The Regulatory Role of Pancreatic Enzymes in the Maintenance of Small Intestinal Structure and Enterocyte Turnover with Special Reference to Alpha Amylase
Abstract
1. Introduction
2. Results
2.1. Structural Changes in Small Intestine
2.2. Changes in Brush Border Thickness and Goblet Cell Population in Small Intestine
2.3. The Levels of Accumulated Glycogen in Small Intestinal Mucosa
2.4. The Disaccharidase Activity in Small Intestinal Brush Border
2.5. The Proliferation and Apoptotic Indices in Small Intestinal Segments
2.6. Expression of PepT1
3. Discussion
4. Materials and Methods
4.1. Animal Experiment and Diets
4.1.1. Animals
4.1.2. Feeding and Enzyme Administration
4.1.3. Autopsy
4.2. Histomorphometric Analysis
4.3. Immunohistochemical Analysis
4.3.1. Intestinal Crypt Stem Cell Proliferative Activity
4.3.2. Apoptotic Index of the Epithelial Cells of the Small Intestine
4.4. Glycogen Determination
4.5. Brush Border Disaccharidase Activity Assay
4.6. Expression of PepT1
4.7. Statistical Analysis
5. Limitations of the Study
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- McDonald, P.; Edwards, R.A.; Greenhalgh, J.F.D.; Morgan, C.A. Animal Nutrition, 6th ed.; Pearson Education Limited: Harlow, UK, 2002. [Google Scholar]
- Pond, W.G.; Church, D.C.; Pond, K.R.; Schoknecht, P.A. Basic Animal Nutrition and Feeding, 5th ed.; Wiley: Hoboken, NJ, USA, 2005. [Google Scholar]
- Gregory, P.C.; Tabeling, R.; Kamphues, J. Pancreas nutrition and animal growth: Growth and digestion in pancreatic duct ligated pigs. Effect of enzyme supplementation. In Biology of the Pancreas in Growing Animals, 1st ed.; Elsevier: Amsterdam, The Netherlands, 1999; pp. 381–393. [Google Scholar]
- Fedkiv, O.; Rengman, S.; Westrom, B.R.; Pierzynowski, S.G. Growth is dependent on the exocrine pancreas function in young weaners but not in growing–finishing pigs. J. Physiol. Pharmacol. 2009, 60, 55–59. [Google Scholar] [PubMed]
- Adler, G.; Hausmann, W.; Elsebach, K.; Goke, B.; Lorenz-Meyer, H.; Herberg, L.; Arnold, R. Effect of pancreatic atrophy and hypertrophy on the small intestine. Gut 1987, 28, 193–195. [Google Scholar] [CrossRef] [PubMed]
- Balas, D.; Senegas-Balas, F.; Bertrand, C.; Frexinos, J.; Ribet, A. Effects of pancreatic duct ligation on the hamster intestinal mucosa: Histological findings. Digestion 1980, 20, 157–167. [Google Scholar] [CrossRef] [PubMed]
- Nousia-Arvanitakis, S.; Karagiozoglou-Lamboudes, T.; Aggouridaki, C.; Malaka- Lambrellis, E.; Galli-Tsinopoulou, A.; Xefteri, M. Influence of jejunal morphology changes on exocrine pancreatic function in celiac disease. J. Pediatr. Gastroenterol. Nutr. 1999, 29, 81–85. [Google Scholar] [CrossRef]
- Szkopek, D.; Pierzynowski, S.G.; Pierzynowska, K.; Zaworski, K.; Kondej, A.; Wychowański, P.; Konieczka, P.; Seklecka, B.; Donaldson, J.; Jank, M.; et al. A review: Pancreatic enzymes in the treatment of chronic pancreatic insufficiency in companion animals. J. Vet. Intern. Med. 2024, 38, 2026–2033. [Google Scholar] [CrossRef]
- Pryhodko, O.; Fedkiv, O.; Weström, B.R.; Pierzynowski, S.G. Effects on gut properties in exocrine pancreatic insufficient (EPI) pigs, being growth retarded due to pancreatic duct ligation at 7 weeks but not at 16 weeks of age. Adv. Med. Sci. 2014, 59, 74–80. [Google Scholar] [CrossRef]
- Pierzynowski, S.G.; Stier, C.; Pierzynowska, K. A hypothesis that alpha-amylase evokes regulatory mechanisms originating in the pancreas, gut and circulation, which govern glucose/insulin homeostasis. World J. Diabetes 2023, 14, 1341–1348. [Google Scholar] [CrossRef]
- Pierzynowski, S.G.; Goncharova, K.; Gregory, P.C.; Weström, B.; Podpryatov, S.E.; Podpriatov, S.S.; Woliński, J.; Repich, H.; Wierup, N.; Lozinska, L. Experiments suggesting extra-digestive effects of enteral pancreatic amylase and its peptides on glucose homeostasis in a pig model. Sci. Rep. 2017, 7, 71–79. [Google Scholar] [CrossRef]
- Słupecka, M.; Woliński, J.; Prykhodko, O.; Ochniewicz, P.; Gruijc, D.; Fedkiv, O.; Westrom, B.R.; Pierzynowski, S.G. Stimulating effect of pancreatic-like enzymes on the development of the gastrointestinal tract in piglets. J. Anim. Sci. 2012, 90, 311–314. [Google Scholar] [CrossRef]
- Date, K. Regulatory Functions of α-Amylase in the Small Intestine Other than Starch Digestion: α-Glucosidase Activity, Glucose Absorption, Cell Proliferation, and Differentiation. Amylase Molecular Biology, Physiology, Pharmacology and Drug Development. In New Insights into Metabolic Syndrome; Intechopen: London, UK, 2020. [Google Scholar]
- Pierzynowski, S.G.; Gregory, P.C.; Filip, R.; Woliński, J.; Goncharova-Pierzynowska, K. Glucose Homeostasis Dependency on Acini–Islet–Acinar (AIA) Axis Communication: A New Possible Pathophysiological Hypothesis Regarding Diabetes Mellitus. Nutr. Diabetes 2018, 8, 55. [Google Scholar] [CrossRef]
- Pierzynowska, K.; Oredsson, S.; Pierzynowski, S. Amylase-Dependent Regulation of Glucose Metabolism and Insulin/Glucagon Secretion in the Streptozotocin-Induced Diabetic Pig Model and in a Rat Pancreatic Beta-Cell Line, BRIN-BD1. J. Diabetes Res. 2020, 1, 2148740. [Google Scholar] [CrossRef] [PubMed]
- Pierzynowska, K.; Wychowański, P.; Zaworski, K.; Woliński, J.; Donaldson, J.; Pierzynowski, S. Anti-Incretin Gut Features Induced by Feed Supplementation with Alpha-Amylase: Studies on EPI Pigs. Int. J. Mol. Sci. 2023, 24, 16177. [Google Scholar] [CrossRef] [PubMed]
- Rengman, S.; Fedkiv, O.; Botermans, J.; Svendsen, J.; Westrom, B.; Pierzynowski, S. An elemental diet fed, enteral or parenteral, does not support growth in young pigs with exocrine pancreatic insufficiency. Clin. Nutr. 2009, 28, 325–330. [Google Scholar] [CrossRef] [PubMed]
- Rengman, S.; Fedkiv, O.; Botermans, J.; Svendsen, J.; Westrom, B.; Pierzynowski, S. The growth of exocrine pancreatic insufficient young pigs fed an elemental diet is dependent on enteral pancreatin supplementation. Livest. Sci. 2010, 134, 50–52. [Google Scholar] [CrossRef]
- Pierzynowski, S.; Swieboda, P.; Filip, R.; Szwiec, K.; Valverde Piedra, J.L.; Gruijc, D.; Pryhodko, O.; Fedkiv, O.; Kruszewska, D.; Botermans, J.; et al. Behavioral changes in response to feeding pancreatic-like enzymes to exocrine pancreatic insufficiency pigs. J. Anim. Sci. 2012, 90, 439–441. [Google Scholar] [CrossRef]
- Walkowiak, J.; Sands, D.; Nowakowska, A.; Piotrowski, R.; Zybert, K.; Herzig, K.H.; Milanowski, A. Early decline of pancreatic function in cystic fibrosis patients with class 1 or 2 CFTR mutations. J. Pediatr. Gastroenterol. Nutr. 2005, 40, 199–201. [Google Scholar] [CrossRef]
- Safdi, M.; Bekal, P.K.; Martin, S.; Saeed, Z.; Burton, F.; Toskes, P. The effects of oral pancreatic enzymes (Creon 10 capsule) on steatorrhea: A multicenter, placebo-controlled, parallel group trial in subjects with chronic pancreatitis. Pancreas 2006, 33, 156–162. [Google Scholar] [CrossRef]
- Stern, R.C.; Eisenberg, J.D.; Wagener, J.S.; Ahrens, R.; Rock, M.; do Pico, G.; Orenstein, D.M. A comparison of the efficacy and tolerance of pancrelipase and placebo in the treatment of steatorrhea in cystic fibrosis patients with clinical exocrine pancreatic insufficiency. Am. J. Gastroenterol. 2000, 95, 1932–1938. [Google Scholar] [CrossRef]
- Date, K.; Yamazaki, T.; Toyoda, Y.; Hoshi, K.; Ogawa, H. A-Amylase Expressed in Human Small Intestinal Epithelial Cells is Essential for Cell Proliferation and Differentiation. J. Cell Biochem. 2020, 121, 1238–1249. [Google Scholar] [CrossRef]
- Freedman, S.D.; Zaworski, K.; Pierzynowska, K.; Pierzynowski, S.; Gallotto, R.; Sathe, M.; Borowitz, D.S. Validation of an omega-3 substrate challenge absorption test as an indicator of global fat lipolysis. PLoS ONE 2023, 18, e0284651. [Google Scholar] [CrossRef]
- Durie, P.; Kalnins, D.; Ellis, L. Uses and abuses of enzyme therapy in cystic fibrosis. J. R. Soc. Med. 1998, 91, 2–13. [Google Scholar] [CrossRef] [PubMed]
- Tabori, H.; Arnold, C.; Jaudszus, A.; Hans-Joachim, M.; Renz, D.M.; Reinsch, S.; Lorens, M.; Michl, R.; Gerber, A.; Lehmann, T.; et al. Abdominal symptoms in cystic fibrosis and their relation to genotype, history, clinical and laboratory findings. PLoS ONE 2017, 12, e0174463. [Google Scholar] [CrossRef] [PubMed]
- Thornton, C.S.; Waddell, B.J.; Congly, S.E.; Svishchuk, J.; Somayaji, R.; Fatovich, L.; Isaac, D.; Doucette, K.; Fonseca, K.; Drews, S.J.; et al. Porcine-derives pancreatic enzyme replacement therapy may be linked to chronic hepatitis E virus infection in cystic fibrosis lung transplant recipients. Gut 2024, 73, 1702–1711. [Google Scholar] [CrossRef] [PubMed]
- Senegas-Balas, F.; Balas, D.; Bouisson, M.; Ribet, A. Effect of pancreatic duct ligation on the hamster intestinal mucosa. Variation of several hydrolases. Digestion 1981, 21, 83–91. [Google Scholar] [CrossRef]
- Hauer-Jensen, M.; Skjonsberg, G.; Moen, E.; Clausen, O.P.F. Intestinal morphology and cytokinetics in pancreatic insufficiency. An experimental study in the rat. Dig. Dis. Sci. 1995, 40, 2170–2176. [Google Scholar] [CrossRef]
- Simpson, K.W.; Morton, D.B.; Sørensen, S.H.; McLean, L.; Riley, J.E.; Batt, R.M. Biochemical changes in the jejunal mucosa of dogs with exocrine pancreatic insufficiency following pancreatic duct ligation. Res. J. Vet. Sci. 1989, 47, 338–345. [Google Scholar] [CrossRef]
- Williams, D.A.; Batt, R.M.; McLean, L. Bacterial overgrowth in the duodenum of dogs with exocrine pancreatic insufficiency. J. Am. Vet. Med. Assoc. 1987, 191, 201–206. [Google Scholar] [PubMed]
- Goncharova, K.; Pierzynowski, S.G.; Grujic, D.; Kirko, S.; Szwiec, K.; Wang, J.; Kovalenko, T.; Osadchenko, I.; Ushakova, G.; Shmigel, H. A piglet with surgically induced exocrine pancreatic insufficiency as an animal model of newborns to study fat digestion. Br. J. Nutr. 2014, 112, 2060–2067. [Google Scholar] [CrossRef]
- Goncharova, K.; Kirko, S.; Grujic, D.; Kardas, M.; Grochowska-Niedworok, E.; Pryhodko, O.; Woliński, J.; Ushakova, G.; Lozinska, L.; Pierzynowski, S.G. Enhanced absorption of long-chain polyunsaturated fatty acids following consumption of functional milk formula, pre-digested with immobilized lipase ex vivo in an exocrine pancreatic insufficient (EPI) pig model. J. Funct. Foods 2017, 34, 422–430. [Google Scholar] [CrossRef]
- Senegas-Balas, F.; Bastie, M.J.; Balas, D.; Escourrou, J.; Bommelaer, G.; Bertrand, C.; Arany, Y.; Ribet, A. Histological variations of the duodenal mucosa in chronic human pancreatitis. Dig. Dis. Sci. 1982, 27, 917–922. [Google Scholar] [CrossRef]
- van Elburg, R.M.; Uil, J.J.; van Aalderen, W.M.; Mulder, C.J.J.; Heymans, H.S.A. Intestinal permeability in exocrine pancreatic insufficiency due to cystic fibrosis or chronic pancreatitis. Pediatr. Res. 1996, 39, 985–991. [Google Scholar] [CrossRef] [PubMed]
- Pezzilli, R. Chronic pancreatitis: Maldigestion, intestinal ecology and intestinal inflammation. World J. Gastroenterol. 2009, 15, 1673–1676. [Google Scholar] [CrossRef] [PubMed]
- Werlin, S.L.; Benuri-Silbiger, I.; Kerem, E.; Adler, S.N.; Goldin, E.; Zimmerman, J.; Malka, N.; Cohen, L.; Armoni, S.; Yatzkan-Israelit, Y.; et al. Evidence of intestinal inflammation in patients with cystic fibrosis. J. Pediatr. Gastroenterol. Nutr. 2010, 51, 304–308. [Google Scholar] [CrossRef] [PubMed]
- Ferraris, R.P. Dietary and developmental regulation of intestinal sugar transport. Biochem. J. 2001, 360, 265–276. [Google Scholar] [CrossRef]
- Karasov, W.H.; Douglas, A.E. Comparative digestive physiology. Comp. Dig. Physiol. 2013, 3, 741–783. [Google Scholar] [CrossRef]
- Westermarck, E.; Wiberg, M. Exocrine pancreatic insufficiency in the dog: Historical background, diagnosis, and treatment. Top. Companion Anim. Med. 2012, 27, 96–103. [Google Scholar] [CrossRef]
- Lammers, W.J. Role of growth factors in the modulation of cell proliferation and apoptosis during pancreatic enzyme supplementation. J. Gastroenterol. 2011, 46, 799–809. [Google Scholar]
- de Oliveira, M.P. Microbial enzyme supplementation in carbohydrate malabsorption: Effects on gut health and inflammation. J. Dig. Dis. 2016, 17, 561–569. [Google Scholar]
- Reeds, P.; Burrin, D.G.; Stoll, B.; Farook, J. Intestinal glutamate metabolism 1,2. J. Nutr. 2000, 130, 978–983. [Google Scholar] [CrossRef]
- Rohm, F.; Skurk, T.; Daniel, H.; Spanier, B. Appearance of Di- and Tripeptides in Human Plasma after a Protein Meal Does Not Correlate with PEPT1 Substrate Selectivity. Mol. Nutr. Food Res. 2019, 63, e1801094. [Google Scholar] [CrossRef]
- Faul, F.; Erdfelder, E.; Lang, A.G.; Buchner, A. G∗power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav. Res. Methods 2007, 39, 175–191. [Google Scholar] [CrossRef] [PubMed]
- Fischer, A.H.; Jacobson, K.A.; Rose, J.; Zeller, R. Paraffin embedding tissue samples for sectioning. Cold Spring Harb. Protoc. 2008, 2008, 49. [Google Scholar] [CrossRef] [PubMed]
- Feldman, A.T.; Wolfe, D. Tissue Processing and Hematoxylin and Eosin Staining. In Histopathology. Methods in Molecular Biology; Day, C., Ed.; Humana Press: New York, NY, USA, 2014; Volume 1180, pp. 31–43. [Google Scholar] [CrossRef]
- Phillips, A.D.; Brown, A.; Hicks, S.; Schuller, S.; Murch, S.H.; Walker-Smith, J.A.; Swallow, D.M. Acetylated sialic acid residues and blood group antigens localise within the epithelium in microvillous atrophy indicating internal accumulation of the glycocalyx. Gut 2004, 53, 1764–1771. [Google Scholar] [CrossRef] [PubMed]
- Good, C.A.; Kramer, H.; Somogyi, M. The Determination of Glycogen. JBC 1933, 100, 485–491. [Google Scholar] [CrossRef]
- Dahlqvist, E. Assay of intestinal disaccharidases. Scand. J. Clin. Lab. Investig. 1984, 4, 169–172. [Google Scholar] [CrossRef]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the Folin phenol reagent. JBC 1951, 193, 265–275. [Google Scholar] [CrossRef]
- Szkopek, D.; Mendel, M.; Kinsner, M.; Fotschki, B.; Juśkiewicz, J.; Kozłowski, K.; Matusevicius, P.; Konieczka, P. Interaction between peroxisome proliferator-activated receptors and cannabidiol in the gut of chickens applied to different challenge conditions. Int. J. Mol. Sci. 2024, 25, 11398. [Google Scholar] [CrossRef]
- Dekaney, C.M.; Bazer, F.W.; Jaeger, L.A. Mucosal morphogenesis and cytodifferentiation in fetal porcine small intestine. Anat. Rec. 1997, 249, 517–523. [Google Scholar] [CrossRef]
Parameter/Group | EPI | Amylase | Creon | Healthy |
---|---|---|---|---|
Duodenum | ||||
Mucosa thickness, μm | 1207.0 ± 132.3 | 1374.0 ± 191.5 | 1373.0 ± 165.1 | 1288.0 ± 36.8 |
Villus length, μm | 662.1 ± 113.3 a | 863.7 ± 120.1 b | 984.7 ± 174.0 b | 857.5 ± 41.5 b |
Crypt depth, μm | 171.4 ± 9.5 a | 249.6 ± 42.5 b | 247.8 ± 25.0 b | 227.2 ± 31.5 b |
Muscularis thickness, μm | 174.0 ± 36.8 a | 304.7 ± 40.7 b | 317.4 ± 27.2 b | 326.8 ± 48.3 b |
Proximal Jejunum | ||||
Mucosa thickness, μm | 1086.0 ± 145.1 | 1300.0 ± 194.4 | 1145.0 ± 95.8 | 1153.0 ± 40.4 |
Villus length, μm | 605.9 ± 106.4 a | 828.6 ± 143.5 b | 744.3 ± 80.6 b | 777.8 ± 36.9 b |
Crypt depth, μm | 174.8 ± 6.2 a | 234.3 ± 19.3 b | 216.5 ± 24.6 b | 225.1 ± 16.8 b |
Muscularis thickness, μm | 210.5 ± 71.7 a | 265.6 ± 32.2 ab | 295.0 ± 21.7 b | 293.1 ± 45.6 b |
Middle Jejunum | ||||
Mucosa thickness, μm | 975.9 ± 91.6 ac | 1095.0 ± 85.6 ab | 1107.0 ± 53.7 b | 958.4 ± 48.6 c |
Villus length, μm | 569.2 ± 75.4 a | 681.5 ± 85.6 ab | 706.2 ± 32.8 b | 648.8 ± 29.6 a |
Crypt depth, μm | 188.5 ± 19.9 a | 215.8 ± 25.0 b | 244.2 ± 23.0 c | 199.2 ± 18.9 ab |
Muscularis thickness, μm | 189.5 ± 47.7 a | 302.2 ± 31.2 b | 313.9 ± 23.6 b | 308.9 ± 18.1 b |
Distal Jejunum | ||||
Mucosa thickness, μm | 839.5 ± 101.2 | 949.8 ± 99.3 | 948.4 ± 75.1 | 904.4 ± 47.1 |
Villus length, μm | 501.8 ± 82.5 a | 609.9 ± 106.2 ab | 666.2 ± 81.6 b | 586.3 ± 133.1 a |
Crypt depth, μm | 181.0 ± 27.6 a | 230.9 ± 43.2 b | 233.6 ± 20.1 b | 222.3 ± 63.3 a |
Muscularis thickness, μm | 189.7 ± 54.0 a | 306.3 ± 45.0 b | 327.9 ± 25.5 b | 295.2 ± 93.0 ab |
Ileum | ||||
Mucosa thickness, μm | 764.8 ± 140.6 | 841.6 ± 94.6 | 878.7 ± 137.3 | 844.5 ± 24.8 |
Villus length, μm | 470.1 ± 109.4 | 539.6 ± 91.6 | 544.0 ± 101.1 | 591.5 ± 50.9 |
Crypt depth, μm | 164.7 ± 7.2 a | 204.2 ± 34.6 b | 213.3 ± 22.0 b | 214.6 ± 9.0 b |
Muscularis thickness, μm | 198.4 ± 62.8 a | 326.3 ± 93.4 b | 325.9 ± 64.8 b | 286.1 ± 32.2 b |
Parameter/Group | EPI | Amylase | Creon | Healthy |
---|---|---|---|---|
Duodenum | ||||
Brush border thickness, μm | 4.3 ± 1.5 a | 7.8 ± 2.0 b | 7.8 ± 1.0 b | 5.7 ± 1.5 ab |
Goblet cell area in crypts, μm2 | 1602.0 ± 426.0 a | 4419.0 ± 853.5 b | 2374.0 ± 776.1 a | 3421.0 ± 666.9 b |
Crypt area, μm2 | 9892.0 ± 3357.0 a | 14,495 ± 2554 b | 12,335 ± 2247 a | 21,424 ± 3447 c |
Goblet cells, n per crypt | 8.2 ± 0.8 a | 14.7 ± 1.1 b | 10.9 ± 1.0 c | 10.4 ± 1.9 ac |
Proximal Jejunum | ||||
Brush border thickness, μm | 4.4 ± 1.9 a | 8.3 ± 2.3 b | 7.1 ± 1.4 c | 5.7 ± 1.2 ac |
Goblet cell area in crypts, μm2 | 1809.0 ± 692.2 a | 3577.0 ± 705.1 b | 2184.0 ± 309.8 a | 2511.0 ± 601.6 a |
Crypt area, μm2 | 11,318 ± 4287 a | 13,615 ± 2510 a | 14,142 ± 2805 a | 20,174 ± 2739 b |
Goblet cells, n per crypt | 8.3 ± 0.6 a | 13.9 ± 1.6 b | 9.7 ± 0.8 a | 8.6 ± 1.5 a |
Middle Jejunum | ||||
Brush border thickness, μm | 5.6 ± 1.5 a | 8.4 ± 1.0 b | 8.6 ± 1.0 b | 6.4 ± 0.6 a |
Goblet cell area in crypts, μm2 | 1989.0 ± 801.8 a | 3152.0 ± 677.6 b | 2331.0 ± 572.4 a | 3122.0 ± 670.0 ab |
Crypt area, μm2 | 14,333 ± 5451 a | 12,728 ± 2841 a | 16,053 ± 2908 a | 22,584 ± 3935 b |
Goblet cells, n per crypt | 7.9 ± 1.7 a | 14.9 ± 1.5 b | 10.2 ± 1.9 a | 8.3 ± 1.6 a |
Distal Jejunum | ||||
Brush border thickness, μm | 4.1 ± 1.4 a | 7.2 ± 2.3 b | 7.4 ± 1.0 b | 5.8 ± 1.2 ab |
Goblet cell area in crypts, μm2 | 1736.0 ± 778.7 a | 3622.0 ± 798.8 b | 2556.0 ± 459.0 a | 2476.0 ± 425.5 a |
Crypt area, μm2 | 10,713 ± 4930 a | 12,381 ± 4573 ab | 13,425 ± 1250 ab | 17,155 ± 2747 b |
Goblet cells, n per crypt | 8.9 ± 1.0 a | 15.0 ± 1.6 b | 9.9 ± 1.1 a | 8.8 ± 0.9 a |
Ileum | ||||
Brush border thickness, μm | 3.4 ± 1.6 a | 8.4 ± 1.4 b | 6.8 ± 1.6 b | 6.4 ± 1.4 b |
Goblet cell area in crypts, μm2 | 2335.0 ± 1363.0 a | 4598.0 ± 728.8 b | 2626.0 ± 230.0 a | 3659.0 ± 820.8 ab |
Crypt area, μm2 | 11,744 ± 6474 a | 13,955 ± 2809 a | 13,360 ± 912 a | 22,407 ± 5307 b |
Goblet cells, n per crypt | 10.1 ± 1.6 a | 16.5 ± 3.5 b | 12.1 ± 1.6 c | 10.3 ± 0.3 a |
Gene | Acc. No | Primer Sequence (5′–3′) | Amplicon Size |
---|---|---|---|
PepT1 | EU400159 | CATCGCCATACCCTTCTG TTCCCATCCATCGTGACATT | 144 |
GAPDH | X94251 | ACACTCACTCTTCTACCTTTG CAAATTCATTGTCGTACCAG | 90 |
ACTB | AY550069 | TGCGGCATCCACGAAACTAC AGGGCCGTGATCTCCTTCTG | 146 |
B2M | NM_213978.1 | ACTTTTCACACCGCTCCAGT CGGATGGAACCCAGATACAT | 180 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zaworski, K.; Wychowański, P.; Szkopek, D.; Woliński, J.; Donaldson, J.; Pierzynowski, S.; Pierzynowska, K. The Regulatory Role of Pancreatic Enzymes in the Maintenance of Small Intestinal Structure and Enterocyte Turnover with Special Reference to Alpha Amylase. Int. J. Mol. Sci. 2025, 26, 249. https://doi.org/10.3390/ijms26010249
Zaworski K, Wychowański P, Szkopek D, Woliński J, Donaldson J, Pierzynowski S, Pierzynowska K. The Regulatory Role of Pancreatic Enzymes in the Maintenance of Small Intestinal Structure and Enterocyte Turnover with Special Reference to Alpha Amylase. International Journal of Molecular Sciences. 2025; 26(1):249. https://doi.org/10.3390/ijms26010249
Chicago/Turabian StyleZaworski, Kamil, Piotr Wychowański, Dominika Szkopek, Jarosław Woliński, Janine Donaldson, Stefan Pierzynowski, and Kateryna Pierzynowska. 2025. "The Regulatory Role of Pancreatic Enzymes in the Maintenance of Small Intestinal Structure and Enterocyte Turnover with Special Reference to Alpha Amylase" International Journal of Molecular Sciences 26, no. 1: 249. https://doi.org/10.3390/ijms26010249
APA StyleZaworski, K., Wychowański, P., Szkopek, D., Woliński, J., Donaldson, J., Pierzynowski, S., & Pierzynowska, K. (2025). The Regulatory Role of Pancreatic Enzymes in the Maintenance of Small Intestinal Structure and Enterocyte Turnover with Special Reference to Alpha Amylase. International Journal of Molecular Sciences, 26(1), 249. https://doi.org/10.3390/ijms26010249