Next Article in Journal
Biomarkers of Extracellular Matrix Fragments in Patients with Psoriasis
Next Article in Special Issue
Glycyl-tRNA Synthetase as a Target for Antiviral Drug Screening Against Influenza Virus
Previous Article in Journal
Genome-Wide Association Study to Identify Genetic Factors Linked to HBV Reactivation Following Liver Transplantation in HBV-Infected Patients
Previous Article in Special Issue
Mapping Antimalarial Drug Resistance in Mozambique: A Systematic Review of Plasmodium falciparum Genetic Markers Post-ACT Implementation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Synergy of Chitosan and Azoxystrobin Against Fusarium graminearum Is Modulated by Selected ABC Transporters

1
Plant Breeding and Acclimatization Institute—National Research Institute, Radzikow, 05-870 Blonie, Poland
2
Ludwik Rydygier Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Torun, 85-094 Bydgoszcz, Poland
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(1), 262; https://doi.org/10.3390/ijms26010262
Submission received: 29 November 2024 / Revised: 23 December 2024 / Accepted: 28 December 2024 / Published: 30 December 2024
(This article belongs to the Special Issue Antimicrobial Agents: Natural Products or Synthetic Compounds)

Abstract

The development of innovative and effective strategies to combat fungal pathogens is critical to sustainable crop protection. Fungicides have been used for over two centuries, with traditional copper- and sulfur-based formulations still in use due to their broad-spectrum, multisite mode of action, which minimizes the risk of pathogen resistance. In contrast, modern systemic fungicides, though potent, often target a single site of action, leading to the accelerated emergence of resistant fungal strains. This study explores synergistic interactions between chitosan (CS) and selected fungicides, focusing on their antifungal activity against Fusarium graminearum. Among the fungicides tested, azoxystrobin (Amistar) exhibited the highest 44.88 synergy score when combined with CS (30 kDa, degree of deacetylation ≥ 90), resulting in significantly improved antifungal efficacy. Furthermore, the combination of CS and Amistar with double-stranded RNA (dsRNA) targeting selected ABC transporter genes further amplified antifungal activity by silencing genes critical for fungal tolerance to treatment. This dual synergy highlights the potential of RNA interference (RNAi) as both a functional tool to investigate fungal physiology and an effective antifungal strategy. These findings reveal a promising and environmentally friendly approach to mitigate resistance while improving fungal control. Furthermore, the remarkable synergy between azoxystrobin and CS presents a novel mechanism with significant potential for sustainable agricultural applications, which warrants further investigation to elucidate its molecular basis.

1. Introduction

Exploring synergistic interactions can deepen our understanding of the mechanisms behind the antifungal activities of specific compounds and guide the development of innovative and more effective combinations. Chitosan (CS), a copolymer composed of N-acetyl-D-glucosamine (GlcNAc) and deacetylated D-glucosamine (GlcN), is derived through the partial deacetylation and hydrolysis of chitin, the second most abundant natural polysaccharide after cellulose. Thanks to its distinct molecular characteristics, CS exhibits notable biological activities across various organisms. It has strong antifungal properties, effectively inhibiting the growth of pathogenic fungi and reducing mycotoxin levels in plant tissues [1]. Furthermore, CS is recognized for its ability to stimulate plant immune responses and enhance growth [2,3]. These attributes, combined with its biocompatibility and biodegradability, position CS as a promising candidate for applications in sustainable agriculture [4]. Its proven ability to control Fusarium growth, minimize mycotoxin production, and strengthen plant immunity highlights its potential as a powerful solution for managing Fusarium-related plant diseases. Fungicides have been utilized for over two centuries to protect crops from fungal pathogens. Traditional copper- and sulfur-based formulations, while relatively less potent, remain in use due to their multisite mode of action, which significantly reduces the risk of fungal resistance [5]. For example, the Miedzian fungicide used in this study contains copper oxychloride as its active ingredient. Copper oxychloride interacts with sulfhydryl groups in proteins, leading to their denaturation and restricting fungal growth [6,7]. In contrast, modern systemic fungicides that target a single site of action are more prone to fostering fungal resistance [8], thereby limiting their long-term utility. Examples of such fungicides used in this study include Amistar, Fungimat, and Micosar. Amistar, which contains azoxystrobin, is a broad spectrum fungicide that disrupts mitochondrial electron transport at the Q0 center of cytochrome bc1 [9]. Fungimat, with tebuconazole as its active ingredient, belongs to the triazole class of fungicides, which inhibit 14α-demethylase activity, impairing ergosterol synthesis and halting fungal growth [10]. Similarly, Micosar, containing metconazole as the active compound, is another broad-spectrum fungicide that inhibits ergosterol biosynthesis and is highly effective against Fusarium head blight (FHB) [11].
ATP-binding cassette (ABC) transporter genes have very broad biological functions such as signal transduction, and they are associated with pathogenesis and fungicide resistance in many species of fungi [12,13,14]. Typically, ABC transporter-based resistance is linked to the upregulation of these genes [15,16,17]. In Fusarium graminearum (F. graminearum), deletion of ABC genes has been shown to decrease virulence and increase susceptibility to azole group fungicides [18].
Our previous research explored the antifungal properties of CS, highlighting its potential to reduce fungal pathogenesis and inhibit mycotoxin production. Notably, significant antifungal activity was observed only in a specific batch of CS characterized by low molecular weight (MW) and a high degree of deacetylation (DD) [1]. In the present study, we observed that the most effective CS sample exhibited synergistic interactions when combined with selected fungicides. This article, therefore, aims to investigate these synergistic effects and elucidate the potential mechanisms underlying such interactions. The widespread reliance on modern, single-site fungicides often accelerates the emergence of resistant fungal strains [8]. Combining antifungal agents with different modes of action, such as site-specific fungicides and broad-spectrum CS, offers a promising strategy to minimize the use of plant-protective agrochemicals and mitigate the development of fungicide-resistant pathogens.

2. Results

2.1. Antifungal Activity of Selected Fungicides

The antifungal activities of selected fungicides were evaluated using 96-well microtiter plate culture of F. graminearum in potato dextrose broth (PDB) medium. The relative growth of F. graminearum in PDB medium supplemented with fungicides was shown as a proportion of its growth in the control PDB medium without fungicides (Figure 1) across series of concentrations (Supplementary Table S3). Miedzian Extra 350 SC containing copper oxychloride as the active ingredient (350 g/L) exhibited the weakest fungicidal or fungistatic activity. Growth inhibition was observed at a 101 dilution of the commercial fungicide, but the relative growth rate increased to 0.6 at the 102 dilution. Further dilutions (10−3 to 10−7) stimulated fungal growth instead of inhibiting it (Figure 1). Amistar 250 SC with azoxystrobin (250 g/L) inhibited F. graminearum growth at concentrations ranging from 101 to 103 dilutions, with a consistent relative growth rate of 0.2. At higher dilutions (10−4 to 106), partial growth inhibition was observed, with relative growth rates increasing from 0.53 to 0.83. The 10−7 dilution had no measurable effect on fungal growth (Figure 1). Micosar 60 SL containing metconazole (CAS:125116-23-6) (60 g/L) strongly inhibited growth in the 10−1 dilution. Almost complete inhibition was observed at dilutions from 102 to 10−4, with relative growth rates ranging from 0.00 to 0.04. Higher dilutions (105 to 107) did not significantly affect fungal growth (Figure 1). Fungimat with tebuconazole (25 g/L) exhibited the strongest fungicide activity among the fungicides tested. Growth was nearly completely inhibited at dilutions from 101 to 105. At a 106 dilution, growth was moderately inhibited, with a relative growth rate of 0.5. The 107 dilution, however, had no effect on fungal growth (Figure 1).

