Scholar] [CrossRef]
  28. Cichos, K.H.; Andrews, R.M.; Wolschendorf, F.; Narmore, W.; Mabry, S.E.; Ghanem, E.S. Efficacy of Intraoperative Antiseptic Techniques in the Prevention of Periprosthetic Joint Infection: Superiority of Betadine. J. Arthroplast. 2019, 34, S312–S318. [Google Scholar] [CrossRef]
  29. Mikláš, R.; Miklášová, N.; Bukovský, M.; Horváth, B.; Kubincová, J.; Devínsky, F. Synthesis, surface and antimicrobial properties of some quaternary ammonium homochiral camphor sulfonamides. Eur. J. Pharm. Sci. 2014, 65, 29–37. [Google Scholar] [CrossRef]
  30. Bonez, P.C.; dos Santos Alves, C.F.; Dalmolin, T.V.; Agertt, V.A.; Mizdal, C.R.; Costa Flores, V.; Marques, J.B.; Santos, R.V.; de Campos, M.M. Chlorhexidine activity against bacterial biofilms. Am. J. Infect. Control. 2013, 41, e119–e122. [Google Scholar] [CrossRef]
  31. Ebrahimi, A.; Hemati, M.; Habibian Dehkordi, S.; Bahadoran, S.; Khoshnood, S. Chlorhexidine Digluconate Effects on Planktonic Growth and Biofilm Formation in Some Field Isolates of Animal Bacterial Pathogens. Jundishapur J. Nat. Pharm. Prod. 2014, 9, e14298. [Google Scholar] [CrossRef]
  32. Hassan, K.A.; Jackson, S.M.; Penesyan, A.; Patching, S.G.; Tetu, S.G.; Eijkelkamp, B.A. Transcriptomic and biochemical analyses identify a family of chlorhexidine efflux proteins. Proc. Natl. Acad. Sci. USA 2013, 110, 20254–20259. [Google Scholar] [CrossRef]
  33. Lordelo, R.; Branco, R.; Gama, F.; Moraiset, P.V. Assessment of antimicrobial resistance, biofilm formation, and surface modification potential in hospital strains of Pseudomonas aeruginosa and Klebsiella pneumoniae. Heliyon 2024, 10, e30464. [Google Scholar] [CrossRef]
  34. Mohapatra, S. Sterilization and Disinfection. Essent. Neuroanesthesia 2017, 929–944. [Google Scholar]
  35. Fink, R. Terpenoids as Natural Agents against Food-Borne Bacteria—Evaluation of Biofilm Biomass versus Viability Reduction. Processes 2023, 11, 148. [Google Scholar] [CrossRef]
  36. Szekeres, E.; Chiriac, C.M.; Baricz, A.; Szoke-Nagy, T.; Lung, I.; Soran, M.L.; Rudi, K.; Dragos, N.; Coman, C. Investigating antibiotics, antibiotic resistance genes, and microbial contaminants in groundwater in relation to the proximity of urban areas. Environ. Pollut. 2018, 236, 734–744. [Google Scholar] [CrossRef] [PubMed]
  37. Stokes, H.W.; Hall, R.M. A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: Integrons. Mol. Microbiol. 1989, 3, 1669–1683. [Google Scholar] [CrossRef] [PubMed]
  38. Fang, C.T.; Chen, H.C.; Chuang, Y.P.; Chang, S.C.; Wang, J.T. Cloning of a cation efflux pump gene associated with chlorhexidine resistance in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 2002, 46, 2024–2028. [Google Scholar] [CrossRef]
  39. Abuzaid, A.; Hamouda, A.; Amyes, S. Klebsiella pneumoniae susceptibility to biocides and its association with cepA, qacΔE and qacE efflux pump genes and antibiotic resistance. J. Hospital infection. 2012, 81, 87–91. [Google Scholar] [CrossRef]
  40. Pastrana-Carrasco, J.; Garza-Ramos, J.U.; Barrios, H.; Morfin-Otero, R.; Rodríguez-Noriega, E.; Barajas, J.M.; Suárez, S.; Díaz, R.; Miranda, G.; Solórzano, F.; et al. qacEΔ1 gene frequency and biocide resistance in extended-spectrum β-lactamase producing Enterobacteriaceae clinical isolates. Rev. Investig. Clínica 2013, 64, 535–540. [Google Scholar]
  41. Kosyakova, K.G.; Esaulenko, N.B.; Kameneva, O.A.; Kazakov, S.P.; Dubinina, A.Y.; Mezina, E.Y.; Zaitsev, A.A. Prevalence of Carbapenemase Genes, qacE, qacEΔ1 and cepA in Multidrug-Resistant Gram-Negative Bacteria with Different Susceptibility to Chlorhexidine. Epidemiol. Vaccinal Prev. 2020, 19, 49–60. (In Russian) [Google Scholar] [CrossRef]
  42. Kucken, D.; Feucht, H.; Kaulfers, P. Association of qacE and qacEΔ1 with multiple resistance to antibiotics and antiseptics in clinical isolates of Gram-negative bacteria. FEMS Microbiol. Lett. 2000, 183, 95–98. [Google Scholar] [CrossRef]
  43. Goodarzi, R.; Yousefimashouf, R.; Taheri, M.; Nouri, F.; Asghari, B. Susceptibility to biocides and the prevalence of biocides resistance genes in clinical multidrug-resistant P. aeruginosa isolates from Hamadan. Iran. Mol. Biol. Rep. 2021, 48, 5275–5281. [Google Scholar] [CrossRef]
  44. Wang, C.; Cai, P.; Guo, Y.; Mi, Z. Distribution of the antiseptic-resistance genes qacEDelta1 in 331 clinical isolates of P. aeruginosa in China. J. Hospital Infect. 2007, 66, 93–95. [Google Scholar]
  45. Radmehr, M.; Majid, M.; Ghasemzadeh-Moghaddam, H.; Azimian, A.; van Belkum, A. High Prevalence of Antiseptic Resistance Encoding Genes and Reduced Phenotypic Antiseptic Susceptibility Among Antibiotic-Resistant Pseudomonas aeruginosa Isolates. Jundishapur J. Microbiol. 2023, 16, e135911. [Google Scholar] [CrossRef]
  46. Kazama, H.; Hamashima, H.; Sasatsu, M.; Arai, T. Distribution of the antiseptic-resistance genes qacE and qacEΔ1 in Gram-negative bacteria. FEMS Microbiol. Lett. 1998, 159, 173–178. [Google Scholar] [CrossRef] [PubMed]
  47. Yuan, J.; Xu, X.; Guo, Q.; Zhao, X.; Ye, X.; Guo, Y.; Wang, M. Prevalence of the oqxAB gene complex in Klebsiella pneumoniae and Escherichia coli clinical isolates. J. Antimicrob. Chemother. 2012, 67, 1655–1659. [Google Scholar] [CrossRef]
  48. Dehnamaki, M.; Ghane, M.; Babaeekhou, L. Detection of OqxAB and QepA efflux pumps and their association with antibiotic resistance in Klebsiella pneumoniae isolated from urinary tract infection. Int. J. Infect. 2020, 7, e107397. [Google Scholar] [CrossRef]
  49. Ni, L.; Zhang, Z.; Shen, R.; Liu, X.; Li, X.; Chen, B.; Wu, X.; Li, H.; Xie, X.; Huang, S. Disinfection Strategies for Carbapenem-Resistant Klebsiella pneumoniae in a Healthcare Facility. Antibiotics 2022, 11, 736. [Google Scholar] [CrossRef]
  50. Levy, S.B. Active efflux, a common mechanism for biocide and antibiotic resistance. Appl. Microbiol. 2002, 92, 65S–71S. [Google Scholar] [CrossRef]
  51. Pakzad, I.; Zayyen Karin, M.; Taherikalani, M.; Boustanshenas, M.; Lari, A.R. Contribution of AcrAB efflux pump to ciprofloxacin resistance in Klebsiella pneumoniae isolated from burn patients. GMS Hyg. Infect. Control. 2013, 8, Doc15. [Google Scholar]
  52. Maurya, N.; Jangra, M.; Tambat, R.; Nandanwar, H. Alliance of efflux pumps with β-lactamases in multidrug-resistant Klebsiella pneumoniae isolates. Microb. Drug Resist. 2019, 25, 1155–1163. [Google Scholar] [CrossRef]
  53. Smith, B.L.; Fernando, S.; King, M.D. Escherichia coli resistance mechanism AcrAB-TolC efflux pump interactions with commonly used antibiotics: A molecular dynamics study. Sci. Rep. 2024, 14, 2742. [Google Scholar] [CrossRef]
  54. Cohen, S.P.; McMurry, L.M.; Levy, S.B. The marA locus causes decreased expression of OmpF porin in multiple antibiotic resistant (Mar) mutants of Escherichia coli. J. Bacteriol. 1988, 170, 5416–5422. [Google Scholar] [CrossRef]
  55. Guo, W.; Shan, K.; Xu, B.; Li, J. Determining the resistance of carbapenem-resistant Klebsiella pneumoniae to common disinfectants and elucidating the underlying resistance mechanisms. Pathog. Glob. Health 2015, 109, 184–192. [Google Scholar] [CrossRef] [PubMed]
  56. Padilla, E.; Llobet-Brossa, E.; Doménech-Sánchez, A.; Martínez-Martiínez, L.; Bengoechea, J.; Alberti, S. Klebsiella pneumoniae AcrAB Efflux Pump Contributes to Antimicrobial Resistance and Virulence. Antimicrob. Agents Chemother. 2010, 54, 177–183. [Google Scholar] [CrossRef] [PubMed]
  57. Bina, X.R.; Weng, Y.; Budnick, J.; Van Allen, M.E.; Bina, J.E. Klebsiella pneumoniae TolC contributes to antimicrobial resistance, exopolysaccharide production, and virulence. Infect. Immun. 2023, 91, e0030323. [Google Scholar] [CrossRef] [PubMed]
  58. Aparna, V.; Dineshkumar, K.; Mohanalakshmi, N.; Velmurugan, D.; Hopper, W. Identification of natural compound inhibitors for multidrug efflux pumps of Escherichia coli and Pseudomonas aeruginosa using in silico high-throughput virtual screening and in vitro validation. PLoS ONE 2014, 9, e101840. [Google Scholar] [CrossRef]
  59. Srikumar, R.; Kon, T.; Gotoh, N.; Poole, K. Expression of Pseudomonas aeruginosa multidrug efflux pumps MexA-MexB-OprM and MexC-MexD-OprJ in a multidrug-sensitive Escherichia coli strain. Antimicrob. Agents Chemother. 1998, 42, 65–71. [Google Scholar] [CrossRef]
  60. Horner, C.; Mawer, D.; Wilcox, M. Reduced susceptibility to chlorhexidine in staphylococci: Is it increasing and does it matter? J. Antimicrob. Chemother. 2012, 67, 2547–2559. [Google Scholar] [CrossRef]
  61. LaBreck, P.T.; Rice, G.K.; Paskey, A.C.; Elassal, E.M.; Cer, R.Z.; Law, N.N.; Schlett, C.D.; Bennett, J.W.; Millar, E.V.; Ellis, M.W.; et al. Conjugative Transfer of a Novel Staphylococcal Plasmid Encoding the Biocide Resistance Gene, qacA. Front. Microbiol. 2018, 19, 2664. [Google Scholar] [CrossRef]
  62. Damavandi, M.S.; Maryam, S.D.; Alireza, D.; Fatemeh, H.; Roohollah, T.; Abolfazl, G. Detection of Antiseptic Resistance Genes among Staphylococcus aureus Colonising Nurses and Coagulase-Negative Staphylococci Isolated from Clinical Specimens at Teaching Hospitals in Southwest of Iran. Jundishapur J. Microbiol. 2016, 10, e39285. [Google Scholar] [CrossRef]
  63. Schlett, C.D.; Millar, E.V.; Crawford, K.B.; Cui, T.Y.; Lanier, J.B.; Tribble, D.R. Prevalence of Chlorhexidine-Resistant Methicillin-Resistant Staphylococcus aureus following Prolonged Exposure. Antimicrob. Agents Chemother. 2014, 58, 4404–4410. [Google Scholar] [CrossRef]
  64. McClure, J.A.; Zaal DeLongchamp, J.; Conly, J.M.; Zhang, K. Novel Multiplex PCR Assay for Detection of Chlorhexidine-Quaternary Ammonium, Mupirocin, and Methicillin Resistance Genes, with Simultaneous Discrimination of Staphylococcus aureus from Coagulase-Negative Staphylococci. J. Clin. Microbiol. 2017, 55, 1857–1864. [Google Scholar] [CrossRef] [PubMed]
  65. Ghasemzadeh-Moghaddam, H.; Azimian, A.; Bayan, G.; Dashti, V.; Nojoomi, S.; Shirazi, N.; Solati, A.; Belkum, A.V. High prevalence and expression of antiseptic resistance genes among infectious t037/ST239 methicillin-resistant Staphylococcus aureus (MRSA) strains in North Khorasan Province, Iran. Iran. J. Basic Med. Sci. 2022, 25, 775–780. [Google Scholar] [PubMed]
  66. Ammar, A.M.; Attia, A.M.; Abd El-Hamid, M.I.; El-Shorbagy, I.M.; Abd El-Kader, S.A. Genetic basis of resistance waves among methicillin resistant Staphylococcus aureus isolates recovered from milk and meat products in Egypt. Cell. Mol. Biol. 2016, 62, 7–15. [Google Scholar] [PubMed]
  67. Costa, S.S.; Viveiros, M.; Amaral, L.; Couto, I. Multidrug Efflux Pumps in Staphylococcus aureus: An Update. Open Microbiol. J. 2013, 7, 59–71. [Google Scholar] [CrossRef]
  68. Hassanzadeh, S.; Ganjloo, S.; Pourmand, M.R.; Mashhadi, R.; Ghazvini, K. Epidemiology of efflux pumps genes mediating resistance among Staphylococcus aureus; A systematic review. Microb. Pathog. 2020, 139, 103850. [Google Scholar] [CrossRef]
  69. Kaatz, G.W.; Thyagarajan, R.V.; Seo, S.M. Effect of promoter region mutations and mgrA overexpression on transcription of norA, which encodes a Staphylococcus aureus multidrug efflux transporter. Antimicrob. Agents Chemother. 2005, 49, 161–169. [Google Scholar] [CrossRef]
  70. Truong-Bolduc, Q.C.; Hooper, D.C. Phosphorylation of MgrA and its effect on expression of the NorA and NorB efflux pumps of Staphylococcus aureus. J Bacteriol. 2010, 192, 2525–2534. [Google Scholar] [CrossRef]
  71. Deng, X.; Sun, F.; Ji, Q.; Liang, H.; Missiakas, D.; Lan, L.; He, C. Expression of multidrug resistance efflux pump gene norA is iron responsive in Staphylococcus aureus. J. Bacteriol. 2012, 194, 1753–1762. [Google Scholar] [CrossRef]
  72. Ghufran, S.; Shurook, S.; Kifah, J. Detection the Prevalence of Some Chromosomal Efflux Pump Genes in Methicillin Resistant Staphylococcus aureus Isolated from Iraqi Patients. Iraqi J. Biotechnol. 2019, 18, 33–42. [Google Scholar]
  73. Narui, K.; Noguchi, N.; Wakasugi, K.; Sasatsu, M. Cloning and characterization of a novel chromosomal drug efflux gene in Staphylococcus aureus. Biol. Pharm. Bull. 2002, 25, 1533–1536. [Google Scholar] [CrossRef]
  74. Antiabong, J.F.; Kock, M.M.; Bellea, N.M.; Ehlers, M.M. Diversity of Multidrug Efflux Genes and Phenotypic Evaluation of the In vitro Resistance Dynamics of Clinical Staphylococcus Aureus Isolates Using Methicillin; a Model β-lactam. Open Microbiol. J. 2017, 11, 132–141. [Google Scholar] [CrossRef] [PubMed]
  75. Kanamori, H.; Rutala, W.A.; Weber, D.J. The Role of Patient Care Items as a Fomite in Healthcare-Associated Outbreaks and Infection Prevention. Clin. Infect. Dis. 2017, 65, 1412–1419. [Google Scholar] [CrossRef] [PubMed]
  76. Rutala, W.A.; Weber, D.J. Best practices for disinfection of noncritical environmental surfaces and equipment in health care facilities: A bundle approach. Am. J. Infect. Control. 2019, 47, A96–A105. [Google Scholar] [CrossRef] [PubMed]
  77. Amsalu, A.; Sapula, S.A.; De Barros Lopes, M.; Hart, B.J.; Nguyen, A.H.; Drigo, B.; Turnidge, J.; Leong, L.E.; Venter, H. Efflux pump-driven antibiotic and biocide cross-resistance in Pseudomonas aeruginosa isolated from different ecological niches: A case study in the development of multidrug resistance in environmental hotspots. Microorganisms 2020, 8, 1647. [Google Scholar] [CrossRef]
  78. Bridier, A.; Briandet, R.; Thomas, V.; Dubois-Brissonnet, F. Resistance of bacterial biofilms to disinfectants: A review. Biofouling 2011, 27, 1017–1032. [Google Scholar] [CrossRef]
  79. Zhang, Y.; Gu, A.Z.; He, M.; Li, D.; Chen, J. Subinhibitory concentrations of disinfectants promote the horizontal transfer of multidrug resistance genes within and across genera. Environ. Sci. Technol. 2017, 51, 570–580. [Google Scholar] [CrossRef]
  80. Ghaly, T.M.; Chow, L.; Asher, A.J.; Waldron, L.S.; Gillings, M.R. Evolution of class 1 integrons: Mobilization and dispersal via food-borne bacteria. PLoS ONE 2017, 12, e0179169. [Google Scholar] [CrossRef]
  81. Samir, P.; El-Baz, A.M.; Kenawy, H.I. The linkage between prevalence of integron I and reduced susceptibility to biocides in MDR Klebsiella pneumoniae isolated from neonates. Iran. J. Microbiol. 2023, 15, 27–37. [Google Scholar] [CrossRef]
  82. Islam, T.; Saha, O.; Sultana, S.; Hridoy, M.; Hasan, M.; Marzan, S.; Rahman, M.M. Comparison Between Reduced Susceptibility to Disinfectants and Multidrug Resistance Among Hospital Isolates of Pseudomonas aeruginosa and Staphylococcus aureus in Bangladesh. Bagcilar Med. Bull. 2017, 2, 88–97. [Google Scholar] [CrossRef]
  83. ATCC. The Global Bioresource Center. Available online: https://www.lgcstandards-atcc.org (accessed on 5 May 2023).
  84. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
  85. Merritt, J.H.; Kadouri, D.E.; O’Toole, G.A. Growing and analyzing static biofilm. Curr. Protoc. Microbiol. 2005, 1, Unit-1B.1. [Google Scholar]
  86. Holá, V.; Ruzicka, F.; Horka, M. Microbial diversity in biofilm infections of the urinary tract with the use of sonication techniques. FEMS Immunol. Med. Microbiol. 2010, 59, 525–528. [Google Scholar] [CrossRef] [PubMed]
  87. GOST R 58151.4-2018; Disinfectants. Methods for Determining Efficiency Factor. Federal Agency for Technical Regulation and Metrology: Moscow, Russia, 2018.
  88. Shkarin, V.V.; Kovalishena, O.V.; Blagonravova, A.S.; Vorob’yeva, O.N.; Alekseyeva, I.G. Method for Determining the Sensitivity of Microorganisms to Disinfectants: Methodological Recommendations [Sposob Opredeleniya Chuvstvitel’nosti Mikroorganizmov k Dezinfitsiruyushchim Sredstvam: Metodicheskiye Rekomendatsii]; NGMA: Nizhny Novgorod, Russia, 2010; p. 24. (In Russian) [Google Scholar]
  89. Chen, Y.; Liao, K.; Huang, Y.; Guo, P.; Huang, H.; Wu, Z.; Liu, M. Determining the susceptibility of carbapenem resistant Klebsiella pneumoniae and Escherichia coli strains against common disinfectants at a tertiary hospital in China. BMC Infect. Dis. 2020, 20, 88. [Google Scholar] [CrossRef] [PubMed]
  90. AL-Yozbakee, Z.; Mohammad, K. CRISPR-Cas system in multi drugs resistant Klebsiella pneumoniae from different clinical samples and its correlation with antibiotic-resistant genes in Mosul city. Iraqi J. Appl. Nat. Sci. 2024, 16, 820–829. [Google Scholar] [CrossRef]
  91. Al-Grawi, I.G.A.; Al-Absali, A.K.; Kareem, N.H.; Belal, S.A. Occurrence of MexAB-OprM efflux pump operon on septicemic Pseudomonas aeruginosa chromosome. Iraqi Postgrad. Med. J. 2012, 2, 97–102. [Google Scholar]
  92. Noguchi, N.; Nakaminami, H.; Nishijima, S.; Kurokawa, I.; So, H.; Sasatsu, M. Antimicrobial agent of susceptibilities and antiseptic resistance gene distribution among methicillin-resistant Staphylococcus aureus isolates from patients with impetigo and staphylococcal scalded skin syndrome. J. Clin. Microbiol. 2006, 44, 2119–2125. [Google Scholar] [CrossRef]
  93. Patel, D.; Kosmidis, C.; Seo, S.; Kaatz, G. Ethidium Bromide MIC Screening for Enhanced Efflux Pump Gene Expression or Efflux Activity in Staphylococcus aureus. Antimicrob. Agents Chemother. 2010, 54, 5070–5073. [Google Scholar] [CrossRef]
  94. Huang, J.; O’Toole, P.W.; Shen, W.; Amrine-Madsen, H.; Jiang, X.; Lobo, N.; Palmer, L.M.; Voelker, L.; Fan, F.; Gwynn, M.N.; et al. Novel chromosomally encoded multidrug efflux transporter MdeA in Staphylococcus aureus. Antimicrob. Agents Chemother. 2004, 48, 909–917. [Google Scholar] [CrossRef]
  95. Suma, T.A.; Alam, N.; Raihan, S.Z.; Zahid, M.A.; Mandal, S.C.; Suchana, F.J.; Kundu, R.; Hossain, A.; Muhit, M.A. Association of Antibacterial Susceptibility Profile with the Prevalence of Genes Encoding Efflux Proteins in the Bangladeshi Clinical Isolates of Staphylococcus aureus. Antibiotics 2023, 12, 305. [Google Scholar] [CrossRef]
Figure 1. Sensitivity of E. coli strains to biocidal compositions based on chlorhexidine. (a) Minimum inhibitory (MIC) and minimum bactericidal (MBC) concentrations of chlorhexidine (CHX) and the S7 composite solution of CHX (0.07%) and the cationic surfactant benzalkonium chloride (BAC, 0.055%) (S7). MIC and MBC are presented as a percentage of dilution of the initial solutions. (b) The prevalence of non-biofilm-forming (NBF), weak biofilm-forming (WBF), moderate biofilm-forming (MBF) and strong biofilm-forming (SBF) strains. (c) The viability of E. coli after the addition of CHX or S7 to the one-day old biofilm. (d) The prevalence of E. coli containing a certain number of efflux pump genes among MDR and non-MDR strains with MBCCHX ≥ 1% and MBCCHX < 1%. (e) Heat map depicting the obtained MIC and MBC results and presence of the tested efflux pump genes in relation to MDR and biofilm biomass. 1–26, E. coli strains EC1-EC26. Data are mean ± standard error of the mean (SEM), n indicates independent strains, *** p < 0.0005.
Figure 1. Sensitivity of E. coli strains to biocidal compositions based on chlorhexidine. (a) Minimum inhibitory (MIC) and minimum bactericidal (MBC) concentrations of chlorhexidine (CHX) and the S7 composite solution of CHX (0.07%) and the cationic surfactant benzalkonium chloride (BAC, 0.055%) (S7). MIC and MBC are presented as a percentage of dilution of the initial solutions. (b) The prevalence of non-biofilm-forming (NBF), weak biofilm-forming (WBF), moderate biofilm-forming (MBF) and strong biofilm-forming (SBF) strains. (c) The viability of E. coli after the addition of CHX or S7 to the one-day old biofilm. (d) The prevalence of E. coli containing a certain number of efflux pump genes among MDR and non-MDR strains with MBCCHX ≥ 1% and MBCCHX < 1%. (e) Heat map depicting the obtained MIC and MBC results and presence of the tested efflux pump genes in relation to MDR and biofilm biomass. 1–26, E. coli strains EC1-EC26. Data are mean ± standard error of the mean (SEM), n indicates independent strains, *** p < 0.0005.
Ijms 26 00355 g001
Figure 2. Sensitivity of K. pneumoniae strains to biocidal compositions based on chlorhexidine. (a) Minimum inhibitory (MIC) and minimum bactericidal (MBC) concentrations of chlorhexidine (CHX) and the S7 composite solution of CHX (0.07%) and the cationic surfactant benzalkonium chloride (BAC, 0.055%) (S7). MIC and MBC are presented as a percentage of dilution of the initial solutions. (b) The prevalence of non-biofilm-forming (NBF), weak biofilm-forming (WBF), moderate biofilm-forming (MBF) and strong biofilm-forming (SBF) strains. (c) The viability of E. coli after addition of CHX or S7 on the one-day old biofilm. (d) The prevalence of E. coli containing a certain number of efflux pump genes among MDR and non-MDR strains with MBCCHX ≥ 1% and MBCCHX < 1%. (e) Heat map depicting the obtained MIC and MBC results and presence of tested efflux pump genes in relation to MDR and biofilm biomass. 1–57, K. pneumoniae strains KP1-KP57. Data are mean ± SEM, n indicates independent strains, * p < 0.05, *** p < 0.0005.
Figure 2. Sensitivity of K. pneumoniae strains to biocidal compositions based on chlorhexidine. (a) Minimum inhibitory (MIC) and minimum bactericidal (MBC) concentrations of chlorhexidine (CHX) and the S7 composite solution of CHX (0.07%) and the cationic surfactant benzalkonium chloride (BAC, 0.055%) (S7). MIC and MBC are presented as a percentage of dilution of the initial solutions. (b) The prevalence of non-biofilm-forming (NBF), weak biofilm-forming (WBF), moderate biofilm-forming (MBF) and strong biofilm-forming (SBF) strains. (c) The viability of E. coli after addition of CHX or S7 on the one-day old biofilm. (d) The prevalence of E. coli containing a certain number of efflux pump genes among MDR and non-MDR strains with MBCCHX ≥ 1% and MBCCHX < 1%. (e) Heat map depicting the obtained MIC and MBC results and presence of tested efflux pump genes in relation to MDR and biofilm biomass. 1–57, K. pneumoniae strains KP1-KP57. Data are mean ± SEM, n indicates independent strains, * p < 0.05, *** p < 0.0005.
Ijms 26 00355 g002
Figure 3. Sensitivity of P. aeruginosa strains to biocidal compositions based on chlorhexidine. (a) Minimum inhibitory (MIC) and minimum bactericidal (MBC) concentrations of chlorhexidine (CHX) and the S7 composite solution of CHX (0.07%) and the cationic surfactant benzalkonium chloride (BAC, 0.055%) (S7). MIC and MBC are presented as a percentage of dilution of the initial solutions. (b) The prevalence of non-biofilm-forming (NBF), weak biofilm-forming (WBF), moderate biofilm-forming (MBF) and strong biofilm-forming (SBF) strains. (c) The viability of E. coli after addition of CHX or S7 on the one-day old biofilm. (d) The prevalence of E. coli containing a certain number of efflux pump genes among MDR and non-MDR strains with MBCCHX ≥ 1% and MBCCHX < 1%. (e) Heat map depicting the obtained MIC and MBC results and presence of tested efflux pump genes in relation to MDR and biofilm biomass. 1–28, P. aeruginosa strains PA1-PA28. Data are mean ± SEM n indicates independent strains, *** p < 0.0005.
Figure 3. Sensitivity of P. aeruginosa strains to biocidal compositions based on chlorhexidine. (a) Minimum inhibitory (MIC) and minimum bactericidal (MBC) concentrations of chlorhexidine (CHX) and the S7 composite solution of CHX (0.07%) and the cationic surfactant benzalkonium chloride (BAC, 0.055%) (S7). MIC and MBC are presented as a percentage of dilution of the initial solutions. (b) The prevalence of non-biofilm-forming (NBF), weak biofilm-forming (WBF), moderate biofilm-forming (MBF) and strong biofilm-forming (SBF) strains. (c) The viability of E. coli after addition of CHX or S7 on the one-day old biofilm. (d) The prevalence of E. coli containing a certain number of efflux pump genes among MDR and non-MDR strains with MBCCHX ≥ 1% and MBCCHX < 1%. (e) Heat map depicting the obtained MIC and MBC results and presence of tested efflux pump genes in relation to MDR and biofilm biomass. 1–28, P. aeruginosa strains PA1-PA28. Data are mean ± SEM n indicates independent strains, *** p < 0.0005.
Ijms 26 00355 g003
Figure 4. Sensitivity of S. aureus strains to biocidal compositions based on chlorhexidine. (a) Minimum inhibitory (MIC) and minimum bactericidal (MBC) concentrations of chlorhexidine (CHX) and the S7 composite solution of CHX (0.07%) and the cationic surfactant benzalkonium chloride (BAC, 0.055%) (S7). MIC and MBC are presented as a percentage of dilution of the initial solutions. (b) The prevalence of non-biofilm-forming (NBF), weak biofilm-forming (WBF), moderate biofilm-forming (MBF) and strong biofilm-forming (SBF) strains. (c) The viability of E. coli after addition of CHX or S7 on the one-day old biofilm. (d) The prevalence of E. coli containing a certain number of efflux pump genes among MDR and non-MDR strains with MBCCHX ≥ 1% and MBCCHX < 1%. (e) Heat map depicting the obtained MIC and MBC results and the presence of tested efflux pump genes in relation to MDR and biofilm biomass. 1–29, S. aureus strains SA1-SA29. Data are mean ± SEM, n indicates independent strains, *** p < 0.0005.
Figure 4. Sensitivity of S. aureus strains to biocidal compositions based on chlorhexidine. (a) Minimum inhibitory (MIC) and minimum bactericidal (MBC) concentrations of chlorhexidine (CHX) and the S7 composite solution of CHX (0.07%) and the cationic surfactant benzalkonium chloride (BAC, 0.055%) (S7). MIC and MBC are presented as a percentage of dilution of the initial solutions. (b) The prevalence of non-biofilm-forming (NBF), weak biofilm-forming (WBF), moderate biofilm-forming (MBF) and strong biofilm-forming (SBF) strains. (c) The viability of E. coli after addition of CHX or S7 on the one-day old biofilm. (d) The prevalence of E. coli containing a certain number of efflux pump genes among MDR and non-MDR strains with MBCCHX ≥ 1% and MBCCHX < 1%. (e) Heat map depicting the obtained MIC and MBC results and the presence of tested efflux pump genes in relation to MDR and biofilm biomass. 1–29, S. aureus strains SA1-SA29. Data are mean ± SEM, n indicates independent strains, *** p < 0.0005.
Ijms 26 00355 g004
Table 1. Comparison of the survival of bacteria E. coli, K. pneumoniae, P. aeruginosa, and S. aureus under the action of CHX and S7 in plankton and biofilm.
Table 1. Comparison of the survival of bacteria E. coli, K. pneumoniae, P. aeruginosa, and S. aureus under the action of CHX and S7 in plankton and biofilm.
ParameterMicroorganism
E. coli
(n = 26)
K. pneumoniae (n = 57)P. aeruginosa
(n = 23)
S. aureus
(n = 29)
Median MIC and MBC in plankton culture, final concentration of CHX or S7 (CHX/BAC) in %
MICCHX0.000380.000780.000780.000006
MBCCHX0.000780.000780.001560.000025
MICS70.00000013/
0.00000011
0.0000084/
0.0000066
0.000017/
0.000013
0.00000013/
0.0000001
MBCS70.00000027/
0.00000021
0.0000084/
0.0000066
0.000017/
0.000013
0.00000026/
0.00000021
Bacterial survival in % (median CFU/mL) in one-day old biofilm after application of the biocidal solution
After CHX80.8 (7.98 × 103)5.3 (3.3 × 102)32.1 (1.0 × 101)34.5 (0.7 × 101)
After S70000
Biofilm biomass, median OD5700.1230.3910.7030.158
Note. MIC—minimum inhibitory concentration, MBC—minimum bactericidal concentration, CHX—chlorhexidine, S7—composite solution of CHX (0.07%) and the cationic surfactant benzalkonium chloride (BAC, 0.055%).
Table 2. Comparison of the survival of randomly chosen strains of E. coli, K. pneumoniae, P. aeruginosa, and S. aureus with the immediate action of CHX and S7 on the “ceramic tile” and “plastic” surfaces.
Table 2. Comparison of the survival of randomly chosen strains of E. coli, K. pneumoniae, P. aeruginosa, and S. aureus with the immediate action of CHX and S7 on the “ceramic tile” and “plastic” surfaces.
Exposure Time, minSolutionE. coli
Strain EC8
K. pneumoniae
Strain KP20
P. aeruginosa
Strain PA5
S. aureus
Strain SA12
CFU/100 cm2EffectCFU/100 cm2EffectCFU/100 cm2EffectCFU/100 cm2Effect
Ceramic tiles
10NaCl>300NBE>300NBE>300NBE>300NBE
CHX0Bactericidal0Bactericidal50–99IBA<5IBA
S70Bactericidal0Bactericidal0Bactericidal0Bactericidal
30NaCl>300NBE>300NBE>300NBE>300NBE
CHX0Bactericidal 0Bactericidal 0Bactericidal0Bactericidal
S70Bactericidal0Bactericidal0Bactericidal0Bactericidal
60NaCl>300NBE>300NBE>300NBE>300NBE
CHX0Bactericidal0Bactericidal0Bactericidal0Bactericidal
S70Bactericidal0Bactericidal0Bactericidal0Bactericidal
Plastic
10NaCl>300NBE>300NBE>300NBE>300NBE
CHX0Bactericidal0Bactericidal5-99IBA0Bactericidal
S70Bactericidal0Bactericidal0Bactericidal0Bactericidal
30NaCl>300NBE>300NBE>300NBE>300NBE
CHX0Bactericidal0Bactericidal0Bactericidal0Bactericidal
S70Bactericidal0Bactericidal0Bactericidal0Bactericidal
60NaCl>300NBE>300NBE>300NBE>300NBE
CHX0Bactericidal0Bactericidal0Bactericidal0Bactericidal
S70Bactericidal0Bactericidal0Bactericidal0Bactericidal
Note. NBE—no bactericidal effect, IBA—incomplete bactericidal action.
Table 3. Comparison of the survival of randomly chosen strains of E. coli, K. pneumoniae, P. aeruginosa, and S. aureus under the action of CHX and S7 on one-day old biofilms formed on the surface of “ceramic tile” and “plastic”.
Table 3. Comparison of the survival of randomly chosen strains of E. coli, K. pneumoniae, P. aeruginosa, and S. aureus under the action of CHX and S7 on one-day old biofilms formed on the surface of “ceramic tile” and “plastic”.
Exposure Time, hSolutionE. coli
Strain EC8
K. pneumoniae
Strain KP20
P. aeruginosa
Strain PA5
S. aureus
Strain SA12
CFU/
100 cm2
EffectCFU/
100 cm2
EffectCFU/
100 cm2
EffectCFU/
100 cm2
Effect
Ceramic tiles
1NaCl>100NBE>300NBE10–50NBE>100NBE
CHX0Bactericidal0Bactericidal0Bactericidal0Bactericidal
S70Bactericidal0Bactericidal0Bactericidal0Bactericidal
2NaCl>100NBE>300NBE10–50NBE>100NBE
CHX0Bactericidal0Bactericidal0Bactericidal0Bactericidal
S70Bactericidal0Bactericidal0Bactericidal0Bactericidal
Plastic
1NaCl10–50NBE>300NBE10–50NBE>100NBE
CHX0Bactericidal0Bactericidal0Bactericidal0Bactericidal
S70Bactericidal0Bactericidal0Bactericidal0Bactericidal
2NaCl10–50NBE>300NBE10–50NBE>100NBE
CHX0Bactericidal0Bactericidal0Bactericidal0Bactericidal
S70Bactericidal0Bactericidal0Bactericidal0Bactericidal
Note. NBE—no bactericidal effect.
Table 4. The primer sequence, PCR program, and expected amplicon size used in the study.
Table 4. The primer sequence, PCR program, and expected amplicon size used in the study.
GeneNucleotide Sequence (5′–3′)PCR ProgramAmplicon Size (bp)Reference
qacEΔ1TAGCGAGGGCTTTACTAAGC
ATTCAGAATGCCGAACACCG
93 °C, 2 m; 35 [93 °C, 30 s; 55 °C, 30 s; 72 °C,1 m]; 72 °C, 10 m300[89]
qacECCCGAATTCATGAAAGGCTGGCTT
AAGCTTTCACCATGGCGTCGG
cepACAACTCCTTCGCCTATCCCG
TCAGGTCAGACCAAACGGCG
94 °C, 5 m; 30 [94 °C, 30 s; 53 °C, 1 m; 72 °C, 2 m]; 72 °C, 7 m1051
oqxACTCGGCGCGATGATGCT
CCACTCTTCACGGGAGACGA
95 °C, 1 m; 35 [95 °C, 45 s; 60 °C, 45 s; 72 °C, 1 m]; 72 °C, 5 m392[48]
oqxBTTCTCCCCCGGCGGGAAGTAC
CTCGGCCATTTTGGCGCGTA
512
acrABATCAGCGGCCGGATTGGTAAA
CGGGTTCGGGAAAATAGCGCG
94 °C, 5 m; 30 [94 °C, 1 m; 56 °C, 30 s; 72 °C, 1 m]; 72 °C, 10 m312[90]
mexA/BTGTCGAAGTTTTTCATTGATAG
AAGGTCACGGTGATGGT
94 °C, 3 m; 32 [94 °C, 30 s; 57 °C, 45 s; 72 °C, 1 m]; 72 °C, 5 m280[91]
smr (qacC/D)GCCATAAGTACTGAAGTTATTGGA
GACTACGGTTGTTAAGACTAAACCT
95 °C, 5 m; 35 [94 °C, 40 s; 54 °C, 50 s; 72 °C, 50 s]; 72 °C, 5 m195[92]
qacA/BCTATGGCAATAGGAGATATGGTGT
CCACTACAGATTCTTCAGCTACATG
94 °C, 5 m; 30 [94 °C, 30 s; 53 °C, 30 s; 72 °C, 1 m]; 72 °C, 5 m416[89]
norAATGAATAAACAGATTTTTGT
CTACATATTTTGTTCTTTCA
94 °C, 3 m; 35 [94 °C, 1 m; 50 °C, 45 s; 72 °C, 1,5 m]; 72 °C, 3,5 m1167[71]
norBTCGCCTTCAACACCATCAAC
GGCGTAGGAGATGATGGTCA
94 °C, 3 m; 35 [94 °C, 1 m; 52 °C, 1 m; 72 °C, 1 m]; 72 °C, 3,5 m236[72]
norCGCGGGAGTGTGTTCTTCATC
CTGGAGGAAGGTGTTGAAGC
94 °C, 3 m; 35 [94 °C, 1 m; 62 °C, 45 s; 72 °C, 1,5 m]; 72 °C, 3,5 m441
mepAGCAGTTATCATGTCTATCGGCG
TGCACCTTGTAAAATGGCCA
240[93]
mdeATATGGCGATTGTTGTTTTTACTAC
AACCGTGTGCATTCATTTCTGG
94 °C, 3 m; 35 [94 °C, 1 m; 62 °C, 45 s; 72 °C, 1 m]; 72 °C, 3,5 m1072[94]
sepAGCAGTCGAGCATTTAATGGA
ACGTTGTTGCAACTGTGTAAGA
94 °C, 4 m; 35 [94 °C, 30 s; 57 °C, 55 s; 72 °C, 1 m]; 72 °C, 5 m103[95]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kuznetsova, M.V.; Nesterova, L.Y.; Mihailovskaya, V.S.; Selivanova, P.A.; Kochergina, D.A.; Karipova, M.O.; Valtsifer, I.V.; Averkina, A.S.; Starčič Erjavec, M. Nosocomial Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus: Sensitivity to Chlorhexidine-Based Biocides and Prevalence of Efflux Pump Genes. Int. J. Mol. Sci. 2025, 26, 355. https://doi.org/10.3390/ijms26010355

AMA Style

Kuznetsova MV, Nesterova LY, Mihailovskaya VS, Selivanova PA, Kochergina DA, Karipova MO, Valtsifer IV, Averkina AS, Starčič Erjavec M. Nosocomial Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus: Sensitivity to Chlorhexidine-Based Biocides and Prevalence of Efflux Pump Genes. International Journal of Molecular Sciences. 2025; 26(1):355. https://doi.org/10.3390/ijms26010355

Chicago/Turabian Style

Kuznetsova, Marina V., Larisa Y. Nesterova, Veronika S. Mihailovskaya, Polina A. Selivanova, Darja A. Kochergina, Marina O. Karipova, Igor V. Valtsifer, Anastasia S. Averkina, and Marjanca Starčič Erjavec. 2025. "Nosocomial Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus: Sensitivity to Chlorhexidine-Based Biocides and Prevalence of Efflux Pump Genes" International Journal of Molecular Sciences 26, no. 1: 355. https://doi.org/10.3390/ijms26010355

APA Style

Kuznetsova, M. V., Nesterova, L. Y., Mihailovskaya, V. S., Selivanova, P. A., Kochergina, D. A., Karipova, M. O., Valtsifer, I. V., Averkina, A. S., & Starčič Erjavec, M. (2025). Nosocomial Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus: Sensitivity to Chlorhexidine-Based Biocides and Prevalence of Efflux Pump Genes. International Journal of Molecular Sciences, 26(1), 355. https://doi.org/10.3390/ijms26010355

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop