Group V Chitin Deacetylases Are Responsible for the Structure and Barrier Function of the Gut Peritrophic Matrix in the Chinese Oak Silkworm Antheraea pernyi
Abstract
1. Introduction
2. Results
2.1. ApCDAs Sequence Analysis
2.2. Temporal and Spatial Distribution of ApCDA5a and ApCDA5b
2.3. Effect of Nosema Spores on ApCDA Expression
2.4. Knockdown of ApCDA5 Interfered with PM Formation
2.5. Functional Analysis of Group V ApCDAs
3. Materials and Methods
3.1. Insect Rearing and Infection Experiments
3.2. Identification of CDA5 Genes and Bioinformatic Analysis
3.3. Developmental and Tissue-Specific Expression Profiles of ApCDA5a and ApCDA5b
3.4. Quantitative RT-PCR Analysis
3.5. Functional Analysis of ApCDA5 by RNA Interference (RNAi)
3.6. PM Structural Analysis by Scanning Electron Microscopy (SEM)
3.7. Statistical Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, X.; Cooper, A.M.; Zhang, J.; Zhu, K.Y. Biosynthesis, modifications and degradation of chitin in the formation and turnover of peritrophic matrix in insects. J. Insect Physiol. 2019, 114, 109–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ibrahim, S.P.; Dias, R.O.; Ferreira, C.; Silva, C.P.; Terra, W.R. Histochemistry and transcriptomics of mucins and peritrophic membrane (PM) proteins along the midgut of a beetle with incomplete PM and their complementary function. Insect Biochem. Mol. Biol. 2023, 162, 104027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kariu, T.; Smith, A.; Yang, X.; Pal, U. A chitin deacetylase-like protein is a predominant constituent of tick peritrophic membrane that influences the persistence of Lyme disease pathogens within the vector. PLoS ONE 2013, 8, e78376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zha, X.L.; Wang, H.; Sun, W.; Zhang, H.Y.; Wen, J.; Huang, X.Z.; Lu, C.; Shen, Y.H. Characteristics of the peritrophic matrix of the silkworm, Bombyx mori and factors influencing its formation. Insects 2021, 12, 516. [Google Scholar] [CrossRef] [Scilit]
- Huber, M.; Cabib, E.; Miller, L.H. Malaria parasite chitinase and penetration of the mosquito peritrophic membrane. Proc. Natl. Acad. Sci. USA 1991, 88, 2807–2810. [Google Scholar] [CrossRef] [Scilit]
- Langer, R.C.; Vinetz, J.M. Plasmodium ookinete-secreted chitinase and parasite penetration of the mosquito peritrophic matrix. Trends Parasitol. 2001, 17, 269–272. [Google Scholar] [CrossRef] [Scilit]
- Passarelli, A.L. Barriers to success: How baculoviruses establish efficient systemic infections. Virology 2011, 411, 383–392. [Google Scholar] [CrossRef] [Scilit]
- Schlein, Y.; Jacobson, R.L.; Shlomai, J. Chitinase secreted by Leishmania functions in the sandfly vector. Proc. R. Soc. Lond. Ser. Biol. Sci. 1991, 245, 121–126. [Google Scholar]
- Liu, X.; Ma, X.; Lei, C.; Xiao, Y.; Zhang, Z.; Sun, X. Synergistic effects of Cydia pomonella granulovirus GP37 on the infectivity of nucleopolyhedroviruses and the lethality of Bacillus thuringiensis. Arch. Virol. 2011, 156, 1707–1715. [Google Scholar] [CrossRef] [Scilit]
- Thamthiankul, S.; Moar, W.; Miller, M.; Panbangred, W. Improving the insecticidal activity of Bacillus thuringiensis subsp. aizawai against Spodoptera exigua by chromosomal expression of a chitinase gene. Appl. Microbiol. Biotechnol. 2004, 65, 183–192. [Google Scholar] [CrossRef] [Scilit]
- Güney, G.; Cedden, D.; Hänniger, S.; Hegedus, D.D.; Heckel, D.G.; Toprak, U. Peritrophins are involved in the defense against Bacillus thuringiensis and nucleopolyhedrovirus formulations in Spodoptera littoralis (Lepidoptera: Noctuidae). Insect Biochem. Mol. Biol. 2024, 166, 104073. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Merzendorfer, H. Insect-derived chitinases. Yellow biotechnology II: Insect biotechnology in plant protection and industry. Adv. Biochem. Eng. 2013, 136, 19–50. [Google Scholar]
- Zhong, X.W.; Wang, X.H.; Tan, X.; Xia, Q.Y.; Xiang, Z.H.; Zhao, P. Identification and molecular characterization of a chitin deacetylase from Bombyx mori peritrophic membrane. Int. J. Mol. Sci. 2014, 15, 1946–1961. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kafetzopoulos, D.; Martinou, A.; Bouriotis, V. Bioconversion of chitin to chitosan: Purification and characterization of chitin deacetylase from Mucor rouxii. Proc. Natl. Acad. Sci. USA 1993, 90, 2564–2568. [Google Scholar] [CrossRef] [Scilit]
- Campbell, P.M.; Cao, A.T.; Hines, E.R.; East, P.D.; Gordon, K.H. Proteomic analysis of the peritrophic matrix from the gut of the caterpillar, Helicoverpa armigera. Insect Biochem. Mol. Biol. 2008, 38, 950–958. [Google Scholar] [CrossRef] [Scilit]
- Dixit, R.; Arakane, Y.; Specht, C.A.; Richard, C.; Kramer, K.J.; Beeman, R.W.; Muthukrishnan, S. Domain organization and phylogenetic analysis of proteins from the chitin deacetylase gene family of Tribolium castaneum and three other species of insects. Insect Biochem. Mol. Biol. 2008, 38, 440–451. [Google Scholar] [CrossRef] [Scilit]
- Noh, M.Y.; Muthukrishnan, S.; Kramer, K.J.; Arakane, Y. Group I chitin deacetylases are essential for higher order organization of chitin fibers in beetle cuticle. J. Biol. Chem. 2018, 293, 6985–6995. [Google Scholar] [CrossRef] [Scilit]
- Quan, G.; Ladd, T.; Duan, J.; Wen, F.; Doucet, D.; Cusson, M.; Krell, P.J. Characterization of a spruce budworm chitin deacetylase gene: Stage-and tissue-specific expression, and inhibition using RNA interference. Insect Biochem. Mol. Biol. 2013, 43, 683–691. [Google Scholar] [CrossRef] [Scilit]
- Arakane, Y.; Dixit, R.; Begum, K.; Park, Y.; Specht, C.A.; Merzendorfer, H.; Kramer, K.J.; Muthukrishnan, S.; Beeman, R.W. Analysis of functions of the chitin deacetylase gene family in Tribolium castaneum. Insect Biochem. Mol. Biol. 2009, 39, 355–365. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.J.; Chen, Z.C.; Wang, Y.W.; Fu, K.Y.; Guo, W.C.; Li, G.Q. Silencing chitin deacetylase 2 impairs larval–pupal and pupal–adult molts in Leptinotarsa decemlineata. Insect Mol. Biol. 2019, 28, 52–64. [Google Scholar] [CrossRef] [Scilit]
- Yu, R.R.; Liu, W.M.; Zhao, X.M.; Zhang, M.; Li, D.Q.; Zuber, R.; Ma, E.B.; Zhu, K.; Moussian, B.; Zhang, J.Z. LmCDA1 organizes the cuticle by chitin deacetylation in Locusta migratoria. Insect Mol. Biol. 2019, 28, 301–312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mun, S.; Noh, M.Y.; Geisbrecht, E.R.; Kramer, K.J.; Muthukrishnan, S.; Arakane, Y. Chitin deacetylases are necessary for insect femur muscle attachment and mobility. Proc. Natl. Acad. Sci. USA 2022, 119, e2120853119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, T.; Ma, P.; Zhou, J.; He, Y.; Liu, W.; Liu, X.; Zhang, X.; Yu, R.; Zhang, M.; Moussian, B.; et al. Group I CDAs are responsible for a selective CHC-independent cuticular barrier in Locusta migratoria. Pestic. Biochem. Physiol. 2021, 175, 104854. [Google Scholar] [CrossRef] [Scilit]
- Toprak, U.; Erlandson, M.; Baldwin, D.; Karcz, S.; Wan, L.; Coutu, C.; Gillott, C.; Hegedus, D.D. Identification of the Mamestra configurata (Lepidoptera: Noctuidae) peritrophic matrix proteins and enzymes involved in peritrophic matrix chitin metabolism. Insect Sci. 2016, 23, 656–674. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Zhao, D.; Guo, X.C.; Liu, Z.R.; Li, R.J.; Lu, X.J.; Guo, W. Group V chitin deacetylases influence the structure and composition of the midgut of Beet armyworm, Spodoptera exigua. Int. J. Mol. Sci. 2023, 24, 3076. [Google Scholar] [CrossRef] [Scilit]
- Yu, H.Z.; Li, N.Y.; Li, B.; Toufeeq, S.; Xie, Y.X.; Huang, Y.L.; Du, Y.M.; Zeng, X.D.; Zhu, B.; Lu, Z.J. Immune functional analysis of chitin deacetylase 3 from the Asian citrus psyllid Diaphorina citri. Int. J. Mol. Sci. 2019, 21, 64. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Li, Y.P.; Ambühl, D.; Liu, Y.Q.; Li, M.W.; Qin, L. Nutrient composition of Chinese oak silkworm, Antheraea pernyi, a traditional edible insect in China: A review. J. Insects Food Feed 2020, 6, 355–369. [Google Scholar] [CrossRef] [Scilit]
- Li, X.S.; Wang, G.B.; Sun, Y.; Liu, W.; He, Y.Z.; Wang, F.C.; Jiang, Y.R.; Qin, L. Transcriptome analysis of the midgut of the Chinese oak silkworm Antheraea pernyi infected with Antheraea pernyi nucleopolyhedrovirus. PLoS ONE 2016, 11, e0165959. [Google Scholar] [CrossRef] [Scilit]
- Blair, D.E.; Schüttelkopf, A.W.; MacRae, J.I.; van Aalten, D.M. Structure and metal-dependent mechanism of peptidoglycan deacetylase, a streptococcal virulence factor. Proc. Natl. Acad. Sci. USA 2005, 102, 15429–15434. [Google Scholar] [CrossRef] [Scilit]
- Jakubowska, A.K.; Caccia, S.; Gordon, K.H.; Ferré, J.; Herrero, S. Downregulation of a chitin deacetylase-like protein in response to baculovirus infection and its application for improving baculovirus infectivity. J. Virol. 2010, 84, 2547–2555. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.; Zhong, L.; Wang, Y.; Zheng, S.; Bian, Y.; Du, J.; Yang, R.; Liu, W.; Qin, L. Tyrosine hydroxylase and DOPA decarboxylase are associated with pupal melanization during larval–pupal transformation in Antheraea pernyi. Front. Physiol. 2022, 13, 832730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Liu, W.; Jiang, Y.; Huang, L.; Irfan, M.; Shi, S.; Yang, R.; Qin, L. Morphological and molecular characterization of Nosema pernyi, a microsporidian parasite in Antheraea pernyi. Parasitol. Res. 2015, 114, 3327–3336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003, 31, 3784–3788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Scilit]
- Letunic, I.; Bork, P. Interactive tree of life (iTOL) v3: An online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res. 2016, 44, W242–W245. [Google Scholar] [CrossRef] [Scilit]
- Liu, W.; Wang, Y.; Leng, Z.; Wang, Q.; Duan, X.; Luo, Y.; Jiang, Y.; Qin, L. Nitric oxide plays a crucial role in midgut immunity under microsporidian infection in Antheraea pernyi. Mol. Immunol. 2020, 126, 65–72. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit]
- Luschnig, S.; Bätz, T.; Armbruster, K.; Krasnow, M.A. Serpentine and vermiform encode matrix proteins with chitin binding and deacetylation domains that limit tracheal tube length in Drosophila. Curr. Biol. 2006, 16, 186–194. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Yan, J.; Liu, Q.; Zhang, Y.; Gong, J.; Hou, Y. Genome-wide analysis and hormone regulation of chitin deacetylases in silkworm. Int. J. Mol. Sci. 2019, 20, 1679. [Google Scholar] [CrossRef] [Scilit]
- Yu, R.; Liu, W.; Li, D.; Zhao, X.; Ding, G.; Zhang, M.; Ma, E.; Zhu, K.; Li, S.; Moussian, B.; et al. Helicoidal organization of chitin in the cuticle of the migratory locust requires the function of the chitin deacetylase2 enzyme (LmCDA2). J. Biol. Chem. 2016, 291, 24352–24363. [Google Scholar] [CrossRef] [Scilit]
- Derksen, A.C.; Granados, R.R. Alteration of a lepidopteran peritrophic membrane by baculoviruses and enhancement of viral infectivity. Virology 1988, 167, 242–250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, P.; Granados, R.R. An intestinal mucin is the target substrate for a baculovirus enhancin. Proc. Natl. Acad. Sci. USA 1997, 94, 6977–6982. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Regev, A.; Keller, M.; Strizhov, N.; Sneh, B.; Prudovsky, E.; Chet, I.; Ginzberg, I.; Koncz-Kalman, Z.; Koncz, C.; Schell, J.; et al. Synergistic activity of a Bacillus thuringiensis delta-endotoxin and a bacterial endochitinase against Spodoptera littoralis larvae. Appl. Environ. Microbiol. 1996, 62, 3581–3586. [Google Scholar] [CrossRef] [Scilit]
- Fescemyer, H.W.; Sandoya, G.V.; Gill, T.A.; Ozkan, S.; Marden, J.H.; Luthe, D.S. Maize toxin degrades peritrophic matrix proteins and stimulates compensatory transcriptome responses in fall armyworm midgut. Insect Biochem. Mol. Biol. 2013, 43, 280–291. [Google Scholar] [CrossRef] [Scilit]
- Xi, Y.; Pan, P.L.; Ye, Y.X.; Yu, B.; Zhang, C.X. Chitin deacetylase family genes in the brown planthopper, Nilaparvata lugens (H. emiptera: D. elphacidae). Insect Mol. Biol. 2014, 23, 695–705. [Google Scholar] [CrossRef] [Scilit]
- Pan, G.; Xu, J.; Li, T.; Xia, Q.; Liu, S.L.; Zhang, G.; Li, S.; Li, C.; Liu, H.; Yang, L.; et al. Comparative genomics of parasitic silkworm microsporidia reveal an association between genome expansion and host adaptation. BMC Genom. 2013, 14, 186. [Google Scholar] [CrossRef] [Scilit]
- Nolan, R.A.; Clovis, C.J. Nosema fumiferanae release into the gut of the larvae of the eastern spruce budworm (Choristoneura fumiferana). J. Invertebr. Pathol. 1985, 45, 112–114. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Q.; Li, F.; Shu, Q.; Feng, P.; Wang, Y.; Dai, M.; Mao, T.; Sun, H.; Wei, J.; Li, B. Disruption of peritrophic matrix chitin metabolism and gut immune by chlorantraniliprole results in pathogenic bacterial infection in Bombyx mori. Pestic. Biochem. Physiol. 2023, 193, 105430. [Google Scholar] [CrossRef] [Scilit]








| Name | Primers |
|---|---|
| ApCDA5a | Forward: ATTTCCAAAGGATTGCGGTAG |
| Reverse: ATAGGACCACAGGAAGTAGCG | |
| ApCDA5b | Forward: TGCCGCTGTAAACGAAATA |
| Reverse: ATAATCCAAGAGGGTTTCC | |
| Sq-ApCDA5a | Forward: CTGCCCTACAGCCTCCATTCC |
| Reverse: CCACAGGAAGTAGCGGGACAT | |
| Sq-ApCDA5b | Forward: GCTCATTTCGCTAACATTCCC |
| Reverse: AACCAGGCATCCTCATCTTCG | |
| Sq-- | Forward: CCAAAGGCCAACAGAGAGAAGA |
| Reverse: CAAGAATGAGGGCTGGAAGAGA | |
| qPCR-ApCDA5a | Forward: GCTTACCCAGCCGTTTACAG |
| Reverse: CACAGGAAGTAGCGGGACAT | |
| qPCR-ApCDA5b | Forward: GTGCCCAACTGCTTCAATCC |
| Reverse: ACCAGGCATCCTCATCTTCG | |
| qPCR-- | Forward: ACCAACTGGGACGACATGGAGAAA |
| Reverse: TCTCTCTGTTGGCCTTTGGGTTGA | |
| dsApCDA5a | Forward: TAATACGACTCACTATAGGGCACCACAAACCTTCTGGATAAC |
| Reverse: TAATACGACTCACTATAGGGCAGGAATGGAGGCTGTAGGGCA | |
| dsApCDA5b | Forward: TAATACGACTCACTATAGGGACACCGCAGACATACTGGGCT |
| Reverse: TAATACGACTCACTATAGGGACCAGGCATCCTCATCTTCGC | |
| dsGFP | Forward: TAATACGACTCACTATAGGGAGATAAACGGCCACAAGTTCAGC |
| Reverse: TAATACGACTCACTATAGGGAGAGTGTTCTGCTGGTAGTGGTC |
| Name | GenBank Accession Number | Protein Length (aa) | Signal Peptide Length (aa) | M. W.(kDa) | pI |
|---|---|---|---|---|---|
| ApCDA5a | WJN23032.1 | 380 | 17 | 43.06 | 4.46 |
| ApCDA5b | WJN23033.1 | 385 | 18 | 43.60 | 4.44 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, J.-W.; Wang, Q.; Jiang, Y.-M.; Jiang, Y.-R.; Wang, Y.; Liu, W. Group V Chitin Deacetylases Are Responsible for the Structure and Barrier Function of the Gut Peritrophic Matrix in the Chinese Oak Silkworm Antheraea pernyi. Int. J. Mol. Sci. 2025, 26, 296. https://doi.org/10.3390/ijms26010296
Tang J-W, Wang Q, Jiang Y-M, Jiang Y-R, Wang Y, Liu W. Group V Chitin Deacetylases Are Responsible for the Structure and Barrier Function of the Gut Peritrophic Matrix in the Chinese Oak Silkworm Antheraea pernyi. International Journal of Molecular Sciences. 2025; 26(1):296. https://doi.org/10.3390/ijms26010296
Chicago/Turabian StyleTang, Jing-Wen, Qi Wang, Yun-Min Jiang, Yi-Ren Jiang, Yong Wang, and Wei Liu. 2025. "Group V Chitin Deacetylases Are Responsible for the Structure and Barrier Function of the Gut Peritrophic Matrix in the Chinese Oak Silkworm Antheraea pernyi" International Journal of Molecular Sciences 26, no. 1: 296. https://doi.org/10.3390/ijms26010296
APA StyleTang, J.-W., Wang, Q., Jiang, Y.-M., Jiang, Y.-R., Wang, Y., & Liu, W. (2025). Group V Chitin Deacetylases Are Responsible for the Structure and Barrier Function of the Gut Peritrophic Matrix in the Chinese Oak Silkworm Antheraea pernyi. International Journal of Molecular Sciences, 26(1), 296. https://doi.org/10.3390/ijms26010296