2.2. Antifungal Interaction of CS and Selected Fungicides

CS, a biocompatible macromolecule with potent antifungal properties, was selected based on previous findings demonstrating its strong antifungal activity [1]. The study aimed to evaluate the effect of CS on F. graminearum growth in PDB medium supplemented with CS and one of the following fungicides: Miedzian Extra 350 SC, Amistar 250 SC, Micosar 60 SL, or Fungimat. The combination of Miedzian Extra 350 SC (0, 0.035, 0.35, 3.5, and 35 mg/L) and CS (0 and 50 mg/L) yielded an average synergy score of 0.91. Synergistic interactions (highlighted in red on the 3D graph) were observed at Miedzian concentrations between 0.35 and 3.5 mg/L when combined with CS at 50 mg/L. Additive effects (marked in white) were observed at Miedzian concentrations of 0.035 and 35 mg/L with CS at 50 mg/L (Figure 2). The combination of Amistar 250 SC (0, 0.025, 0.25, 2.5, and 25 mg/L) and CS (0 and 50 mg/L) resulted in an average synergy score of 25.36. Strong synergistic effects (marked in red) were observed at Amistar concentrations of 2.5 and 25 mg/L with CS at 50 mg/L. However, antagonistic interactions (highlighted in green) occurred at lower Amistar concentrations of 0.025 and 0.25 mg/L with CS at 50 mg/L (Figure 2). The combination of Micosar 60 SL (0, 0.006, 0.06, 0.6, and 6 mg/L) and CS (0 and 50 mg/L) demonstrated a weak synergistic interaction at a concentration of Micosar of 0.6 mg/L with CS at 50 mg/L, resulting in a synergy score of 0.49. Antagonistic interactions (marked in green) were observed at lower Micosar concentrations of 0.006 and 0.06 mg/L with CS at 50 mg/L (Figure 2). The combination of Fungimat (0, 0.0025, 0.025, 0.25, and 2.5 mg/L) and CS (0 and 50 mg/L) produced an average synergy score of 8.19, with strong synergy observed at the Fungimat concentration of 0.25 mg/L with CS at 50 mg/L. Additive interactions (highlighted in white) were observed for all other concentrations (Figure 2).
Based on the synergy scores determined for the four fungicides, further investigations were conducted that focused on Amistar 250 due to its pronounced synergistic potential. These studies evaluated five concentrations of Amistar (0.025, 0.25, 2.5, 25, and 250 mg/L) combined with three concentrations of CS (25, 50, and 200 mg/L) (Figure 3). The average global synergy score for these specified concentrations was 11.44. CS at 50 mg/L exhibited strong synergy with Amistar at concentrations of 0.25, 2.5, 25, and 250 mg/L, with the highest synergy scores observed at 0.25 mg/L (42.82) and 2.5 mg/L (44.88). CS at 25 mg/L also showed synergistic interactions with Amistar at 0.25, 2.5, and 25 mg/L but exhibited antagonistic effects at 0.025 mg/L and 250 mg/L (Figure 3B).

2.3. Genes Encoding ATP Binding Cassette (ABC) Proteins Identified in the F. graminearum Genome

A BLAST search was performed against the F. graminearum genome to identify previously unreported ABC proteins. The completeness of these proteins was verified and their target domains were confirmed using the NCBI Conserved Domain Database (NCBI CDD) (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi, accessed on 7 October 2024). This analysis identified a total of 63 ABC proteins (Table 1). The genes encoding these ABC proteins, designated FgABC1 to FgABC63, were named according to their chromosomal locations (Figure 4A). For example, the gene FG05_00541, located at the start of chromosome 1, was named FgABC1, where “1” indicates the first ABC protein-encoding gene, “Fg” denotes F. graminearum, and “ABC” refers to the conserved domain characteristic of the ABC transporter subfamily. This naming convention was consistently applied to the remaining 62 ABC proteins. ABC protein-encoding genes were identified on all four chromosomes of the F. graminearum genome. Chromosome 2 contained the highest number of these genes (20 FgABC genes), followed by chromosome 3 (16 FgABC genes) and chromosome 4 (14 FgABC genes). Chromosome 1 harbored the fewest ABC protein-encoding genes, with 12 FgABC genes (Figure 4A).

2.4. Phylogenetic Analysis of ABC Transporter Proteins

Previous studies have identified four genes encoding ABC proteins, including FPSE_06011 (ZEB2-regulated ABC transporter 1), ZAR1 [17], and FPSE_11895 (ABC multidrug transporter, MDR1) [17], as playing roles in fungicide response. The newly identified ABC proteins were classified into eight groups based on their structural features (intron-exon distribution) and physicochemical properties (protein size and amino acid number) (Figure 4B). For example, genes encoding ABC proteins with a high number of introns and exons were classified into groups III, IV, and VIII, with no significant variation in the number of amino acids observed among these groups. On the contrary, smaller ABC proteins, characterized by fewer introns and exons and shorter amino acid sequences, were grouped into groups VI and VII. Group I showed an unusual distribution due to significant variation in gene structure and size. Groups II and V, though containing proteins with a relatively larger amino acid count, had fewer introns and exons within each group, suggesting a distinct gene structure compared to the other categories.
Group III includes the previously reported FPSE_06011/FG05_04580 (ZEB2-regulated ABC transporter1, ZAR1) and its homolog, FG05_08312, identified in the F. graminearum isolate under investigation. DNASTAR and phylogenetic analysis revealed that FG05_08312 is closely related to FPSE_06011/FG05_04580, leading to the selection of FG05_08312 as the primary ABC transporter gene for further studies (Supplementary Figure S1). Group VIII includes the previously reported FPSE_11895/FG05_06771 (ABC multidrug transporter, MDR1) and FG05_11988 from the F. graminearum isolate that is being studied in our lab. Based on sequence similarity, FPSE_11895 (ABC multidrug transporter, MDR1) and FG05_06771 are considered the same gene in different strains. Therefore, we selected FG05_11988, the closest homolog to FPSE_11895 (ABC multidrug transporter, MDR1), for further studies (Supplementary Figure S2). The genes FG05_08312 and FG05_11988 were selected as targets for dsRNA studies as potential genes associated with tolerance to fungicides.

2.5. Treatment with Amistar and CS Modifies the Expression of Selected Genes

To analyze changes in the expression of potential target genes (FG05_08312 and FG05_11988) related to F. graminearum’s response to Amistar (azoxystrobin), relative gene expression was assessed across different treatments. For the FG05_08312 gene, the baseline expression in the PDB control treatment was approximately 0.88. Treatment with CS maintained a gene expression relative to that of the PDB control, while treatment with Amistar (AMI) resulted in a significant increase in expression to 3.12, the highest level observed for this gene across all treatments. Notably, co-treatment with CS and AMI (CSAMI) led to a significant downregulation in expression to 1.55 compared to AMI treatment alone (Figure 5). The expression pattern of the FG05_11988 gene was similar. The baseline expression level in PDB treatment was 1.12. Treatment with CS slightly but not significantly increased expression to 1.66. Treatment with AMI significantly upregulated the gene to 8.39. Consistent with the trend observed for FG05_08312, co-treatment with CSAMI resulted in an upregulation of FG05_11988 to 7.02, which, while still higher than in the PDB and CS treatments, was significantly lower than the expression level seen with AMI treatment alone (Figure 5).

2.6. Fusarium Transcriptome Response to Co-Treatment with CS and AMI

The transcriptome of F. graminearum was analyzed under two conditions: a culture treated with AMI alone and a culture co-treated with AMI and CS. The culture served as a reference for observing the transcriptomic changes. Initial transcriptomic changes were examined using hierarchical clustering, based on Pearson’s average distance between the top 2000 genes (Figure 6A). Results of principal component analysis (PCA) indicated that the first principal component (PC1) accounted for 68.3% of the variance, effectively distinguishing samples according to their type of treatment (Figure 6B). Genes with a false discovery rate (FDR) < 0.05 and a log2 fold change > 2 were considered differentially expressed genes (DEG). Co-treatment with CS and AMI resulted in the downregulation of 1393 genes and the upregulation of 751 genes compared to treatment with AMI alone (Figure 6C).
Differentially expressed genes (DEGs) were further analyzed using gene set enrichment analysis (GSEA) to identify enriched pathways across the tested samples with an FDR cutoff value of <0.05. Pathways were ranked by normalized enrichment score (NES), where positive scores indicate upregulation and negative scores indicate downregulation.
The top six pathways with the highest positive NES values were as follows: “Myosin complex”, “Monocarboxylic acid catabolic process”, “Oxo-acid-lyase activity”, “Regulation of GTPase activity”, “Thiolester hydrolase activity”, and “Protein targeting to peroxisome”. These pathways indicate increased activity in cytoskeletal function and specific metabolic processes related to acid catabolism (Figure 7A). The top six pathways with the most negative NES values were as follows: “Primary amine oxidase activity”, “Transition metal ion transmembrane transporter activity”, “3-oxoacyl-[acyl-carrier-protein] synthase activity”, “Fatty acid synthase activity”, “Fatty acid biosynthetic process”, and “ABC-type transporter activity”, indicating a decrease in the activity of processes such as amine oxidation, ion transport, and fatty acid biosynthesis (Figure 7A).
Focusing exclusively on Molecular Function (MF) GO terms with FDR < 0.05, the top 10 positively and top 10 negatively scored NES pathways were selected. The “Thiolester hydrolase activity” showed the highest positive NES, followed by pathways associated with cytoskeletal organization, motor function, and nucleotide transmembrane transporter activity. In the pathways with the most negative NES values, “Primary amine oxidase activity” exhibited the strongest downregulation, followed by “Transition metal ion transmembrane transporter activity”, “3-oxoacyl-[acyl-carrier-protein] synthase activity”, and “ABC-type transporter activity”, indicating that these pathways were the most downregulated across all GO terms. Additionally, pathways such as “ATPase-coupled transmembrane transporter activity”, “Primary active transmembrane transporter activity”, ”Oxidoreductase activity”, and “Monooxygenase activity” also exhibited negative scores, suggesting a general downregulation in genes associated with oxidative processes and transmembrane transport.
Considering ABC (ATP-binding cassette) protein-coding genes, we conducted further analysis on the pathway “ABC-type transporter activity” due to its significant downregulation and potential link to the synergistic interaction between CS and AMI. Of the 39 genes annotated to this pathway, 20 exhibited significant changes in expression (FDR < 0.05) following co-treatment with CS and AMI (CSAMI) compared to treatment with AMI. Among these, 3 genes were upregulated, while 17 genes were downregulated. Upregulated genes associated with this pathway were FG05_06565, FG05_08373, and FG05_09611 (Figure 8).

2.7. dsRNA-Based Silencing of F. graminearum ABC Transporter-Encoding Genes

dsRNA-based silencing of F. graminearum ABC transporter-encoding genes results in significant gene silencing and strong retardation of F. graminearum growth. The use of dsRNA for RNA interference (RNAi)-based gene silencing is a powerful tool for functional genomics. In this study, we used this approach to silence F. graminearum genes that were strongly upregulated in response to AMI treatment. The ABC transporter-encoding genes FG05_08312 (group III) and FG05_11988 (group VIII) were selected for analysis, as they represent key genes in these groups. The most effective dsRNA for silencing each targeted gene was designed using the siRNA-Finder (si-Fi; version v1.2.3-0008) software [20]. The dsRNA designed for silencing FG05_08312 (group III) was a 393 bp fragment, spanning the 686 bp to 1079 bp region of the transcript (Supplementary Figure S2). The dsRNA for silencing FG05_11988 (group VIII) was a 413 bp fragment, spanning the 497 bp to 910 bp region of the transcript. Analysis indicated that these fragments would likely produce the most efficient siRNA molecules (Supplementary Figure S2).
The designed and synthesized dsRNA was tested for gene silencing efficiency. For the dsRNA targeting the FG05_08312 gene (dsRNA FG05_08312), exogenous silencing resulted in a 29% reduction in relative expression compared to the nontreated variant. Similarly, dsRNA targeting FG05_11988 (dsRNA FG05_11988) led to a 71% decrease in relative expression of FG05_11988 (Figure 9).

2.8. Fungal Growth After Exogenous Gene Silencing, AMI, and CS

To investigate the interaction between the specified dsRNA and CS, AMI, and their combination (CSAMI), we used four variants of dsRNA treatment: no dsRNA (control), dsRNA targeting GFP (green fluorescent protein gene, acting as a control, i.e., targeting a gene not existing in F. graminearum), and dsRNA targeting two previously identified genes (FG05_08312 and FG05_11988). In the absence of dsRNA, the PDB treatment exhibited the highest OD450 value (1.00), serving as a relative baseline. CS treatment caused a moderate reduction in OD450 (0.87), while AMI led to a greater reduction (0.62). The combination treatment, CSAMI, showed the lowest value of OD450 (0.50), indicating the strongest effect in reducing fungal growth. All comparisons between treatment groups were statistically significant compared to the PDB control. When GFP-targeting dsRNA was introduced (serving as a control), the PDB group maintained a high OD450 value (1.06), similar to the condition without dsRNA. CS treatment caused a slight reduction (0.92), while AMI and CSAMI further reduced OD450 to 0.67 and 0.52, respectively. The statistical significance followed the same trends as in the no-dsRNA condition, with CSAMI being the most effective treatment.
When dsRNA targeting FG05_08312 was applied, OD450 values decreased across all treatments compared to the GFP control. The PDB group showed a moderate reduction to 0.77, while CS and AMI resulted in further decreases to 0.66 and 0.42, respectively. Combination treatment, CSAMI, achieved the lowest OD450 value at 0.44. Similarly, with dsRNA targeting FG05_11988, the OD450 values showed trends comparable to those observed for FG05_08312. The PDB group showed a reduction to 0.71, and CS remained at 0.74, with no significant differences (ns) between the two. In contrast, AMI reduced OD450 further to 0.55, while CSAMI again produced the lowest OD450 value at 0.40 (Figure 10).

3. Discussion

Fungicides vary in their effectiveness against F. graminearum, largely due to differences in their mechanisms of action and target specificity. For example, fungicides that inhibit ergosterol biosynthesis, such as Fungimat (tebuconazole) and Micosar (metconazole), disrupt the integrity of the fungal cell membrane. In contrast, azoxystrobin, present in AMI, targets mitochondrial electron transport, thereby impairing ATP production and leading to fungal cell death [21]. Experimental data on F. graminearum growth in PDB medium supplemented with these fungicides confirm their high efficacy. In contrast, copper oxychloride, an active component of Miedzian, functions as a multisite fungicide. It targets sulfhydryl (-SH) groups, causing enzyme inactivation and disrupting cell membranes. However, its antifungal effectiveness is generally lower compared to AMI, Micosar, and Fungimat. Data from F. graminearum growth assays show significant fungicidal activity only at the 10−1 and 10−2 dilutions, while lower concentrations were neutral or even stimulatory.
Combining fungicides with CS can result in various types of interaction, depending on the concentrations and specific fungicide used. When Miedzian (copper oxychloride) was applied at 33.5 mg/L in combination with 50 mg/L CS, the resulting synergy score was relatively weak, 0.91, indicating minimal improvement in antifungal activity. In contrast, other concentration combinations exhibited an additive effect, where the antifungal activity of both components combined without significant interaction. Previous studies have reported synergistic effects between copper-based fungicides and CS. For example, Lemke et al., 2022 demonstrated that the combination of copper fungicides with CS allowed for a 50% reduction in the required dose of the fungicide while maintaining effective plant protection [22]. This synergy suggests that CS may enhance the efficacy of copper-based fungicides, reducing the need for higher fungicide concentrations while still achieving desired levels of disease control.
The application of Micosar (metconazole) with CS resulted in two types of interactions: a weak synergistic effect (synergy score of 0.49) and an antagonistic effect at 0.006 mg/L Micosar and 50 mg/L CS. In contrast, the combination of Fungimat (tebuconazole) with CS primarily showed an additive effect, with a modest synergy score of 8.19 at 0.6 mg/L of Fungimat and 50 mg/L CS. When AMI (azoxystrobin) was applied with CS, the synergy was particularly strong, with a synergy score of 25.36 at concentrations ranging from 0.25 to 2.5 mg/L AMI and 50 mg/L CS. It was the highest score observed among all tested fungicides. Further testing with a broader range of concentrations revealed regions of strong synergy (synergy scores from 29.39 to 44.88), along with some antagonistic (−3.91 to −6.3 scores) and additive interactions. These findings align with the results of [23], who reported a high synergistic activity between CS and azoxystrobin. In their study, Amistar (azoxystrobin) and Signum (boscalid and pyraclostrobin) demonstrated the most significant increases in antifungal activity when combined with CS oligomers. In contrast, Teldor (fenhexamid) and Switch (cyprodinil and fludioxonil) showed a weaker response. When CS oligomers were used separately, they inhibited Botrytis cinerea germination by 4.8% at a concentration of 10 mg/L. However, in combination with Amistar (10 mg/L), the inhibition increased dramatically from 1.6% to 96.4%, and with Signum (2 mg/L), it increased from 1.7% to 89.0% [23]. The synergistic interaction between strobilurin-based fungicides, such as azoxystrobin or pyraclostrobin, and CS is not yet fully understood. Additionally, the precise antifungal mechanism of CS remains unclear, primarily due to the wide range of CS samples with varying properties, which results in diverse antifungal effects on different target organisms (review by [2]). Although the exact mode of action of CS is still under investigation, several hypotheses have been proposed. One of the most widely supported mechanisms is that the positively charged amine groups on CS interact with the negatively charged fungal cell membranes, leading to membrane destabilization [2].
In general, synergy between two compounds arises when their mechanisms of action are distinct and nonoverlapping. This may partially explain why synergy is observed with demethylation inhibitor (DMI) fungicides, although the interaction is not as pronounced as with strobilurin-based fungicides such as azoxystrobin and CS. Fungicides such as Fungimat (tebuconazole) and Micosar (metconazole) destabilize fungal cell membranes, a mechanism that overlaps with CS’s action, which could account for the weaker synergy observed. In contrast, strobilurin fungicides such as azoxystrobin disrupt cellular respiration, a mechanism that is not shared by CS. This distinct mode of action may explain the more pronounced increase in antifungal activity when azoxystrobin-based fungicides are combined with CS.
ABC transporter proteins play essential roles in various physiological functions, including cellular detoxification, signal transduction, and lipid regulation [14]. Emerging evidence highlights the significant roles of ABC transporters in Fusarium life cycle [24,25], pathogenesis [12,24,26,27] and responses to fungicides [17,18,24]. To further explore these roles, we identified the complete family of ABC-encoding genes in the F. graminearum genome and assigned names based on their chromosomal locations. Our analysis revealed a total of 64 genes distributed on the four F. graminearum chromosomes. Phylogenetic analysis grouped these genes into eight distinct clades. To the best of our knowledge, this study provides the first comprehensive characterization of the entire ABC transporter-encoding gene family in F. graminearum reported in the literature. The two ABC transporter-encoding genes, FG05_08312 and FG05_11988, were selected as targets for exogenous dsRNA-based silencing experiments due to their roles in fungicide resistance. Exogenous application of dsRNA to F. graminearum cultures effectively silenced the expression of these target genes (Figure 9) and inhibited fungal growth. When gene silencing was combined with simultaneous treatment with AMI and CS, a significantly stronger growth inhibition of F. graminearum was observed compared to treatment with CS or AMI alone. This finding suggests that the ABC transporters encoded by FG05_08312 and FG05_11988 genes, which are implicated in F. graminearum responses to CS and AMI, may also contribute to an as-yet unknown mechanism of F. graminearum resistance to azoxystrobin. Although the efficiency of gene silencing by specific dsRNAs must be considered, these results highlight the synergistic effect of dsRNA treatment and application of CSAMI (combined CS and AMI). Notably, gene-specific dsRNAs targeting FG05_08312 and FG05_11988 enhanced the fungicidal efficacy of the CSAMI treatment, underscoring their potential for improving fungal control strategies.

4. Materials and Methods

4.1. Materials

This study utilized various synthetic fungicides with different active ingredients. Miedzian Extra 350 SC, with copper oxychloride (CAS: 1332-65-6, active ingredient concentration: 350 g/L) as the active ingredient, was supplied by Synthos Agro (Oświęcim, Poland). Amistar 250 SC, containing azoxystrobin (CAS: 131860-33-8, active ingredient concentration: 250 g/L), was obtained from Syngenta Polska (Warsaw, Poland). Micosar 60 SL, with metconazole (CAS: 125116-23-6, active ingredient concentration: 60 g/L), was provided by Ciech Sarzyn S.A. (Nowa Sarzyna, Poland). Fungimat, which has tebuconazole (CAS: 107534-96-3, active ingredient concentration: 25 g/L) as its active ingredient, was supplied by SMB Life Science (Warsaw, Poland). CS, derived from shrimp with a viscosity of 10 cps, a molecular weight of 30 kDa, and a degree of deacetylation ≥ 90%, was supplied by Pol-Aura (Warsaw, Poland). PDB was supplied by ROTH (Karlsruhe, Germany). For dsRNA synthesis, the MEGAscript RNAi Kit was provided by Thermo Fisher Scientific (Waltham, MA, USA).

4.2. Methods

4.2.1. CS Solution Preparation

A stock solution of CS was prepared by dissolving 1.5 g of specified CS in 500 mL of Milli-Q water with 1% acetic acid (pH 3.0) and stirring the mixture overnight at room temperature. The stock solution was diluted to the desired final concentration with Milli-Q water, and the pH was adjusted to 5.6 using NaOH. The solution was then filtered through a 0.22 μm filter.

4.2.2. Production of F. graminearum Macroconidia

Macroconidia of the F. graminearum BW5 isolate were produced as described by [1]. Briefly, 3–4 cm2 of fresh F. graminearum mycelium obtained on PDA medium was used to inoculate 150 mL of an adapted V8 liquid medium containing 170 mL/L of potato and vegetable juice (Fortuna®, Pultusk, Poland) and 1.5 g/L calcium carbonate. The culture grew in 500 mL Erlenmeyer flasks on a shaker at 120 rpm at 25 °C under UV light for two weeks. The fungal suspension was filtered through Miracloth, and macroconidia were verified under a light microscope (Nikon®, Tokyo, Japan) and counted using a Fuchs–Rosenthal counting chamber. The macroconidia were suspended in ddH2O and stored at −80 °C.

4.2.3. Microtiter Plate Fungal Growth Assay

To evaluate the impact of antifungal agents (fungicides, CS, dsRNA) on fungal growth, a 96-well microtiter plate assay was performed. Each well containing PDB and the tested antifungal agent was inoculated with 10 µL of F. graminearum isolate BW5 macroconidia suspension (1 × 105 spores/mL). Plates were incubated in the dark at 25 °C for 5 days, and the optical density at 450 nm (OD450) of the culture was measured using a Tecan Infinite 200 Pro (Tecan, Männedorf, Switzerland). Wells containing all components except the F. graminearum inoculum served as background controls. The OD450 values were calculated using Equation (1):
OD450 = Measured OD450 − Control OD450
The minimum inhibitory concentration (MIC) of fungicides and CS was calculated to evaluate their respective antifungal efficacy. The MIC was defined as the lowest concentration that completely inhibited the growth of the F. graminearum BW5 isolate, as shown in Supplementary Table S2.
To compare the antifungal activity of across all treatments, OD450 values of the specified antifungal agents are presented as “relative growth” values, with the OD450 of the untreated F. graminearum culture serving as the reference point.

4.2.4. RNA Extraction from Fungal Liquid Culture

The F. graminearum culture was incubated for 5 days in 5 mL of PDB medium supplemented with specified antifungal agents, with the same conditions as in the microtiter plates growth assay. The mycelium was rinsed with ddH2O, and total RNA was extracted from 100 mg of N2-frozen, homogenized mycelium using the Direct-zol RNA Miniprep Kit (Zymo-R2072, Irvine, CA, USA) according to the manufacturer’s protocol. RNA quantity was measured using a Nanodrop spectrophotometer (Nanodrop Technologies®, Wilmington, DE, USA). To confirm that the RNA was free of genomic DNA contamination, a 36-cycle PCR reaction was performed using 50 ng of DNase-treated RNA and primers targeting the Fusarium Elongation factor1 gene (Supplementary Table S1). The absence of a PCR product after gel electrophoresis indicated that the RNA was free of gDNA. RNA quality was assessed using 1% agarose gel electrophoresis and verified with a Bioanalyzer 2100 (Agilent Technologies®, Santa Clara, CA, USA). The same method was used for both RT-qPCR and RNA-seq; a minimum of 2 µg of total RNA (RIN ≥ 6.5, 28S/18S ≥ 1.0, not contaminated with DNA, protein, or salt ions) was sent to the company to prepare an Illumina standard RNA library with polyA selection. The company HaploX Biotechnology Co., Ltd. (HaploX Biotechnology Co., Ltd., Hong Kong, China) performed Illumina NovaSeq 6000 sequencing with an estimated data output of ~25 M pair-end reads with a quality score of at least Q30. The raw FASTQ data obtained from sequencing was then further analyzed.

4.2.5. RNA-Seq Results Quality Control and Analysis

The raw FASTQ data were quality-checked using FastQC version 0.12.1 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc, accessed on 9 October 2024) with standard command-line parameters. Low-quality reads and adapter sequences were removed using Trimmomatic version 0.30 (http://www.usadellab.org/cms/?page=trimmomatic, accessed on 9 October 2024) [28]. Processed reads were aligned to the genome annotation file (GFF3) of the F. graminearum genome assembly (GCA_000240135.3), obtained from EnsemblFungi (https://fungi.ensembl.org/index.html, accessed on 9 October 2024), using HISAT2 version 2.2.1 with default settings [29]. The obtained output alignment file (.bam) was used as input for featureCounts to quantify transcript reads and further analyzed for differential expression using DESeq2 [30]. The cutoff values for differentially expressed genes (DEGs) were set at a false discovery rate (FDR; adjusted p-value) < 0.05 and a log2 fold change > 2 between the two experimental conditions. The iDEP 2.01 server (https://bioinformatics.sdstate.edu/idep/, accessed on 10 October 2024) [31] was used for principal component analysis (PCA), hierarchical cluster heatmap generation, and gene set enrichment analysis (GSEA) of differentially expressed genes [31]. The RT-qPCR was used to verify the reliability of the RNA-seq results (Supplementary Figure S4).

4.2.6. Identification of the ABC Transporter in F. graminearum Strain CS3005 Genome

To identify the ABC transporter genes, we conducted a BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 7 October 2024) [32] search of the protein sequence of the previously reported ABC transporter against the F. graminearum strain CS3005 genome database (https://fungi.ensembl.org/index.html; accessed on 9 October 2024) [33]. The identified proteins were analyzed using various web tools, including NCBI Conserved Domain Search (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi accessed on 7 October 2024), InterProScan (http://www.ebi.ac.uk/interpro/ accessed on 9 October 2024) [34], and SMART (http://smart.embl-heidelberg.de/ accessed on 10 October 2024) [35], to determine family-specific domains and motifs.

4.2.7. Chromosomal Location and Multiple Sequence Alignment of ABC Transporter

Data concerning the chromosomal location were acquired from the F. graminearum strain CS3005 genome database (https://fungi.ensembl.org/index.html; accessed on 9 October 2024). The physical position of each ABC transporter on its respective chromosome was drawn by MapDraw [36]. The nomenclature of the identified ABC transporter was conducted in accordance with its chromosomal order. The multiple sequence alignment of the ABC transporter was conducted using DNASTAR (DNASTAR, Inc., Madison, WI, USA). The protein sequences utilized for the multiple sequence alignment were sourced from the F. graminearum strain CS3005 genome database (https://fungi.ensembl.org/index.html; accessed on 9 October 2024).

4.2.8. Phylogenetic Analysis of the ABC Transporter

Phylogenetic analysis was conducted utilizing the MEGA 7.0.26 software tool [37]. The ABC proteins were initially aligned using the ClustalW v2.0 online program (http://www.ebi.ac.uk/Tools/webservices/services/msa/clustalw2_soap; accessed on 10 October 2024) [38]. The neighbor-joining approach was employed for tree construction. The bootstrap method with 1000 repeats was employed to assess the reliability of the built tree.

4.2.9. Quantitative Reverse Transcriptase PCR (qRT-PCR) of Selected F. graminearum Genes

Total RNA extracted from fungal cultures was used for cDNA synthesis with oligo-dT primers and the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific®, Waltham, MA, USA), following the manufacturer’s instructions. The qPCR reaction mix consisted of 2 μL of 5× HOT FIREPol EvaGreen qPCR Mix Plus (ROX) (Solis Biodyne®, Tartu, Estonia), 0.3 μL of forward primer (10 μM), 0.3 μL of reverse primer (10 μM), 15 ng of template cDNA, and water to a final volume of 10 μL. Relative gene expression was calculated using the 2−∆∆Ct method as described by [39]. All primers used for qPCR are listed in Supplementary Table S1. The results presented reflect the average relative expression values from at least three biological replicates and four technical repeats for each sample.

4.2.10. In Silico Analysis and Synthesis of dsRNA

The SiFi 2.1 software (siFi21_1.2.3-0008, https://sourceforge.net/projects/sifi21/, accessed on 30 September 2024) Ref. [20] was used to select a region of the F. graminearum target gene transcript for dsRNA synthesis and to predict potential off-target sites. The F. graminearum genome assembly (https://www.ebi.ac.uk/ena/browser/view/GCA_901446245.1, accessed on 30 September 2024) was used for this analysis. The selected dsRNA region (Supplementary Figure S3) was synthesized using the MEGAscript Kit (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions. The template for dsRNA synthesis was obtained by PCR using forward and reverse primers with T7 promoter sequences (TAATACGACTCACTATAGGG) at their 5′ ends (listed in Supplementary Table S1). The PCR template was cDNA derived from RNA extracted from liquid fungal cultures as earlier described.

4.2.11. Synergy Score Calculation

The OD450 values, indicating fungal growth in the presence of various fungicide and CS combinations, were analyzed and visualized using SynergyFinder 3.0 software [19] (https://synergyfinder.fimm.fi/synergy/20240912095621795773/) accessed on 12 August 2024. The Zero Interaction Potency (ZIP) model was applied to calculate the synergy score between CS and the fungicides.

4.2.12. Statistical Analysis

The data in the graphs represent mean values ± standard errors. Each treatment was performed with at least three biological replicates. Analysis of variance (ANOVA) and least significant difference (LSD) post hoc tests were conducted and visualized using GraphPad Prism version 8.0.2 software (GraphPad Software, Boston, MA, USA). Results were considered statistically significant at p < 0.05.

5. Conclusions

Among the four tested fungicides, AMI, which contains the active ingredient azoxystrobin, demonstrated the highest synergy when combined with CS (30 kDa, degree of deacetylation < 90). This cotreatment resulted in the most significant increase in antifungal efficiency.
The combined application of dsRNA targeting ABC transporter genes and CSAMI (CS + AMI) further enhanced antifungal activity. This highlights a dual synergy: between CS and AMI and the role of dsRNA in silencing genes involved in the tolerance of F. graminearum to CSAMI treatment.
Our findings emphasize that exogenously induced RNAi via dsRNA is not only an effective antifungal strategy but also a powerful tool to investigate the roles of specific genes in fungal physiology, including tolerance to fungicides and CS, as demonstrated in this study.
This study also sheds light on the remarkable synergy between azoxystrobin and CS, a mechanism that remains to be fully understood but holds significant promise as a high-efficiency, ecofriendly approach for protecting plants against F. graminearum and potentially other fungal pathogens.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms26010262/s1. References [40,41] are cited in the Supplementary Materials.

Author Contributions

Conceptualization, W.O. and P.P. (Pawel Poznanski); methodology: W.O., P.P. (Pawel Poznanski), and P.P. (Pascal Poznanski); validation: W.O., P.P. (Pawel Poznanski), P.P. (Pascal Poznanski), and A.S.; formal analysis: P.P. (Pawel Poznanski) and A.S.; investigation: P.P. (Pawel Poznanski) and P.P. (Pascal Poznanski); data curation: P.P. (Pawel Poznanski) and A.S.; resources: P.P. (Pawel Poznanski) and A.S.; writing—original draft preparation: W.O. and P.P. (Pawel Poznanski), writing—review and editing: W.O.; visualization: P.P. (Pawel Poznanski); supervision: W.O.; project administration: W.O. and P.P. (Pawel Poznanski); funding acquisition: W.O. and P.P. (Pawel Poznanski). All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Science Centre, Poland, grant no 2019/35/B/NZ9/00323 (W.O.) and by the Plant Breeding and Acclimatization Institute—National Research Institute, project “Pierwszy Projekt Naukowy” (Pawel P.).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw RNA-seq data analyzed in this study are openly available in NCBI at https://www.ncbi.nlm.nih.gov/sra/PRJNA1199923; accessed on 19 December 2024.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Poznanski, P.; Hameed, A.; Dmochowska-Boguta, M.; Bryla, M.; Orczyk, W. Low Molecular Weight and High Deacetylation Degree Chitosan Batch Alleviates Pathogenesis, Toxin Accumulation, and Fusarium Gene Regulation in Barley Leaf Pathosystem. Int. J. Mol. Sci. 2023, 24, 12894. [Google Scholar] [CrossRef] [PubMed]
  2. Poznanski, P.; Hameed, A.; Orczyk, W. Chitosan and chitosan nanoparticles: Parameters enhancing antifungal activity. Molecules 2023, 28, 2996. [Google Scholar] [CrossRef] [PubMed]
  3. Poznanski, P.; Shalmani, A.; Bryla, M.; Orczyk, W. Salicylic Acid Mediates Chitosan-Induced Immune Responses and Growth Enhancement in Barley. Int. J. Mol. Sci. 2024, 25, 13244. [Google Scholar] [CrossRef]
  4. Kean, T.; Thanou, M. Biodegradation, biodistribution and toxicity of chitosan. Adv. Drug Deliv. Rev. 2010, 62, 3–11. [Google Scholar] [CrossRef]
  5. Brent, K.J.; Hollomon, D.W. Fungicide Resistance in Crop Pathogens: How Can It Be Managed? 3rd ed.; GIFAP: Brussels, Belgium, 1995; pp. 48–56. [Google Scholar]
  6. Hughes, M.N.; Poole, R.K. Metal speciation and microbial growth—The hard (and soft) facts. Microbiology 1991, 137, 725–734. [Google Scholar] [CrossRef]
  7. Gharieb, M.I.; Ali, M.I.; El-Shoura, A.A. Transformation of copper oxychloride fungicide into copper oxalate by tolerant fungi and the effect of nitrogen source on tolerance. Biodegradation 2004, 15, 49–57. [Google Scholar] [CrossRef]
  8. Yin, Y.; Miao, J.; Shao, W.; Liu, X.; Zhao, Y.; Ma, Z. Fungicide resistance: Progress in understanding mechanism, monitoring, and management. Phytopathology 2023, 113, 707–718. [Google Scholar] [CrossRef]
  9. Wang, H.; Wang, J.; Chen, Q.; Wang, M.; Hsiang, T.; Shang, S.; Yu, Z. Metabolic effects of azoxystrobin and kresoxim-methyl against Fusarium kyushuense examined using the Biolog FF MicroPlate. Pestic. Biochem. Physiol. 2016, 130, 52–58. [Google Scholar] [CrossRef]
  10. Paul, P.; Salgado, J.; Bergstrom, G.; Bradley, C.; Byamukama, E.; Byrne, A.; Chapara, V.; Cummings, J.; Chilvers, M.; Dill-Macky, R. Integrated effects of genetic resistance and prothioconazole+ tebuconazole application timing on Fusarium head blight in wheat. Plant Dis. 2019, 103, 223–237. [Google Scholar] [CrossRef]
  11. Pirgozliev, S.; Edwards, S.; Hare, M.; Jenkinson, P. Effect of dose rate of azoxystrobin and metconazole on the development of Fusarium head blight and the accumulation of deoxynivalenol (DON) in wheat grain. Eur. J. Plant Pathol. 2002, 108, 469–478. [Google Scholar] [CrossRef]
  12. Gardiner, D.M.; Stephens, A.E.; Munn, A.L.; Manners, J.M. An ABC pleiotropic drug resistance transporter of Fusarium graminearum with a role in crown and root diseases of wheat. FEMS Microbiol. Lett. 2013, 348, 36–45. [Google Scholar] [CrossRef] [PubMed]
  13. Ziogas, B.N.; Malandrakis, A.A. Sterol biosynthesis inhibitors: C14 demethylation (DMIs). In Fungicide Resistance in Plant Pathogens; Springer: Tokyo, Japan, 2015; pp. 199–216. [Google Scholar]
  14. Liu, X. ABC family transporters. Drug Transp. Drug Dispos. Eff. Toxic. 2019, 1141, 13–100. [Google Scholar]
  15. Omrane, S.; Sghyer, H.; Audéon, C.; Lanen, C.; Duplaix, C.; Walker, A.S.; Fillinger, S. Fungicide efflux and the MgMFS 1 transporter contribute to the multidrug resistance phenotype in Z ymoseptoria tritici field isolates. Environ. Microbiol. 2015, 17, 2805–2823. [Google Scholar] [CrossRef] [PubMed]
  16. Sang, H.; Hulvey, J.; Popko Jr, J.T.; Lopes, J.; Swaminathan, A.; Chang, T.; Jung, G. A pleiotropic drug resistance transporter is involved in reduced sensitivity to multiple fungicide classes in S clerotinia homoeocarpa (FT B ennett). Mol. Plant Pathol. 2015, 16, 251–261. [Google Scholar] [CrossRef] [PubMed]
  17. Zhang, Y.; He, K.; Guo, X.; Jiang, J.; Qian, L.; Xu, J.; Che, Z.; Huang, X.; Liu, S. Transcriptomic profiling of Fusarium pseudograminearum in response to carbendazim, pyraclostrobin, tebuconazole, and phenamacril. J. Fungi 2023, 9, 334. [Google Scholar] [CrossRef]
  18. Abou Ammar, G.; Tryono, R.; Döll, K.; Karlovsky, P.; Deising, H.B.; Wirsel, S.G. Identification of ABC transporter genes of Fusarium graminearum with roles in azole tolerance and/or virulence. PLoS ONE 2013, 8, e79042. [Google Scholar] [CrossRef]
  19. Ianevski, A.; Giri, A.K.; Aittokallio, T. SynergyFinder 3.0: An interactive analysis and consensus interpretation of multi-drug synergies across multiple samples. Nucleic Acids Res. 2022, 50, W739–W743. [Google Scholar] [CrossRef]
  20. Lück, S.; Kreszies, T.; Strickert, M.; Schweizer, P.; Kuhlmann, M.; Douchkov, D. siRNA-Finder (si-Fi) software for RNAi-target design and off-target prediction. Front. Plant Sci. 2019, 10, 1023. [Google Scholar] [CrossRef]
  21. Fishel, F.M.; Dewdney, M. Fungicide Resistance Action Committee’s (FRAC) Classification Scheme of Fungicides According to Mode of Action; Pesticide Information Office, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida: Gainesville, FL, USA, 2012. [Google Scholar]
  22. Lemke, P.; Jünemann, L.; Moerschbacher, B.M. Synergistic antimicrobial activities of chitosan mixtures and chitosan–copper combinations. Int. J. Mol. Sci. 2022, 23, 3345. [Google Scholar] [CrossRef]
  23. Rahman, M.H.; Shovan, L.R.; Hjeljord, L.G.; Aam, B.B.; Eijsink, V.G.; Sørlie, M.; Tronsmo, A. Inhibition of fungal plant pathogens by synergistic action of chito-oligosaccharides and commercially available fungicides. PLoS ONE 2014, 9, e93192. [Google Scholar] [CrossRef]
  24. Qi, P.-F.; Zhang, Y.-Z.; Liu, C.-H.; Zhu, J.; Chen, Q.; Guo, Z.-R.; Wang, Y.; Xu, B.-J.; Zheng, T.; Jiang, Y.-F. Fusarium graminearum ATP-binding cassette transporter gene FgABCC9 is required for its transportation of salicylic acid, fungicide resistance, mycelial growth and pathogenicity towards wheat. Int. J. Mol. Sci. 2018, 19, 2351. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, Z.; Ma, T.; Huang, Y.; Wang, J.; Chen, Y.; Kistler, H.C.; Ma, Z.; Yin, Y. A fungal ABC transporter FgAtm1 regulates iron homeostasis via the transcription factor cascade FgAreA-HapX. PLoS Pathog. 2019, 15, e1007791. [Google Scholar] [CrossRef] [PubMed]
  26. Skov, J.; Lemmens, M.; Giese, H. Role of a Fusarium culmorum ABC transporter (FcABC1) during infection of wheat and barley. Physiol. Mol. Plant Pathol. 2004, 64, 245–254. [Google Scholar] [CrossRef]
  27. O’Mara, S.P.; Broz, K.; Schwister, E.M.; Singh, L.; Dong, Y.; Elmore, J.M.; Kistler, H.C. The Fusarium graminearum transporters Abc1 and Abc6 are important for xenobiotic resistance, trichothecene accumulation, and virulence to wheat. Phytopathology 2023, 113, 1916–1923. [Google Scholar] [CrossRef]
  28. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
  29. Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef]
  30. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
  31. Ge, S.X.; Son, E.W.; Yao, R. iDEP: An integrated web application for differential expression and pathway analysis of RNA-Seq data. BMC Bioinform. 2018, 19, 534. [Google Scholar] [CrossRef]
  32. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  33. Harrison, P.W.; Amode, M.R.; Austine-Orimoloye, O.; Azov, A.G.; Barba, M.; Barnes, I.; Becker, A.; Bennett, R.; Berry, A.; Bhai, J. Ensembl 2024. Nucleic Acids Res. 2024, 52, D891–D899. [Google Scholar] [CrossRef]
  34. Paysan-Lafosse, T.; Blum, M.; Chuguransky, S.; Grego, T.; Pinto, B.L.; Salazar, G.A.; Bileschi, M.L.; Bork, P.; Bridge, A.; Colwell, L.; et al. InterPro in 2022. Nucleic Acids Res. 2023, 51, D418–D427. [Google Scholar] [CrossRef] [PubMed]
  35. Letunic, I.; Bork, P. 20 years of the SMART protein domain annotation resource. Nucleic Acids Res. 2018, 46, D493–D496. [Google Scholar] [CrossRef] [PubMed]
  36. Liu, R.-H.; Meng, J. MapDraw: A microsoft excel macro for drawing genetic linkage maps based on given genetic linkage data. Yi Chuan = Hered. 2003, 25, 317–321. [Google Scholar]
  37. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
  38. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R. Clustal W and Clustal X version 2.0. bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef]
  39. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  40. Kim, S.; Park, J.; Kim, D.; Choi, S.; Moon, H.; Young Shin, J.; Kim, J.E.; Son, H. Development of a versatile copper-responsive gene expression system in the plant-pathogenic fungus Fusarium graminearum. Mol. Plant Pathol. 2021, 22, 1427–1435. [Google Scholar] [CrossRef]
  41. Harris, L.J.; Balcerzak, M.; Johnston, A.; Schneiderman, D.; Ouellet, T. Host-preferential Fusarium graminearum gene expression during infection of wheat, barley, and maize. Fungal. Biol. 2016, 120, 111–123. [Google Scholar] [CrossRef]
Figure 1. Relative growth of Fusarium graminearum in PDB medium supplemented with fungicides: Miedzian Extra 350 SC, Amistar 250 SC, Micosar 60 SL, and Fungimat. Fungal growth was measured as optical density at 450 nm (OD450) and expressed as relative values, with the OD450 of the control culture in PDB medium normalized to 1.0 (indicated by a red line). Fungicide concentrations are presented as serial dilutions of the original commercial formulations. Statistical significance is indicated as follows: ** p ≤ 0.01, *** p ≤ 0.001.
Figure 1. Relative growth of Fusarium graminearum in PDB medium supplemented with fungicides: Miedzian Extra 350 SC, Amistar 250 SC, Micosar 60 SL, and Fungimat. Fungal growth was measured as optical density at 450 nm (OD450) and expressed as relative values, with the OD450 of the control culture in PDB medium normalized to 1.0 (indicated by a red line). Fungicide concentrations are presented as serial dilutions of the original commercial formulations. Statistical significance is indicated as follows: ** p ≤ 0.01, *** p ≤ 0.001.
Ijms 26 00262 g001
Figure 2. Surface graphs that show synergy scores for chitosan (CS) combined with four fungicides: Miedzian Extra 350 SC, Amistar 250 SC, Micosar 60 SL, and Fungimat. The concentrations of active ingredients in each fungicide are indicated, with CS used at a fixed concentration of 50 mg/L. Synergy scores for each combination were calculated using the web-based SynergyFinder 3.0 application [19].
Figure 2. Surface graphs that show synergy scores for chitosan (CS) combined with four fungicides: Miedzian Extra 350 SC, Amistar 250 SC, Micosar 60 SL, and Fungimat. The concentrations of active ingredients in each fungicide are indicated, with CS used at a fixed concentration of 50 mg/L. Synergy scores for each combination were calculated using the web-based SynergyFinder 3.0 application [19].
Ijms 26 00262 g002
Figure 3. Surface graph showing the synergy scores for five concentrations of the active ingredient in Amistar 250 SC (0.025, 0.25, 2.5, 25, and 250 mg/L) combined with three concentrations of chitosan (CS; 25, 50, and 200 mg/L) to inhibit the growth of Fusarium graminearum in liquid PDB medium (A). The corresponding interaction matrix (B) is provided to illustrate the distribution of synergistic (red), antagonistic (green), and additive (white) interactions across the tested concentrations. The graph highlights the highest synergy scores and visually represents the dynamics of the interaction between CS and Amistar.
Figure 3. Surface graph showing the synergy scores for five concentrations of the active ingredient in Amistar 250 SC (0.025, 0.25, 2.5, 25, and 250 mg/L) combined with three concentrations of chitosan (CS; 25, 50, and 200 mg/L) to inhibit the growth of Fusarium graminearum in liquid PDB medium (A). The corresponding interaction matrix (B) is provided to illustrate the distribution of synergistic (red), antagonistic (green), and additive (white) interactions across the tested concentrations. The graph highlights the highest synergy scores and visually represents the dynamics of the interaction between CS and Amistar.
Ijms 26 00262 g003
Figure 4. Genes encoding ABC transporter proteins in the Fusarium graminearum genome. (A) Chromosomal locations of the ABC transporter genes. (B) Phylogenetic analysis of ABC transporter proteins in the Fusarium graminearum genome using the maximum likelihood method. To distinguish them, previously identified genes are marked in their respective colors (FG05_11988 in cyan and FG05_08312 in pink).
Figure 4. Genes encoding ABC transporter proteins in the Fusarium graminearum genome. (A) Chromosomal locations of the ABC transporter genes. (B) Phylogenetic analysis of ABC transporter proteins in the Fusarium graminearum genome using the maximum likelihood method. To distinguish them, previously identified genes are marked in their respective colors (FG05_11988 in cyan and FG05_08312 in pink).
Ijms 26 00262 g004
Figure 5. Relative expression of two Fusarium graminearum genes FG05_08312 and FG05_11988 in response to treatment with Amistar (AMI) and chitosan (CS) treatment 5 days post-inoculation (dpi). Significance markers are as follows: *** p ≤ 0.001, * p ≤ 0.05.
Figure 5. Relative expression of two Fusarium graminearum genes FG05_08312 and FG05_11988 in response to treatment with Amistar (AMI) and chitosan (CS) treatment 5 days post-inoculation (dpi). Significance markers are as follows: *** p ≤ 0.001, * p ≤ 0.05.
Ijms 26 00262 g005
Figure 6. Hierarchical clustering heatmap of Fusarium graminearum cultures treated with chitosan and Amistar (CSAMI) versus Amistar alone (AMI). Each column represents an individual biological replicate (A). Upregulated genes are indicated in green, while downregulated genes are shown in red. Principal component analysis (PCA) of three biological replicates per treatment (B). Number of differentially expressed genes (DEGs) in Fusarium graminearum treated with chitosan and Amistar relative to those treated with Amistar alone (C).
Figure 6. Hierarchical clustering heatmap of Fusarium graminearum cultures treated with chitosan and Amistar (CSAMI) versus Amistar alone (AMI). Each column represents an individual biological replicate (A). Upregulated genes are indicated in green, while downregulated genes are shown in red. Principal component analysis (PCA) of three biological replicates per treatment (B). Number of differentially expressed genes (DEGs) in Fusarium graminearum treated with chitosan and Amistar relative to those treated with Amistar alone (C).
Ijms 26 00262 g006
Figure 7. GSEA analysis of enriched Gene Ontology (GO) terms between CSAMI and AMI variants. (A) Enrichment of the top six upregulated and downregulated pathways across combined GO categories (Biological Process, Molecular Function, Cellular Component). (B) Top ten upregulated and downregulated GO terms within the Molecular Function category. Positive normalized enrichment score (NES) values indicate upregulation (marked in green color), while negative NES values indicate downregulation (marked in red color) of the specified pathways. Only pathways with an FDR < 0.05 were included in the analysis.
Figure 7. GSEA analysis of enriched Gene Ontology (GO) terms between CSAMI and AMI variants. (A) Enrichment of the top six upregulated and downregulated pathways across combined GO categories (Biological Process, Molecular Function, Cellular Component). (B) Top ten upregulated and downregulated GO terms within the Molecular Function category. Positive normalized enrichment score (NES) values indicate upregulation (marked in green color), while negative NES values indicate downregulation (marked in red color) of the specified pathways. Only pathways with an FDR < 0.05 were included in the analysis.
Ijms 26 00262 g007
Figure 8. Hierarchical cluster heatmap of genes related to the GO term “ABC-transporter activity” under CSAMI and AMI treatment. Upregulated genes are indicated in green, while downregulated genes are shown in red (A). A table listing genes with FDR < 0.05, along with their respective log2 fold change (Log2FC) in relation to AMI treatment. Previously identified genes are marked in their respective colors (FG05_11988 in cyan and FG05_08312 in pink). Log2FC values greater than 0 are marked in green, while values less than 0 are marked in red (B).
Figure 8. Hierarchical cluster heatmap of genes related to the GO term “ABC-transporter activity” under CSAMI and AMI treatment. Upregulated genes are indicated in green, while downregulated genes are shown in red (A). A table listing genes with FDR < 0.05, along with their respective log2 fold change (Log2FC) in relation to AMI treatment. Previously identified genes are marked in their respective colors (FG05_11988 in cyan and FG05_08312 in pink). Log2FC values greater than 0 are marked in green, while values less than 0 are marked in red (B).
Ijms 26 00262 g008
Figure 9. Relative expression of Fusarium graminearum genes FG05_08312 and FG05_11988 without dsRNA treatment (PDB) and with indicated dsRNA treatment (+dsRNA). Significance markers for p-value: *** p ≤ 0.001, ** p ≤ 0.01.
Figure 9. Relative expression of Fusarium graminearum genes FG05_08312 and FG05_11988 without dsRNA treatment (PDB) and with indicated dsRNA treatment (+dsRNA). Significance markers for p-value: *** p ≤ 0.001, ** p ≤ 0.01.
Ijms 26 00262 g009
Figure 10. Relative growth values of Fusarium graminearum culture in PDB medium (PDB), PDB medium with 25 mg/L chitosan (CS), PDB medium with a final concentration of 0.25 mg/L of Amistar (AMI), and PDB medium with final concentrations of chitosan (25 mg/L) and Amistar (0.25 mg/L) (CSAMI). Significance markers for p-values: *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, and ns indicates no significant change.
Figure 10. Relative growth values of Fusarium graminearum culture in PDB medium (PDB), PDB medium with 25 mg/L chitosan (CS), PDB medium with a final concentration of 0.25 mg/L of Amistar (AMI), and PDB medium with final concentrations of chitosan (25 mg/L) and Amistar (0.25 mg/L) (CSAMI). Significance markers for p-values: *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05, and ns indicates no significant change.
Ijms 26 00262 g010
Table 1. Members of the ABC transporter superfamily in the Fusarium graminearum genome.
Table 1. Members of the ABC transporter superfamily in the Fusarium graminearum genome.
NameIDLocationaa (Amino Acid)
FgABC1FG05_354081:171,493–172,261208
FgABC2FG05_005411:1,656,768–1,660,8791348
FgABC3FG05_006691:2,114,494–2,119,2921548
FgABC4FG05_013881:4,539,563–4,542,9641076
FgABC5FG05_015261:4,989,585–4,992,166810
FgABC6FG05_119881:5,537,327–5,541,4001280
FgABC7FG05_018851:6,165,681–6,168,080799
FgABC8FG05_020251:6,632,333–6,634,291618
FgABC9FG05_021391:6,947,278–6,951,7301328
FgABC10FG05_023161:7,443,673–7,449,0121463
FgABC11FG05_027491:8,784,793–8,788,9031139
FgABC12FG05_107061:11,252,694–11,257,4771434
FgABC13FG05_080272:203,679–206,515847
FgABC14FG05_083082:974,238–978,7991449
FgABC15FG05_304092:980,752–982,170473
FgABC16FG05_083092:982,272–985,2891005
FgABC17FG05_083122:996,616–1,001,4141517
FgABC18FG05_083732:1,182,832–1,187,6671611
FgABC19FG05_085322:1,734,076–1,737,4371103
FgABC20FG05_088232:2,794,134–2,798,0771263
FgABC21FG05_088302:2,815,927–2,820,2431405
FgABC22FG05_027862:3,305,345–3,309,7111282
FgABC23FG05_028472:3,499,042–3,503,9541470
FgABC24FG05_028702:3,549,227–3,554,1181614
FgABC25FG05_030322:3,977,395–3,979,815806
FgABC26FG05_033232:4,770,610–4,774,6761298
FgABC27FG05_037352:5,870,874–5,877,5781816
FgABC28FG05_038822:6,111,507–6,116,1981475
FgABC29FG05_041812:7,003,497–7,007,0511055
FgABC30FG05_043362:7,491,208–7,495,3651317
FgABC31FG05_044402:7,828,733–7,833,3471490
FgABC32FG05_045802:8,248,117–8,252,6911489
FgABC33FG05_050763:1,062,050–1,065,1211007
FgABC34FG05_127043:1,513,794–1,517,7881296
FgABC35FG05_055273:2,556,404–2,559,5801014
FgABC36FG05_055713:2,706,262–2,711,4061553
FgABC37FG05_055893:2,766,585–2,768,514625
FgABC38FG05_105473:3,785,383–3,789,0431145
FgABC39FG05_105773:3,892,165–3,896,4921404
FgABC40FG05_060123:4,391,572–4,393,859709
FgABC41FG05_061413:4,780,606–4,785,7581432
FgABC42FG05_109113:6,384,333–6,386,479698
FgABC43FG05_109353:6,456,775–6,460,8771351
FgABC44FG05_109953:6,640,167–6,645,3381610
FgABC45FG05_110283:6,733,481–6,737,6791382
FgABC46FG05_112403:7,323,544–7,328,0791457
FgABC47FG05_112723:7,423,264–7,427,8071461
FgABC48FG05_038053:7,697,730–7,700,403842
FgABC49FG05_065654:418,689–422,6121307
FgABC50FG05_067714:1,148,013–1,152,1691347
FgABC51FG05_068814:1,529,213–1,533,7561293
FgABC52FG05_071014:2,326,597–2,328,684607
FgABC53FG05_073254:3,117,178–3,121,7101452
FgABC54FG05_073834:3,346,695–3,351,4571552
FgABC55FG05_075164:3,725,971–3,730,1371358
FgABC56FG05_097324:5,482,419–5,484,359646
FgABC57FG05_097074:5,586,196–5,591,3341467
FgABC58FG05_097064:5,592,046–5,594,437727
FgABC59FG05_096114:5,866,657–5,871,4631514
FgABC60FG05_095284:6,157,607–6,159,955750
FgABC61FG05_093294:6,849,754–6,854,4251474
FgABC62FG05_090174:7,753,696–7,758,7941677
FgABC63FG05_30696KK082496:6,731–11,1071240
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Poznanski, P.; Shalmani, A.; Poznanski, P.; Orczyk, W. The Synergy of Chitosan and Azoxystrobin Against Fusarium graminearum Is Modulated by Selected ABC Transporters. Int. J. Mol. Sci. 2025, 26, 262. https://doi.org/10.3390/ijms26010262

AMA Style

Poznanski P, Shalmani A, Poznanski P, Orczyk W. The Synergy of Chitosan and Azoxystrobin Against Fusarium graminearum Is Modulated by Selected ABC Transporters. International Journal of Molecular Sciences. 2025; 26(1):262. https://doi.org/10.3390/ijms26010262

Chicago/Turabian Style

Poznanski, Pawel, Abdullah Shalmani, Pascal Poznanski, and Waclaw Orczyk. 2025. "The Synergy of Chitosan and Azoxystrobin Against Fusarium graminearum Is Modulated by Selected ABC Transporters" International Journal of Molecular Sciences 26, no. 1: 262. https://doi.org/10.3390/ijms26010262

APA Style

Poznanski, P., Shalmani, A., Poznanski, P., & Orczyk, W. (2025). The Synergy of Chitosan and Azoxystrobin Against Fusarium graminearum Is Modulated by Selected ABC Transporters. International Journal of Molecular Sciences, 26(1), 262. https://doi.org/10.3390/ijms26010262

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop