Comparison of Three Chimeric Zika Vaccine Prototypes Developed on the Genetic Background of the Clinically Proven Live-Attenuated Japanese Encephalitis Vaccine SA14-14-2
Abstract
1. Introduction
2. Results
2.1. Rationale for Selecting the Live-Attenuated JEV SA14-14-2 as a Vaccine Platform and Three Genetically Distinct Strains of ZIKV
2.2. Generation of Three Chimeric JEV/ZIKVs Expressing the Functional prM and E Proteins of Three Genetically Distinct ZIKV Strains
2.3. Comparison of the Virological Properties of the Three Chimeric JEV/ZIKVs in Vero Cells
2.4. Comparison of the Attenuation Phenotypes of the Three Chimeric JEV/ZIKVs in IFNAR−/− Mice
2.5. Evaluation of the Immunogenicity and Protective Efficacy of the Chimeric Virus rJEV/ZIKVP6-740 as a Candidate Vaccine Prototype Against ZIKV Infection
2.6. Comparison of the Amino Acid Sequence of the prM and E Proteins of Three Genetically Distinct ZIKV Strains
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. cDNA Cloning
4.3. Infectious Center Assay
4.4. Recovery of Recombinant Viruses from Functional cDNAs
4.5. Immunoblot Analysis
4.6. Viral Growth Analysis
4.7. Plaque Immunostaining (Immunoplaque Assay)
4.8. Mouse Studies
4.9. Ethics Statement
4.10. Plaque Reduction Neutralization Test (PRNT)
4.11. Sequence Analysis
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Simmonds, P.; Becher, P.; Bukh, J.; Gould, E.A.; Meyers, G.; Monath, T.; Muerhoff, S.; Pletnev, A.; Rico-Hesse, R.; Smith, D.B.; et al. ICTV virus taxonomy profile: Flaviviridae. J. Gen. Virol. 2017, 98, 2–3. [Google Scholar] [CrossRef] [PubMed]
- Postler, T.S.; Beer, M.; Blitvich, B.J.; Bukh, J.; de Lamballerie, X.; Drexler, J.F.; Imrie, A.; Kapoor, A.; Karganova, G.G.; Lemey, P.; et al. Renaming of the genus Flavivirus to Orthoflavivirus and extension of binomial species names within the family Flaviviridae. Arch. Virol. 2023, 168, 224. [Google Scholar] [CrossRef] [PubMed]
- Yun, S.I.; Lee, Y.M. Zika virus: An emerging flavivirus. J. Microbiol. 2017, 55, 204–219. [Google Scholar] [CrossRef]
- Dick, G.W.; Kitchen, S.F.; Haddow, A.J. Zika virus. I. Isolations and serological specificity. Trans. R. Soc. Trop. Med. Hyg. 1952, 46, 509–520. [Google Scholar] [CrossRef]
- Hayes, E.B. Zika virus outside Africa. Emerg. Infect. Dis. 2009, 15, 1347–1350. [Google Scholar] [CrossRef] [PubMed]
- Marchette, N.J.; Garcia, R.; Rudnick, A. Isolation of Zika virus from Aedes aegypti mosquitoes in Malaysia. Am. J. Trop. Med. Hyg. 1969, 18, 411–415. [Google Scholar] [CrossRef] [PubMed]
- Song, B.H.; Yun, S.I.; Woolley, M.; Lee, Y.M. Zika virus: History, epidemiology, transmission, and clinical presentation. J. Neuroimmunol. 2017, 308, 50–64. [Google Scholar] [CrossRef] [PubMed]
- Duffy, M.R.; Chen, T.H.; Hancock, W.T.; Powers, A.M.; Kool, J.L.; Lanciotti, R.S.; Pretrick, M.; Marfel, M.; Holzbauer, S.; Dubray, C.; et al. Zika virus outbreak on Yap Island, Federated States of Micronesia. N. Engl. J. Med. 2009, 360, 2536–2543. [Google Scholar] [CrossRef]
- Lanciotti, R.S.; Kosoy, O.L.; Laven, J.J.; Velez, J.O.; Lambert, A.J.; Johnson, A.J.; Stanfield, S.M.; Duffy, M.R. Genetic and serologic properties of Zika virus associated with an epidemic, Yap State, Micronesia, 2007. Emerg. Infect. Dis. 2008, 14, 1232–1239. [Google Scholar] [CrossRef]
- Haddow, A.D.; Schuh, A.J.; Yasuda, C.Y.; Kasper, M.R.; Heang, V.; Huy, R.; Guzman, H.; Tesh, R.B.; Weaver, S.C. Genetic characterization of Zika virus strains: Geographic expansion of the Asian lineage. PLoS Negl. Trop. Dis. 2012, 6, e1477. [Google Scholar] [CrossRef] [PubMed]
- Cao-Lormeau, V.M.; Roche, C.; Teissier, A.; Robin, E.; Berry, A.L.; Mallet, H.P.; Sall, A.A.; Musso, D. Zika virus, French Polynesia, South Pacific, 2013. Emerg. Infect. Dis. 2014, 20, 1085–1086. [Google Scholar] [CrossRef] [PubMed]
- Aubry, M.; Finke, J.; Teissier, A.; Roche, C.; Broult, J.; Paulous, S.; Despres, P.; Cao-Lormeau, V.M.; Musso, D. Seroprevalence of arboviruses among blood donors in French Polynesia, 2011-2013. Int. J. Infect. Dis. 2015, 41, 11–12. [Google Scholar] [CrossRef] [PubMed]
- Cao-Lormeau, V.M.; Musso, D. Emerging arboviruses in the Pacific. Lancet 2014, 384, 1571–1572. [Google Scholar] [CrossRef] [PubMed]
- Musso, D.; Cao-Lormeau, V.M.; Gubler, D.J. Zika virus: Following the path of dengue and chikungunya? Lancet 2015, 386, 243–244. [Google Scholar] [CrossRef]
- Musso, D.; Nilles, E.J.; Cao-Lormeau, V.M. Rapid spread of emerging Zika virus in the Pacific area. Clin. Microbiol. Infect. 2014, 20, O595–O596. [Google Scholar] [CrossRef] [PubMed]
- Campos, G.S.; Bandeira, A.C.; Sardi, S.I. Zika virus outbreak, Bahia, Brazil. Emerg. Infect. Dis. 2015, 21, 1885–1886. [Google Scholar] [CrossRef]
- Zanluca, C.; Melo, V.C.; Mosimann, A.L.; Santos, G.I.; Santos, C.N.; Luz, K. First report of autochthonous transmission of Zika virus in Brazil. Mem. Inst. Oswaldo Cruz 2015, 110, 569–572. [Google Scholar] [CrossRef] [PubMed]
- Cardoso, C.W.; Paploski, I.A.; Kikuti, M.; Rodrigues, M.S.; Silva, M.M.; Campos, G.S.; Sardi, S.I.; Kitron, U.; Reis, M.G.; Ribeiro, G.S. Outbreak of exanthematous illness associated with Zika, chikungunya, and dengue viruses, Salvador, Brazil. Emerg. Infect. Dis. 2015, 21, 2274–2276. [Google Scholar] [CrossRef] [PubMed]
- Musso, D.; Gubler, D.J. Zika virus. Clin. Microbiol. Rev. 2016, 29, 487–524. [Google Scholar] [CrossRef] [PubMed]
- Petersen, L.R.; Jamieson, D.J.; Powers, A.M.; Honein, M.A. Zika virus. N. Engl. J. Med. 2016, 374, 1552–1563. [Google Scholar] [CrossRef]
- Faria, N.R.; Azevedo, R.; Kraemer, M.U.G.; Souza, R.; Cunha, M.S.; Hill, S.C.; Theze, J.; Bonsall, M.B.; Bowden, T.A.; Rissanen, I.; et al. Zika virus in the Americas: Early epidemiological and genetic findings. Science 2016, 352, 345–349. [Google Scholar] [CrossRef]
- Lanciotti, R.S.; Lambert, A.J.; Holodniy, M.; Saavedra, S.; Signor, L. Phylogeny of Zika virus in Western Hemisphere, 2015. Emerg. Infect. Dis. 2016, 22, 933–935. [Google Scholar] [CrossRef] [PubMed]
- Yun, S.I.; Song, B.H.; Frank, J.C.; Julander, J.G.; Polejaeva, I.A.; Davies, C.J.; White, K.L.; Lee, Y.M. Complete genome sequences of three historically important, spatiotemporally distinct, and genetically divergent strains of Zika virus: MR-766, P6-740, and PRVABC-59. Genome Announc. 2016, 4, e00800-16. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Zika Epidemiology Update—May 2024. Available online: https://www.who.int/publications/m/item/zika-epidemiology-update-may-2024 (accessed on 1 August 2024).
- Centers for Disease Control and Prevention. Countries and Territories at Risk for Zika. Available online: https://www.cdc.gov/zika/geo/index.html (accessed on 1 August 2024).
- Gutierrez-Bugallo, G.; Piedra, L.A.; Rodriguez, M.; Bisset, J.A.; Lourenco-de-Oliveira, R.; Weaver, S.C.; Vasilakis, N.; Vega-Rua, A. Vector-borne transmission and evolution of Zika virus. Nat. Ecol. Evol. 2019, 3, 561–569. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.Y.; Shi, W.F.; Qin, C.F. The evolution of Zika virus from Asia to the Americas. Nat. Rev. Microbiol. 2019, 17, 131–139. [Google Scholar] [CrossRef]
- Sharma, V.; Sharma, M.; Dhull, D.; Sharma, Y.; Kaushik, S.; Kaushik, S. Zika virus: An emerging challenge to public health worldwide. Can. J. Microbiol. 2020, 66, 87–98. [Google Scholar] [CrossRef]
- Weaver, S.C.; Costa, F.; Garcia-Blanco, M.A.; Ko, A.I.; Ribeiro, G.S.; Saade, G.; Shi, P.Y.; Vasilakis, N. Zika virus: History, emergence, biology, and prospects for control. Antivir. Res. 2016, 130, 69–80. [Google Scholar] [CrossRef]
- Epelboin, Y.; Talaga, S.; Epelboin, L.; Dusfour, I. Zika virus: An updated review of competent or naturally infected mosquitoes. PLoS Negl. Trop. Dis. 2017, 11, e0005933. [Google Scholar] [CrossRef] [PubMed]
- Diallo, D.; Sall, A.A.; Diagne, C.T.; Faye, O.; Faye, O.; Ba, Y.; Hanley, K.A.; Buenemann, M.; Weaver, S.C.; Diallo, M. Zika virus emergence in mosquitoes in southeastern Senegal, 2011. PLoS ONE 2014, 9, e109442. [Google Scholar] [CrossRef]
- Boorman, J.P.; Porterfield, J.S. A simple technique for infection of mosquitoes with viruses; transmission of Zika virus. Trans. R. Soc. Trop. Med. Hyg. 1956, 50, 238–242. [Google Scholar] [CrossRef]
- Li, M.I.; Wong, P.S.; Ng, L.C.; Tan, C.H. Oral susceptibility of Singapore Aedes (Stegomyia) aegypti (Linnaeus) to Zika virus. PLoS Negl. Trop. Dis. 2012, 6, e1792. [Google Scholar] [CrossRef]
- Gubler, D.J. The global emergence/resurgence of arboviral diseases as public health problems. Arch. Med. Res. 2002, 33, 330–342. [Google Scholar] [CrossRef] [PubMed]
- Chouin-Carneiro, T.; Vega-Rua, A.; Vazeille, M.; Yebakima, A.; Girod, R.; Goindin, D.; Dupont-Rouzeyrol, M.; Lourenco-de-Oliveira, R.; Failloux, A.B. Differential susceptibilities of Aedes aegypti and Aedes albopictus from the Americas to Zika virus. PLoS Negl. Trop. Dis. 2016, 10, e0004543. [Google Scholar] [CrossRef]
- Grard, G.; Caron, M.; Mombo, I.M.; Nkoghe, D.; Mboui Ondo, S.; Jiolle, D.; Fontenille, D.; Paupy, C.; Leroy, E.M. Zika virus in Gabon (Central Africa)—2007: A new threat from Aedes albopictus? PLoS Negl. Trop. Dis. 2014, 8, e2681. [Google Scholar] [CrossRef]
- Wong, P.S.; Li, M.Z.; Chong, C.S.; Ng, L.C.; Tan, C.H. Aedes (Stegomyia) albopictus (Skuse): A potential vector of Zika virus in Singapore. PLoS Negl. Trop. Dis. 2013, 7, e2348. [Google Scholar] [CrossRef]
- Counotte, M.J.; Kim, C.R.; Wang, J.; Bernstein, K.; Deal, C.D.; Broutet, N.J.N.; Low, N. Sexual transmission of Zika virus and other flaviviruses: A living systematic review. PLoS Med. 2018, 15, e1002611. [Google Scholar] [CrossRef]
- Moreira, J.; Peixoto, T.M.; Siqueira, A.M.; Lamas, C.C. Sexually acquired Zika virus: A systematic review. Clin. Microbiol. Infect. 2017, 23, 296–305. [Google Scholar] [CrossRef] [PubMed]
- Sakkas, H.; Bozidis, P.; Giannakopoulos, X.; Sofikitis, N.; Papadopoulou, C. An update on sexual transmission of Zika virus. Pathogens 2018, 7, 66. [Google Scholar] [CrossRef]
- Musso, D.; Nhan, T.; Robin, E.; Roche, C.; Bierlaire, D.; Zisou, K.; Shan Yan, A.; Cao-Lormeau, V.M.; Broult, J. Potential for Zika virus transmission through blood transfusion demonstrated during an outbreak in French Polynesia, November 2013 to February 2014. Eurosurveillance 2014, 19, 20761. [Google Scholar] [CrossRef]
- Liu, R.; Wang, X.; Ma, Y.; Wu, J.; Mao, C.; Yuan, L.; Lu, J. Prevalence of Zika virus in blood donations: A systematic review and meta-analysis. BMC Infect. Dis. 2019, 19, 590. [Google Scholar] [CrossRef]
- Guzeloglu-Kayisli, O.; Kayisli, U.A.; Schatz, F.; Lockwood, C.J. Vertical Zika virus transmission at the maternal-fetal interface. Front. Virol. 2022, 2, 801778. [Google Scholar] [CrossRef]
- Ades, A.E.; Soriano-Arandes, A.; Alarcon, A.; Bonfante, F.; Thorne, C.; Peckham, C.S.; Giaquinto, C. Vertical transmission of Zika virus and its outcomes: A Bayesian synthesis of prospective studies. Lancet Infect. Dis. 2021, 21, 537–545. [Google Scholar] [CrossRef] [PubMed]
- Brasil, P.; Vasconcelos, Z.; Kerin, T.; Gabaglia, C.R.; Ribeiro, I.P.; Bonaldo, M.C.; Damasceno, L.; Pone, M.V.; Pone, S.; Zin, A.; et al. Zika virus vertical transmission in children with confirmed antenatal exposure. Nat. Commun. 2020, 11, 3510. [Google Scholar] [CrossRef] [PubMed]
- Marban-Castro, E.; Gonce, A.; Fumado, V.; Romero-Acevedo, L.; Bardaji, A. Zika virus infection in pregnant women and their children: A review. Eur. J. Obstet. Gynecol. Reprod. Biol. 2021, 265, 162–168. [Google Scholar] [CrossRef] [PubMed]
- Villalobos-Sanchez, E.; Burciaga-Flores, M.; Zapata-Cuellar, L.; Camacho-Villegas, T.A.; Elizondo-Quiroga, D.E. Possible routes for Zika virus vertical transmission in human placenta: A comprehensive review. Viral Immunol. 2022, 35, 392–403. [Google Scholar] [CrossRef]
- Dupont-Rouzeyrol, M.; Biron, A.; O'Connor, O.; Huguon, E.; Descloux, E. Infectious Zika viral particles in breastmilk. Lancet 2016, 387, 1051. [Google Scholar] [CrossRef]
- Centeno-Tablante, E.; Medina-Rivera, M.; Finkelstein, J.L.; Herman, H.S.; Rayco-Solon, P.; Garcia-Casal, M.N.; Rogers, L.; Ghezzi-Kopel, K.; Zambrano Leal, M.P.; Andrade Velasquez, J.K.; et al. Update on the transmission of Zika virus through breast milk and breastfeeding: A systematic review of the evidence. Viruses 2021, 13, 123. [Google Scholar] [CrossRef]
- Desgraupes, S.; Hubert, M.; Gessain, A.; Ceccaldi, P.E.; Vidy, A. Mother-to-child transmission of arboviruses during breastfeeding: From epidemiology to cellular mechanisms. Viruses 2021, 13, 1312. [Google Scholar] [CrossRef]
- Colt, S.; Garcia-Casal, M.N.; Pena-Rosas, J.P.; Finkelstein, J.L.; Rayco-Solon, P.; Weise Prinzo, Z.C.; Mehta, S. Transmission of Zika virus through breast milk and other breastfeeding-related bodily-fluids: A systematic review. PLoS Negl. Trop. Dis. 2017, 11, e0005528. [Google Scholar] [CrossRef]
- Blohm, G.M.; Lednicky, J.A.; Marquez, M.; White, S.K.; Loeb, J.C.; Pacheco, C.A.; Nolan, D.J.; Paisie, T.; Salemi, M.; Rodriguez-Morales, A.J.; et al. Evidence for mother-to-child transmission of Zika virus through breast milk. Clin. Infect. Dis. 2018, 66, 1120–1121. [Google Scholar] [CrossRef] [PubMed]
- Macnamara, F.N. Zika virus: A report on three cases of human infection during an epidemic of jaundice in Nigeria. Trans. R. Soc. Trop. Med. Hyg. 1954, 48, 139–145. [Google Scholar] [CrossRef]
- Giraldo, M.I.; Gonzalez-Orozco, M.; Rajsbaum, R. Pathogenesis of Zika virus infection. Annu. Rev. Pathol. 2023, 18, 181–203. [Google Scholar] [CrossRef]
- Filgueiras, I.S.; Torrentes de Carvalho, A.; Cunha, D.P.; Mathias da Fonseca, D.L.; El Khawanky, N.; Freire, P.P.; Cabral-Miranda, G.; Schimke, L.F.; Camara, N.O.S.; Ochs, H.D.; et al. The clinical spectrum and immunopathological mechanisms underlying ZIKV-induced neurological manifestations. PLoS Negl. Trop. Dis. 2021, 15, e0009575. [Google Scholar] [CrossRef] [PubMed]
- Bhardwaj, U.; Pandey, N.; Rastogi, M.; Singh, S.K. Gist of Zika virus pathogenesis. Virology 2021, 560, 86–95. [Google Scholar] [CrossRef]
- Cao-Lormeau, V.M.; Blake, A.; Mons, S.; Lastere, S.; Roche, C.; Vanhomwegen, J.; Dub, T.; Baudouin, L.; Teissier, A.; Larre, P.; et al. Guillain-Barre syndrome outbreak associated with Zika virus infection in French Polynesia: A case-control study. Lancet 2016, 387, 1531–1539. [Google Scholar] [CrossRef]
- Oehler, E.; Watrin, L.; Larre, P.; Leparc-Goffart, I.; Lastere, S.; Valour, F.; Baudouin, L.; Mallet, H.; Musso, D.; Ghawche, F. Zika virus infection complicated by Guillain-Barre syndrome—Case report, French Polynesia, December 2013. Eurosurveillance 2014, 19, 20720. [Google Scholar] [CrossRef] [PubMed]
- Broutet, N.; Krauer, F.; Riesen, M.; Khalakdina, A.; Almiron, M.; Aldighieri, S.; Espinal, M.; Low, N.; Dye, C. Zika virus as a cause of neurologic disorders. N. Engl. J. Med. 2016, 374, 1506–1509. [Google Scholar] [CrossRef] [PubMed]
- Roze, B.; Najioullah, F.; Ferge, J.L.; Apetse, K.; Brouste, Y.; Cesaire, R.; Fagour, C.; Fagour, L.; Hochedez, P.; Jeannin, S.; et al. Zika virus detection in urine from patients with Guillain-Barre syndrome on Martinique, January 2016. Eurosurveillance 2016, 21, 30154. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, O.J.M.; da Silva, I.R.F. Guillain-Barre syndrome and Zika virus outbreaks. Curr. Opin. Neurol. 2017, 30, 500–507. [Google Scholar] [CrossRef]
- Leonhard, S.E.; Mandarakas, M.R.; Gondim, F.A.A.; Bateman, K.; Ferreira, M.L.B.; Cornblath, D.R.; van Doorn, P.A.; Dourado, M.E.; Hughes, R.A.C.; Islam, B.; et al. Diagnosis and management of Guillain-Barre syndrome in ten steps. Nat. Rev. Neurol. 2019, 15, 671–683. [Google Scholar] [CrossRef]
- Victora, C.G.; Schuler-Faccini, L.; Matijasevich, A.; Ribeiro, E.; Pessoa, A.; Barros, F.C. Microcephaly in Brazil: How to interpret reported numbers? Lancet 2016, 387, 621–624. [Google Scholar] [CrossRef] [PubMed]
- Brasil, P.; Pereira, J.P., Jr.; Moreira, M.E.; Ribeiro Nogueira, R.M.; Damasceno, L.; Wakimoto, M.; Rabello, R.S.; Valderramos, S.G.; Halai, U.A.; Salles, T.S.; et al. Zika virus infection in pregnant women in Rio de Janeiro. N. Engl. J. Med. 2016, 375, 2321–2334. [Google Scholar] [CrossRef] [PubMed]
- de Araujo, T.V.B.; Rodrigues, L.C.; de Alencar Ximenes, R.A.; de Barros Miranda-Filho, D.; Montarroyos, U.R.; de Melo, A.P.L.; Valongueiro, S.; de Albuquerque, M.; Souza, W.V.; Braga, C.; et al. Association between Zika virus infection and microcephaly in Brazil, January to May, 2016: Preliminary report of a case-control study. Lancet Infect. Dis. 2016, 16, 1356–1363. [Google Scholar] [CrossRef] [PubMed]
- Calvet, G.; Aguiar, R.S.; Melo, A.S.O.; Sampaio, S.A.; de Filippis, I.; Fabri, A.; Araujo, E.S.M.; de Sequeira, P.C.; de Mendonca, M.C.L.; de Oliveira, L.; et al. Detection and sequencing of Zika virus from amniotic fluid of fetuses with microcephaly in Brazil: A case study. Lancet Infect. Dis. 2016, 16, 653–660. [Google Scholar] [CrossRef]
- Mlakar, J.; Korva, M.; Tul, N.; Popovic, M.; Poljsak-Prijatelj, M.; Mraz, J.; Kolenc, M.; Resman Rus, K.; Vesnaver Vipotnik, T.; Fabjan Vodusek, V.; et al. Zika virus associated with microcephaly. N. Engl. J. Med. 2016, 374, 951–958. [Google Scholar] [CrossRef] [PubMed]
- Vhp, L.; Aragao, M.M.; Pinho, R.S.; Hazin, A.N.; Paciorkowski, A.R.; Penalva de Oliveira, A.C.; Masruha, M.R. Congenital Zika virus infection: A review with emphasis on the spectrum of brain abnormalities. Curr. Neurol. Neurosci. Rep. 2020, 20, 49. [Google Scholar] [CrossRef]
- Rombi, F.; Bayliss, R.; Tuplin, A.; Yeoh, S. The journey of Zika to the developing brain. Mol. Biol. Rep. 2020, 47, 3097–3115. [Google Scholar] [CrossRef]
- Teixeira, F.M.E.; Pietrobon, A.J.; Oliveira, L.M.; Oliveira, L.; Sato, M.N. Maternal-fetal interplay in Zika virus infection and adverse perinatal outcomes. Front. Immunol. 2020, 11, 175. [Google Scholar] [CrossRef] [PubMed]
- Cauchemez, S.; Besnard, M.; Bompard, P.; Dub, T.; Guillemette-Artur, P.; Eyrolle-Guignot, D.; Salje, H.; Van Kerkhove, M.D.; Abadie, V.; Garel, C.; et al. Association between Zika virus and microcephaly in French Polynesia, 2013–2015: A retrospective study. Lancet 2016, 387, 2125–2132. [Google Scholar] [CrossRef] [PubMed]
- Jouannic, J.M.; Friszer, S.; Leparc-Goffart, I.; Garel, C.; Eyrolle-Guignot, D. Zika virus infection in French Polynesia. Lancet 2016, 387, 1051–1052. [Google Scholar] [CrossRef]
- Li, K.; Ji, Q.; Jiang, S.; Zhang, N. Advancement in the development of therapeutics against Zika virus infection. Front. Cell Infect. Microbiol. 2022, 12, 946957. [Google Scholar] [CrossRef]
- Wang, Y.; Ling, L.; Zhang, Z.; Marin-Lopez, A. Current advances in Zika vaccine development. Vaccines 2022, 10, 1816. [Google Scholar] [CrossRef] [PubMed]
- Castanha, P.M.S.; Marques, E.T.A. A glimmer of hope: Recent updates and future challenges in Zika vaccine development. Viruses 2020, 12, 1371. [Google Scholar] [CrossRef] [PubMed]
- Zhou, K.; Li, C.; Shi, W.; Hu, X.; Nandakumar, K.S.; Jiang, S.; Zhang, N. Current progress in the development of Zika virus vaccines. Vaccines 2021, 9, 1004. [Google Scholar] [CrossRef]
- Liu, Z.Y.; Qin, C.F. Structure and function of cis-acting RNA elements of flavivirus. Rev. Med. Virol. 2020, 30, e2092. [Google Scholar] [CrossRef] [PubMed]
- Abram, Q.H.; Landry, B.N.; Wang, A.B.; Kothe, R.F.; Hauch, H.C.H.; Sagan, S.M. The myriad roles of RNA structure in the flavivirus life cycle. RNA Biol. 2024, 21, 14–30. [Google Scholar] [CrossRef] [PubMed]
- Ng, W.C.; Soto-Acosta, R.; Bradrick, S.S.; Garcia-Blanco, M.A.; Ooi, E.E. The 5′ and 3′ untranslated regions of the flaviviral genome. Viruses 2017, 9, 137. [Google Scholar] [CrossRef]
- Villordo, S.M.; Carballeda, J.M.; Filomatori, C.V.; Gamarnik, A.V. RNA structure duplications and flavivirus host adaptation. Trends Microbiol. 2016, 24, 270–283. [Google Scholar] [CrossRef] [PubMed]
- Zeng, M.; Duan, Y.; Zhang, W.; Wang, M.; Jia, R.; Zhu, D.; Liu, M.; Zhao, X.; Yang, Q.; Wu, Y.; et al. Universal RNA secondary structure insight into mosquito-borne flavivirus (MBFV) cis-acting RNA biology. Front. Microbiol. 2020, 11, 473. [Google Scholar] [CrossRef]
- Yun, S.I.; Song, B.H.; Frank, J.C.; Julander, J.G.; Olsen, A.L.; Polejaeva, I.A.; Davies, C.J.; White, K.L.; Lee, Y.M. Functional genomics and immunologic tools: The impact of viral and host genetic variations on the outcome of Zika virus infection. Viruses 2018, 10, 422. [Google Scholar] [CrossRef] [PubMed]
- Yun, S.I.; Lee, Y.M. Japanese encephalitis virus. In Encyclopedia of Virology, 4th ed.; Bamford, D., Zuckerman, M., Eds.; Academic Press: Cambridge, MA, USA, 2021; pp. 583–597. [Google Scholar]
- Bollati, M.; Alvarez, K.; Assenberg, R.; Baronti, C.; Canard, B.; Cook, S.; Coutard, B.; Decroly, E.; de Lamballerie, X.; Gould, E.A.; et al. Structure and functionality in flavivirus NS-proteins: Perspectives for drug design. Antiviral Res. 2010, 87, 125–148. [Google Scholar] [CrossRef]
- Brand, C.; Bisaillon, M.; Geiss, B.J. Organization of the flavivirus RNA replicase complex. Wiley Interdiscip. Rev. RNA 2017, 8, e1437. [Google Scholar] [CrossRef] [PubMed]
- Selisko, B.; Wang, C.; Harris, E.; Canard, B. Regulation of Flavivirus RNA synthesis and replication. Curr. Opin. Virol. 2014, 9, 74–83. [Google Scholar] [CrossRef] [PubMed]
- Diosa-Toro, M.; Prasanth, K.R.; Bradrick, S.S.; Garcia Blanco, M.A. Role of RNA-binding proteins during the late stages of Flavivirus replication cycle. Virol. J. 2020, 17, 60. [Google Scholar] [CrossRef] [PubMed]
- Murray, C.L.; Jones, C.T.; Rice, C.M. Architects of assembly: Roles of Flaviviridae non-structural proteins in virion morphogenesis. Nat. Rev. Microbiol. 2008, 6, 699–708. [Google Scholar] [CrossRef] [PubMed]
- Robertson, S.J.; Mitzel, D.N.; Taylor, R.T.; Best, S.M.; Bloom, M.E. Tick-borne flaviviruses: Dissecting host immune responses and virus countermeasures. Immunol. Res. 2009, 43, 172–186. [Google Scholar] [CrossRef]
- Morrison, J.; Aguirre, S.; Fernandez-Sesma, A. Innate immunity evasion by dengue virus. Viruses 2012, 4, 397–413. [Google Scholar] [CrossRef]
- Miorin, L.; Maestre, A.M.; Fernandez-Sesma, A.; Garcia-Sastre, A. Antagonism of type I interferon by flaviviruses. Biochem. Biophys. Res. Commun. 2017, 492, 587–596. [Google Scholar] [CrossRef] [PubMed]
- Gack, M.U.; Diamond, M.S. Innate immune escape by dengue and West Nile viruses. Curr. Opin. Virol. 2016, 20, 119–128. [Google Scholar] [CrossRef]
- Hasan, S.S.; Sevvana, M.; Kuhn, R.J.; Rossmann, M.G. Structural biology of Zika virus and other flaviviruses. Nat. Struct. Mol. Biol. 2018, 25, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, E.R.A.; Mohana-Borges, R.; de Alencastro, R.B.; Horta, B.A.C. The flavivirus capsid protein: Structure, function and perspectives towards drug design. Virus Res. 2017, 227, 115–123. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Lok, S.M.; Yu, I.M.; Zhang, Y.; Kuhn, R.J.; Chen, J.; Rossmann, M.G. The flavivirus precursor membrane-envelope protein complex: Structure and maturation. Science 2008, 319, 1830–1834. [Google Scholar] [CrossRef]
- Shang, Z.; Song, H.; Shi, Y.; Qi, J.; Gao, G.F. Crystal structure of the capsid protein from Zika virus. J. Mol. Biol. 2018, 430, 948–962. [Google Scholar] [CrossRef] [PubMed]
- Tan, T.Y.; Fibriansah, G.; Kostyuchenko, V.A.; Ng, T.S.; Lim, X.X.; Zhang, S.; Lim, X.N.; Wang, J.; Shi, J.; Morais, M.C.; et al. Capsid protein structure in Zika virus reveals the flavivirus assembly process. Nat. Commun. 2020, 11, 895. [Google Scholar] [CrossRef] [PubMed]
- Kostyuchenko, V.A.; Lim, E.X.; Zhang, S.; Fibriansah, G.; Ng, T.S.; Ooi, J.S.; Shi, J.; Lok, S.M. Structure of the thermally stable Zika virus. Nature 2016, 533, 425–428. [Google Scholar] [CrossRef] [PubMed]
- Sirohi, D.; Chen, Z.; Sun, L.; Klose, T.; Pierson, T.C.; Rossmann, M.G.; Kuhn, R.J. The 3.8 A resolution cryo-EM structure of Zika virus. Science 2016, 352, 467–470. [Google Scholar] [CrossRef] [PubMed]
- Nicholls, C.M.R.; Sevvana, M.; Kuhn, R.J. Structure-guided paradigm shifts in flavivirus assembly and maturation mechanisms. Adv. Virus Res. 2020, 108, 33–83. [Google Scholar] [PubMed]
- Zhang, X.; Jia, R.; Shen, H.; Wang, M.; Yin, Z.; Cheng, A. Structures and functions of the envelope glycoprotein in flavivirus infections. Viruses 2017, 9, 338. [Google Scholar] [CrossRef]
- Carro, S.D.; Cherry, S. Beyond the surface: Endocytosis of mosquito-borne flaviviruses. Viruses 2020, 13, 13. [Google Scholar] [CrossRef]
- Hurtado-Monzon, A.M.; Cordero-Rivera, C.D.; Farfan-Morales, C.N.; Osuna-Ramos, J.F.; De Jesus-Gonzalez, L.A.; Reyes-Ruiz, J.M.; Del Angel, R.M. The role of anti-flavivirus humoral immune response in protection and pathogenesis. Rev. Med. Virol. 2020, 30, e2100. [Google Scholar] [CrossRef] [PubMed]
- VanBlargan, L.A.; Goo, L.; Pierson, T.C. Deconstructing the antiviral neutralizing-antibody response: Implications for vaccine development and immunity. Microbiol. Mol. Biol. Rev. 2016, 80, 989–1010. [Google Scholar] [CrossRef]
- Dowd, K.A.; Ko, S.Y.; Morabito, K.M.; Yang, E.S.; Pelc, R.S.; DeMaso, C.R.; Castilho, L.R.; Abbink, P.; Boyd, M.; Nityanandam, R.; et al. Rapid development of a DNA vaccine for Zika virus. Science 2016, 354, 237–240. [Google Scholar] [CrossRef] [PubMed]
- Pardi, N.; Hogan, M.J.; Pelc, R.S.; Muramatsu, H.; Andersen, H.; DeMaso, C.R.; Dowd, K.A.; Sutherland, L.L.; Scearce, R.M.; Parks, R.; et al. Zika virus protection by a single low-dose nucleoside-modified mRNA vaccination. Nature 2017, 543, 248–251. [Google Scholar] [CrossRef] [PubMed]
- Betancourt, D.; de Queiroz, N.M.; Xia, T.; Ahn, J.; Barber, G.N. Cutting edge: Innate immune augmenting vesicular stomatitis virus expressing Zika virus proteins confers protective immunity. J. Immunol. 2017, 198, 3023–3028. [Google Scholar] [CrossRef] [PubMed]
- Cox, F.; van der Fits, L.; Abbink, P.; Larocca, R.A.; van Huizen, E.; Saeland, E.; Verhagen, J.; Peterson, R.; Tolboom, J.; Kaufmann, B.; et al. Adenoviral vector type 26 encoding Zika virus (ZIKV) M-Env antigen induces humoral and cellular immune responses and protects mice and nonhuman primates against ZIKV challenge. PLoS ONE 2018, 13, e0202820. [Google Scholar] [CrossRef] [PubMed]
- Emanuel, J.; Callison, J.; Dowd, K.A.; Pierson, T.C.; Feldmann, H.; Marzi, A. A VSV-based Zika virus vaccine protects mice from lethal challenge. Sci. Rep. 2018, 8, 11043. [Google Scholar] [CrossRef]
- Yi, G.; Xu, X.; Abraham, S.; Petersen, S.; Guo, H.; Ortega, N.; Shankar, P.; Manjunath, N. A DNA vaccine protects human immune cells against Zika virus infection in humanized mice. EBioMedicine 2017, 25, 87–94. [Google Scholar] [CrossRef] [PubMed]
- Larocca, R.A.; Abbink, P.; Peron, J.P.; Zanotto, P.M.; Iampietro, M.J.; Badamchi-Zadeh, A.; Boyd, M.; Ng’ang’a, D.; Kirilova, M.; Nityanandam, R.; et al. Vaccine protection against Zika virus from Brazil. Nature 2016, 536, 474–478. [Google Scholar] [CrossRef] [PubMed]
- Barba-Spaeth, G.; Dejnirattisai, W.; Rouvinski, A.; Vaney, M.C.; Medits, I.; Sharma, A.; Simon-Loriere, E.; Sakuntabhai, A.; Cao-Lormeau, V.M.; Haouz, A.; et al. Structural basis of potent Zika-dengue virus antibody cross-neutralization. Nature 2016, 536, 48–53. [Google Scholar] [CrossRef] [PubMed]
- Dai, L.; Song, J.; Lu, X.; Deng, Y.Q.; Musyoki, A.M.; Cheng, H.; Zhang, Y.; Yuan, Y.; Song, H.; Haywood, J.; et al. Structures of the Zika virus envelope protein and its complex with a flavivirus broadly protective antibody. Cell Host Microbe 2016, 19, 696–704. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Fernandez, E.; Dowd, K.A.; Speer, S.D.; Platt, D.J.; Gorman, M.J.; Govero, J.; Nelson, C.A.; Pierson, T.C.; Diamond, M.S.; et al. Structural basis of Zika virus-specific antibody protection. Cell 2016, 166, 1016–1027. [Google Scholar] [CrossRef] [PubMed]
- Tai, W.; He, L.; Wang, Y.; Sun, S.; Zhao, G.; Luo, C.; Li, P.; Zhao, H.; Fremont, D.H.; Li, F.; et al. Critical neutralizing fragment of Zika virus EDIII elicits cross-neutralization and protection against divergent Zika viruses. Emerg. Microbes Infect. 2018, 7, 7. [Google Scholar] [CrossRef]
- Wang, Q.; Yan, J.; Gao, G.F. Monoclonal antibodies against Zika virus: Therapeutics and their implications for vaccine design. J. Virol. 2017, 91, e01049-17. [Google Scholar] [CrossRef] [PubMed]
- Yun, S.I.; Song, B.H.; Polejaeva, I.A.; Davies, C.J.; White, K.L.; Lee, Y.M. Comparison of the live-attenuated Japanese encephalitis vaccine SA14-14-2 strain with its pre-attenuated virulent parent SA14 strain: Similarities and differences in vitro and in vivo. J. Gen. Virol. 2016, 97, 2575–2591. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y. Phenotypic and genotypic characteristics of Japanese encephalitis attenuated live vaccine virus SA14-14-2 and their stabilities. Vaccine 2010, 28, 3635–3641. [Google Scholar] [CrossRef] [PubMed]
- Yun, S.I.; Lee, Y.M. Japanese encephalitis: The virus and vaccines. Hum. Vaccin. Immunother. 2014, 10, 263–279. [Google Scholar] [CrossRef]
- Vannice, K.S.; Hills, S.L.; Schwartz, L.M.; Barrett, A.D.; Heffelfinger, J.; Hombach, J.; Letson, G.W.; Solomon, T.; Marfin, A.A.; Japanese encephalitis vaccination experts panel. The future of Japanese encephalitis vaccination: Expert recommendations for achieving and maintaining optimal JE control. NPJ Vaccines 2021, 6, 82. [Google Scholar] [CrossRef]
- Yun, S.I.; Song, B.H.; Kim, J.K.; Yun, G.N.; Lee, E.Y.; Li, L.; Kuhn, R.J.; Rossmann, M.G.; Morrey, J.D.; Lee, Y.M. A molecularly cloned, live-attenuated Japanese encephalitis vaccine SA14-14-2 virus: A conserved single amino acid in the ij hairpin of the viral E glycoprotein determines neurovirulence in mice. PLoS Pathog. 2014, 10, e1004290. [Google Scholar] [CrossRef] [PubMed]
- Petersen, T.N.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nat. Methods 2011, 8, 785–786. [Google Scholar] [CrossRef]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. WHO Reference Cell Banks (RCBs). Available online: https://www.who.int/teams/health-product-policy-and-standards/standards-and-specifications/norms-and-standards/who-reference-cell-banks (accessed on 2 October 2024).
- Alzahrani, N.; Wu, M.J.; Shanmugam, S.; Yi, M. Delayed by design: Role of suboptimal signal peptidase processing of viral structural protein precursors in Flaviviridae virus assembly. Viruses 2020, 12, 1090. [Google Scholar] [CrossRef] [PubMed]
- Carbaugh, D.L.; Lazear, H.M. Flavivirus envelope protein glycosylation: Impacts on viral infection and pathogenesis. J. Virol. 2020, 94, e00104-20. [Google Scholar] [CrossRef] [PubMed]
- Stephenson, K.E.; Tan, C.S.; Walsh, S.R.; Hale, A.; Ansel, J.L.; Kanjilal, D.G.; Jaegle, K.; Peter, L.; Borducchi, E.N.; Nkolola, J.P.; et al. Safety and immunogenicity of a Zika purified inactivated virus vaccine given via standard, accelerated, or shortened schedules: A single-centre, double-blind, sequential-group, randomised, placebo-controlled, phase 1 trial. Lancet Infect. Dis. 2020, 20, 1061–1070. [Google Scholar] [CrossRef] [PubMed]
- Modjarrad, K.; Lin, L.; George, S.L.; Stephenson, K.E.; Eckels, K.H.; De La Barrera, R.A.; Jarman, R.G.; Sondergaard, E.; Tennant, J.; Ansel, J.L.; et al. Preliminary aggregate safety and immunogenicity results from three trials of a purified inactivated Zika virus vaccine candidate: Phase 1, randomised, double-blind, placebo-controlled clinical trials. Lancet 2018, 391, 563–571. [Google Scholar] [CrossRef] [PubMed]
- Han, H.H.; Diaz, C.; Acosta, C.J.; Liu, M.; Borkowski, A. Safety and immunogenicity of a purified inactivated Zika virus vaccine candidate in healthy adults: An observer-blind, randomised, phase 1 trial. Lancet Infect. Dis. 2021, 21, 1282–1292. [Google Scholar] [CrossRef]
- Oh, H.S.; Yoon, J.W.; Lee, S.; Kim, S.O.; Hong, S.P. A purified inactivated vaccine derived from Vero cell-adapted Zika virus elicits protection in mice. Virology 2021, 560, 124–130. [Google Scholar] [CrossRef] [PubMed]
- Abbink, P.; Larocca, R.A.; De La Barrera, R.A.; Bricault, C.A.; Moseley, E.T.; Boyd, M.; Kirilova, M.; Li, Z.; Ng’ang’a, D.; Nanayakkara, O.; et al. Protective efficacy of multiple vaccine platforms against Zika virus challenge in rhesus monkeys. Science 2016, 353, 1129–1132. [Google Scholar] [CrossRef] [PubMed]
- Sumathy, K.; Kulkarni, B.; Gondu, R.K.; Ponnuru, S.K.; Bonguram, N.; Eligeti, R.; Gadiyaram, S.; Praturi, U.; Chougule, B.; Karunakaran, L.; et al. Protective efficacy of Zika vaccine in AG129 mouse model. Sci. Rep. 2017, 7, 46375. [Google Scholar] [CrossRef] [PubMed]
- Baldwin, W.R.; Livengood, J.A.; Giebler, H.A.; Stovall, J.L.; Boroughs, K.L.; Sonnberg, S.; Bohning, K.J.; Dietrich, E.A.; Ong, Y.T.; Danh, H.K.; et al. Purified inactivated Zika vaccine candidates afford protection against lethal challenge in mice. Sci. Rep. 2018, 8, 16509. [Google Scholar] [CrossRef]
- Lecouturier, V.; Bernard, M.C.; Berry, C.; Carayol, S.; Richier, E.; Boudet, F.; Heinrichs, J. Immunogenicity and protection conferred by an optimized purified inactivated Zika vaccine in mice. Vaccine 2019, 37, 2679–2686. [Google Scholar] [CrossRef] [PubMed]
- Lecouturier, V.; Pavot, V.; Berry, C.; Donadieu, A.; de Montfort, A.; Boudet, F.; Rokbi, B.; Jackson, N.; Heinrichs, J. An optimized purified inactivated Zika vaccine provides sustained immunogenicity and protection in cynomolgus macaques. NPJ Vaccines 2020, 5, 19. [Google Scholar] [CrossRef]
- Young, G.; Bohning, K.J.; Zahralban-Steele, M.; Hather, G.; Tadepalli, S.; Mickey, K.; Godin, C.S.; Sanisetty, S.; Sonnberg, S.; Patel, H.K.; et al. Complete protection in macaques conferred by purified inactivated Zika vaccine: Defining a correlate of protection. Sci. Rep. 2020, 10, 3488. [Google Scholar] [CrossRef]
- Abbink, P.; Larocca, R.A.; Visitsunthorn, K.; Boyd, M.; De La Barrera, R.A.; Gromowski, G.D.; Kirilova, M.; Peterson, R.; Li, Z.; Nanayakkara, O.; et al. Durability and correlates of vaccine protection against Zika virus in rhesus monkeys. Sci. Transl. Med. 2017, 9, eaao4163. [Google Scholar] [CrossRef]
- Shan, C.; Muruato, A.E.; Nunes, B.T.D.; Luo, H.; Xie, X.; Medeiros, D.B.A.; Wakamiya, M.; Tesh, R.B.; Barrett, A.D.; Wang, T.; et al. A live-attenuated Zika virus vaccine candidate induces sterilizing immunity in mouse models. Nat. Med. 2017, 23, 763–767. [Google Scholar] [CrossRef] [PubMed]
- Ye, X.; Liu, X.; Shu, T.; Deng, W.; Liao, M.; Zheng, Y.; Zheng, X.; Zhang, X.; Li, T.; Fan, W.; et al. A live-attenuated Zika virus vaccine with high production capacity confers effective protection in neonatal mice. J. Virol. 2021, 95, e0038321. [Google Scholar] [CrossRef] [PubMed]
- Shan, C.; Muruato, A.E.; Jagger, B.W.; Richner, J.; Nunes, B.T.D.; Medeiros, D.B.A.; Xie, X.; Nunes, J.G.C.; Morabito, K.M.; Kong, W.P.; et al. A single-dose live-attenuated vaccine prevents Zika virus pregnancy transmission and testis damage. Nat. Commun. 2017, 8, 676. [Google Scholar] [CrossRef]
- Richner, J.M.; Jagger, B.W.; Shan, C.; Fontes, C.R.; Dowd, K.A.; Cao, B.; Himansu, S.; Caine, E.A.; Nunes, B.T.D.; Medeiros, D.B.A.; et al. Vaccine mediated protection against Zika virus-induced congenital disease. Cell 2017, 170, 273–283.e12. [Google Scholar] [CrossRef]
- Xie, X.; Kum, D.B.; Xia, H.; Luo, H.; Shan, C.; Zou, J.; Muruato, A.E.; Medeiros, D.B.A.; Nunes, B.T.D.; Dallmeier, K.; et al. A single-dose live-attenuated Zika virus vaccine with controlled infection rounds that protects against vertical transmission. Cell Host Microbe 2018, 24, 487–499.e5. [Google Scholar] [CrossRef] [PubMed]
- Dai, L.; Xu, K.; Li, J.; Huang, Q.; Song, J.; Han, Y.; Zheng, T.; Gao, P.; Lu, X.; Yang, H.; et al. Protective Zika vaccines engineered to eliminate enhancement of dengue infection via immunodominance switch. Nat. Immunol. 2021, 22, 958–968. [Google Scholar] [CrossRef] [PubMed]
- Bullard, B.L.; Corder, B.N.; Gorman, M.J.; Diamond, M.S.; Weaver, E.A. Efficacy of a T cell-biased adenovirus vector as a Zika virus vaccine. Sci. Rep. 2018, 8, 18017. [Google Scholar] [CrossRef]
- Guo, Q.; Chan, J.F.; Poon, V.K.; Wu, S.; Chan, C.C.; Hou, L.; Yip, C.C.; Ren, C.; Cai, J.P.; Zhao, M.; et al. Immunization with a novel human type 5 adenovirus-vectored vaccine expressing the premembrane and envelope proteins of Zika virus provides consistent and sterilizing protection in multiple immunocompetent and immunocompromised animal models. J. Infect. Dis. 2018, 218, 365–377. [Google Scholar] [CrossRef] [PubMed]
- Steffen, T.; Hassert, M.; Hoft, S.G.; Stone, E.T.; Zhang, J.; Geerling, E.; Grimberg, B.T.; Roberts, M.S.; Pinto, A.K.; Brien, J.D. Immunogenicity and efficacy of a recombinant human adenovirus type 5 vaccine against Zika virus. Vaccines 2020, 8, 170. [Google Scholar] [CrossRef]
- Salisch, N.C.; Stephenson, K.E.; Williams, K.; Cox, F.; van der Fits, L.; Heerwegh, D.; Truyers, C.; Habets, M.N.; Kanjilal, D.G.; Larocca, R.A.; et al. A double-blind, randomized, placebo-controlled phase 1 study of Ad26.ZIKV.001, an Ad26-vectored anti-Zika virus vaccine. Ann. Intern. Med. 2021, 174, 585–594. [Google Scholar] [CrossRef] [PubMed]
- Prow, N.A.; Liu, L.; McCarthy, M.K.; Walters, K.; Kalkeri, R.; Geiger, J.; Koide, F.; Cooper, T.H.; Eldi, P.; Nakayama, E.; et al. The vaccinia virus based Sementis Copenhagen vector vaccine against Zika and chikungunya is immunogenic in non-human primates. NPJ Vaccines 2020, 5, 44. [Google Scholar] [CrossRef] [PubMed]
- Prow, N.A.; Liu, L.; Nakayama, E.; Cooper, T.H.; Yan, K.; Eldi, P.; Hazlewood, J.E.; Tang, B.; Le, T.T.; Setoh, Y.X.; et al. A vaccinia-based single vector construct multi-pathogen vaccine protects against both Zika and chikungunya viruses. Nat. Commun. 2018, 9, 1230. [Google Scholar] [CrossRef]
- Perez, P.; Marín, Q.M.; Lazaro-Frias, A.; Jimenez de Oya, N.; Blazquez, A.B.; Escribano-Romero, E.; CO, S.S.; Ortego, J.; Saiz, J.C.; Esteban, M.; et al. A vaccine based on a modified vaccinia virus Ankara vector expressing Zika virus structural proteins controls Zika virus replication in mice. Sci. Rep. 2018, 8, 17385. [Google Scholar] [CrossRef] [PubMed]
- Brault, A.C.; Domi, A.; McDonald, E.M.; Talmi-Frank, D.; McCurley, N.; Basu, R.; Robinson, H.L.; Hellerstein, M.; Duggal, N.K.; Bowen, R.A.; et al. A Zika vaccine targeting NS1 protein protects immunocompetent adult mice in a lethal challenge model. Sci. Rep. 2017, 7, 14769. [Google Scholar] [CrossRef]
- Li, A.; Yu, J.; Lu, M.; Ma, Y.; Attia, Z.; Shan, C.; Xue, M.; Liang, X.; Craig, K.; Makadiya, N.; et al. A Zika virus vaccine expressing premembrane-envelope-NS1 polyprotein. Nat. Commun. 2018, 9, 3067. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Qu, L.; Ye, X.; Yi, C.; Zheng, X.; Hao, M.; Su, W.; Yao, Z.; Chen, P.; Zhang, S.; et al. Incorporation of NS1 and prM/M are important to confer effective protection of adenovirus-vectored Zika virus vaccine carrying E protein. NPJ Vaccines 2018, 3, 29. [Google Scholar] [CrossRef] [PubMed]
- Li, X.F.; Dong, H.L.; Wang, H.J.; Huang, X.Y.; Qiu, Y.F.; Ji, X.; Ye, Q.; Li, C.; Liu, Y.; Deng, Y.Q.; et al. Development of a chimeric Zika vaccine using a licensed live-attenuated flavivirus vaccine as backbone. Nat. Commun. 2018, 9, 673. [Google Scholar] [CrossRef]
- Xie, X.; Yang, Y.; Muruato, A.E.; Zou, J.; Shan, C.; Nunes, B.T.; Medeiros, D.B.; Vasconcelos, P.F.; Weaver, S.C.; Rossi, S.L.; et al. Understanding Zika virus stability and developing a chimeric vaccine through functional analysis. mBio 2017, 8, e02134-16. [Google Scholar] [CrossRef] [PubMed]
- Chin, W.X.; Lee, R.C.H.; Kaur, P.; Lew, T.S.; Yogarajah, T.; Kong, H.Y.; Teo, Z.Y.; Salim, C.K.; Zhang, R.R.; Li, X.F.; et al. A single-dose live attenuated chimeric vaccine candidate against Zika virus. NPJ Vaccines 2021, 6, 20. [Google Scholar] [CrossRef] [PubMed]
- Xu, K.; Song, Y.; Dai, L.; Zhang, Y.; Lu, X.; Xie, Y.; Zhang, H.; Cheng, T.; Wang, Q.; Huang, Q.; et al. Recombinant chimpanzee adenovirus vaccine AdC7-M/E protects against Zika virus infection and testis damage. J. Virol. 2018, 92, e01722-17. [Google Scholar] [CrossRef]
- Lopez-Camacho, C.; Abbink, P.; Larocca, R.A.; Dejnirattisai, W.; Boyd, M.; Badamchi-Zadeh, A.; Wallace, Z.R.; Doig, J.; Velazquez, R.S.; Neto, R.D.L.; et al. Rational Zika vaccine design via the modulation of antigen membrane anchors in chimpanzee adenoviral vectors. Nat. Commun. 2018, 9, 2441. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Hu, J.; Guo, J.; Wu, C.; Xiong, S.; Dong, C. A vesicular stomatitis virus-based vaccine carrying Zika virus capsid protein protects mice from viral infection. Virol. Sin. 2019, 34, 106–110. [Google Scholar] [CrossRef] [PubMed]
- Touret, F.; Gilles, M.; Klitting, R.; Aubry, F.; de Lamballerie, X.; Nougairede, A. Live Zika virus chimeric vaccine candidate based on a yellow fever 17-D attenuated backbone. Emerg. Microbes Infect. 2018, 7, 161. [Google Scholar] [CrossRef] [PubMed]
- Giel-Moloney, M.; Goncalvez, A.P.; Catalan, J.; Lecouturier, V.; Girerd-Chambaz, Y.; Diaz, F.; Maldonado-Arocho, F.; Gomila, R.C.; Bernard, M.C.; Oomen, R.; et al. Chimeric yellow fever 17D-Zika virus (ChimeriVax-Zika) as a live-attenuated Zika virus vaccine. Sci. Rep. 2018, 8, 13206. [Google Scholar] [CrossRef]
- Hobson-Peters, J.; Harrison, J.J.; Watterson, D.; Hazlewood, J.E.; Vet, L.J.; Newton, N.D.; Warrilow, D.; Colmant, A.M.G.; Taylor, C.; Huang, B.; et al. A recombinant platform for flavivirus vaccines and diagnostics using chimeras of a new insect-specific virus. Sci. Transl. Med. 2019, 11, eaax7888. [Google Scholar] [CrossRef]
- Hazlewood, J.E.; Rawle, D.J.; Tang, B.; Yan, K.; Vet, L.J.; Nakayama, E.; Hobson-Peters, J.; Hall, R.A.; Suhrbier, A. A Zika vaccine generated using the chimeric insect-specific Binjari virus platform protects against fetal brain infection in pregnant mice. Vaccines 2020, 8, 496. [Google Scholar] [CrossRef] [PubMed]
- Hazlewood, J.E.; Tang, B.; Yan, K.; Rawle, D.J.; Harrison, J.J.; Hall, R.A.; Hobson-Peters, J.; Suhrbier, A. The chimeric Binjari-Zika vaccine provides long-term protection against ZIKA virus challenge. Vaccines 2022, 10, 85. [Google Scholar] [CrossRef]
- Tebas, P.; Roberts, C.C.; Muthumani, K.; Reuschel, E.L.; Kudchodkar, S.B.; Zaidi, F.I.; White, S.; Khan, A.S.; Racine, T.; Choi, H.; et al. Safety and immunogenicity of an anti-Zika virus DNA vaccine. N. Engl. J. Med. 2021, 385, e35. [Google Scholar] [CrossRef]
- Gaudinski, M.R.; Houser, K.V.; Morabito, K.M.; Hu, Z.; Yamshchikov, G.; Rothwell, R.S.; Berkowitz, N.; Mendoza, F.; Saunders, J.G.; Novik, L.; et al. Safety, tolerability, and immunogenicity of two Zika virus DNA vaccine candidates in healthy adults: Randomised, open-label, phase 1 clinical trials. Lancet 2018, 391, 552–562. [Google Scholar] [CrossRef]
- In, H.J.; Lee, Y.H.; Jang, S.; Lim, H.J.; Kim, M.Y.; Kim, J.A.; Yoo, J.S.; Chung, G.T.; Kim, Y.J. Enhanced effect of modified Zika virus E antigen on the immunogenicity of DNA vaccine. Virology 2020, 549, 25–31. [Google Scholar] [CrossRef]
- Grubor-Bauk, B.; Wijesundara, D.K.; Masavuli, M.; Abbink, P.; Peterson, R.L.; Prow, N.A.; Larocca, R.A.; Mekonnen, Z.A.; Shrestha, A.; Eyre, N.S.; et al. NS1 DNA vaccination protects against Zika infection through T cell-mediated immunity in immunocompetent mice. Sci. Adv. 2019, 5, eaax2388. [Google Scholar] [CrossRef]
- Bailey, M.J.; Broecker, F.; Duehr, J.; Arumemi, F.; Krammer, F.; Palese, P.; Tan, G.S. Antibodies elicited by an NS1-based vaccine protect mice against Zika virus. mBio 2019, 10, e02861-18. [Google Scholar] [CrossRef] [PubMed]
- Muthumani, K.; Griffin, B.D.; Agarwal, S.; Kudchodkar, S.B.; Reuschel, E.L.; Choi, H.; Kraynyak, K.A.; Duperret, E.K.; Keaton, A.A.; Chung, C.; et al. In vivo protection against ZIKV infection and pathogenesis through passive antibody transfer and active immunisation with a prMEnv DNA vaccine. NPJ Vaccines 2016, 1, 16021. [Google Scholar] [CrossRef]
- Griffin, B.D.; Muthumani, K.; Warner, B.M.; Majer, A.; Hagan, M.; Audet, J.; Stein, D.R.; Ranadheera, C.; Racine, T.; De La Vega, M.A.; et al. DNA vaccination protects mice against Zika virus-induced damage to the testes. Nat. Commun. 2017, 8, 15743. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Liao, X.; Fan, D.; Wang, L.; Song, J.; Feng, K.; Li, M.; Wang, P.; Chen, H.; An, J. Maternal immunization with a DNA vaccine candidate elicits specific passive protection against post-natal Zika virus infection in immunocompetent BALB/c mice. Vaccine 2018, 36, 3522–3532. [Google Scholar] [CrossRef] [PubMed]
- de La Vega, M.A.; Piret, J.; Griffin, B.D.; Rheaume, C.; Venable, M.C.; Carbonneau, J.; Couture, C.; das Neves Almeida, R.; Tremblay, R.R.; Magalhaes, K.G.; et al. Zika-induced male infertility in mice is potentially reversible and preventable by deoxyribonucleic acid immunization. J. Infect. Dis. 2019, 219, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Hraber, P.; Bradfute, S.; Clarke, E.; Ye, C.; Pitard, B. Amphiphilic block copolymer delivery of a DNA vaccine against Zika virus. Vaccine 2018, 36, 6911–6917. [Google Scholar] [CrossRef] [PubMed]
- Richner, J.M.; Himansu, S.; Dowd, K.A.; Butler, S.L.; Salazar, V.; Fox, J.M.; Julander, J.G.; Tang, W.W.; Shresta, S.; Pierson, T.C.; et al. Modified mRNA vaccines protect against Zika virus infection. Cell 2017, 168, 1114–1125.e10. [Google Scholar] [CrossRef]
- Medina-Magues, L.G.; Gergen, J.; Jasny, E.; Petsch, B.; Lopera-Madrid, J.; Medina-Magues, E.S.; Salas-Quinchucua, C.; Osorio, J.E. mRNA vaccine protects against Zika virus. Vaccines 2021, 9, 1464. [Google Scholar] [CrossRef] [PubMed]
- Luisi, K.; Morabito, K.M.; Burgomaster, K.E.; Sharma, M.; Kong, W.P.; Foreman, B.M.; Patel, S.; Fisher, B.; Aleshnick, M.A.; Laliberte, J.; et al. Development of a potent Zika virus vaccine using self-amplifying messenger RNA. Sci. Adv. 2020, 6, eaba5068. [Google Scholar] [CrossRef]
- Zhong, Z.; Portela Catani, J.P.; Mc Cafferty, S.; Couck, L.; Van Den Broeck, W.; Gorle, N.; Vandenbroucke, R.E.; Devriendt, B.; Ulbert, S.; Cnops, L.; et al. Immunogenicity and protection efficacy of a naked self-replicating mRNA-based Zika virus vaccine. Vaccines 2019, 7, 96. [Google Scholar] [CrossRef]
- Liang, H.; Yang, R.; Liu, Z.; Li, M.; Liu, H.; Jin, X. Recombinant Zika virus envelope protein elicited protective immunity against Zika virus in immunocompetent mice. PLoS ONE 2018, 13, e0194860. [Google Scholar] [CrossRef]
- Qu, P.; Zhang, W.; Li, D.; Zhang, C.; Liu, Q.; Zhang, X.; Wang, X.; Dai, W.; Xu, Y.; Leng, Q.; et al. Insect cell-produced recombinant protein subunit vaccines protect against Zika virus infection. Antiviral Res. 2018, 154, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Cibulski, S.; Varela, A.P.M.; Teixeira, T.F.; Cancela, M.P.; Sesterheim, P.; Souza, D.O.; Roehe, P.M.; Silveira, F. Zika virus envelope domain III recombinant protein delivered with saponin-based nanoadjuvant from Quillaja brasiliensis enhances anti-Zika immune responses, including neutralizing antibodies and splenocyte proliferation. Front. Immunol. 2021, 12, 632714. [Google Scholar] [CrossRef]
- Yang, M.; Sun, H.; Lai, H.; Hurtado, J.; Chen, Q. Plant-produced Zika virus envelope protein elicits neutralizing immune responses that correlate with protective immunity against Zika virus in mice. Plant Biotechnol. J. 2018, 16, 572–580. [Google Scholar] [CrossRef] [PubMed]
- To, A.; Medina, L.O.; Mfuh, K.O.; Lieberman, M.M.; Wong, T.A.S.; Namekar, M.; Nakano, E.; Lai, C.Y.; Kumar, M.; Nerurkar, V.R.; et al. Recombinant Zika virus subunits are immunogenic and efficacious in mice. mSphere 2018, 3, e00576-17. [Google Scholar] [CrossRef] [PubMed]
- Medina, L.O.; To, A.; Lieberman, M.M.; Wong, T.A.S.; Namekar, M.; Nakano, E.; Andersen, H.; Yalley-Ogunro, J.; Greenhouse, J.; Higgs, S.; et al. A recombinant subunit based Zika virus vaccine is efficacious in non-human primates. Front. Immunol. 2018, 9, 2464. [Google Scholar] [CrossRef]
- Yang, M.; Dent, M.; Lai, H.; Sun, H.; Chen, Q. Immunization of Zika virus envelope protein domain III induces specific and neutralizing immune responses against Zika virus. Vaccine 2017, 35, 4287–4294. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Li, C.; Afridi, S.K.; Zu, S.; Xu, J.W.; Quanquin, N.; Yang, H.; Cheng, G.; Xu, Z. E90 subunit vaccine protects mice from Zika virus infection and microcephaly. Acta Neuropathol. Commun. 2018, 6, 77. [Google Scholar] [CrossRef]
- Han, J.F.; Qiu, Y.; Yu, J.Y.; Wang, H.J.; Deng, Y.Q.; Li, X.F.; Zhao, H.; Sun, H.X.; Qin, C.F. Immunization with truncated envelope protein of Zika virus induces protective immune response in mice. Sci. Rep. 2017, 7, 10047. [Google Scholar] [CrossRef] [PubMed]
- Boigard, H.; Alimova, A.; Martin, G.R.; Katz, A.; Gottlieb, P.; Galarza, J.M. Zika virus-like particle (VLP) based vaccine. PLoS Negl. Trop. Dis. 2017, 11, e0005608. [Google Scholar] [CrossRef]
- Vang, L.; Morello, C.S.; Mendy, J.; Thompson, D.; Manayani, D.; Guenther, B.; Julander, J.; Sanford, D.; Jain, A.; Patel, A.; et al. Zika virus-like particle vaccine protects AG129 mice and rhesus macaques against Zika virus. PLoS Negl. Trop. Dis. 2021, 15, e0009195. [Google Scholar] [CrossRef]
- Cimica, V.; Williams, S.; Adams-Fish, D.; McMahon, C.; Narayanan, A.; Rashid, S.; Stedman, T.T. Zika virus-like particle (VLP) vaccine displaying envelope (E) protein CD loop antigen elicits protective and specific immune response in a murine model. Biochem. Biophys. Res. Commun. 2020, 529, 805–811. [Google Scholar] [CrossRef] [PubMed]
- Espinosa, D.; Mendy, J.; Manayani, D.; Vang, L.; Wang, C.; Richard, T.; Guenther, B.; Aruri, J.; Avanzini, J.; Garduno, F.; et al. Passive transfer of immune sera induced by a Zika virus-like particle vaccine protects AG129 mice against lethal Zika virus challenge. eBioMedicine 2018, 27, 61–70. [Google Scholar] [CrossRef] [PubMed]
- Dai, S.; Zhang, T.; Zhang, Y.; Wang, H.; Deng, F. Zika virus baculovirus-expressed virus-like particles induce neutralizing antibodies in mice. Virol. Sin. 2018, 33, 213–226. [Google Scholar] [CrossRef]
- Yang, M.; Lai, H.; Sun, H.; Chen, Q. Virus-like particles that display Zika virus envelope protein domain III induce potent neutralizing immune responses in mice. Sci. Rep. 2017, 7, 7679. [Google Scholar] [CrossRef]
- Kozak, M.; Hu, J. The integrated consideration of vaccine platforms, adjuvants, and delivery routes for successful vaccine development. Vaccines 2023, 11, 695. [Google Scholar] [CrossRef] [PubMed]
- Pollard, A.J.; Bijker, E.M. A guide to vaccinology: From basic principles to new developments. Nat. Rev. Immunol. 2021, 21, 83–100. [Google Scholar] [CrossRef]
- Lai, C.J.; Monath, T.P. Chimeric flaviviruses: Novel vaccines against dengue fever, tick-borne encephalitis, and Japanese encephalitis. Adv. Virus Res. 2003, 61, 469–509. [Google Scholar] [PubMed]
- Zhang, R.; Miner, J.J.; Gorman, M.J.; Rausch, K.; Ramage, H.; White, J.P.; Zuiani, A.; Zhang, P.; Fernandez, E.; Zhang, Q.; et al. A CRISPR screen defines a signal peptide processing pathway required by flaviviruses. Nature 2016, 535, 164–168. [Google Scholar] [CrossRef]
- Chambers, T.J.; Hahn, C.S.; Galler, R.; Rice, C.M. Flavivirus genome organization, expression, and replication. Annu. Rev. Microbiol. 1990, 44, 649–688. [Google Scholar] [CrossRef] [PubMed]
- Carbaugh, D.L.; Baric, R.S.; Lazear, H.M. Envelope protein glycosylation mediates Zika virus pathogenesis. J. Virol. 2019, 93, e00113-19. [Google Scholar] [CrossRef] [PubMed]
- Mossenta, M.; Marchese, S.; Poggianella, M.; Slon Campos, J.L.; Burrone, O.R. Role of N-glycosylation on Zika virus E protein secretion, viral assembly and infectivity. Biochem. Biophys. Res. Commun. 2017, 492, 579–586. [Google Scholar] [CrossRef] [PubMed]
- Fontes-Garfias, C.R.; Shan, C.; Luo, H.; Muruato, A.E.; Medeiros, D.B.A.; Mays, E.; Xie, X.; Zou, J.; Roundy, C.M.; Wakamiya, M.; et al. Functional analysis of glycosylation of Zika virus envelope protein. Cell Rep. 2017, 21, 1180–1190. [Google Scholar] [CrossRef]
- Routhu, N.K.; Lehoux, S.D.; Rouse, E.A.; Bidokhti, M.R.M.; Giron, L.B.; Anzurez, A.; Reid, S.P.; Abdel-Mohsen, M.; Cummings, R.D.; Byrareddy, S.N. Glycosylation of Zika virus is important in host-virus interaction and pathogenic potential. Int. J. Mol. Sci. 2019, 20, 5206. [Google Scholar] [CrossRef] [PubMed]
- Gong, D.; Zhang, T.H.; Zhao, D.; Du, Y.; Chapa, T.J.; Shi, Y.; Wang, L.; Contreras, D.; Zeng, G.; Shi, P.Y.; et al. High-throughput fitness profiling of Zika virus E protein reveals different roles for glycosylation during infection of mammalian and mosquito cells. iScience 2018, 1, 97–111. [Google Scholar] [CrossRef] [PubMed]
- Annamalai, A.S.; Pattnaik, A.; Sahoo, B.R.; Muthukrishnan, E.; Natarajan, S.K.; Steffen, D.; Vu, H.L.X.; Delhon, G.; Osorio, F.A.; Petro, T.M.; et al. Zika virus encoding nonglycosylated envelope protein is attenuated and defective in neuroinvasion. J. Virol. 2017, 91, e01348-17. [Google Scholar] [CrossRef]
- Yun, S.I.; Kim, S.Y.; Rice, C.M.; Lee, Y.M. Development and application of a reverse genetics system for Japanese encephalitis virus. J. Virol. 2003, 77, 6450–6465. [Google Scholar] [CrossRef]
- Kim, J.K.; Kim, J.M.; Song, B.H.; Yun, S.I.; Yun, G.N.; Byun, S.J.; Lee, Y.M. Profiling of viral proteins expressed from the genomic RNA of Japanese encephalitis virus using a panel of 15 region-specific polyclonal rabbit antisera: Implications for viral gene expression. PLoS ONE 2015, 10, e0124318. [Google Scholar] [CrossRef] [PubMed]
Oligonucleotide | Sequence (5’→3’) | Direction |
Vector-1F | GGCATACCCCGCGTATTCCCACTA | Forward |
MR-2R | TCTAGTGATCTCTGCGGCTCCTGCACAAGCTATGACA | Reverse |
MR-3F | GCTTGTGCAGGAGCCGCAGAGATCACTAGACGCGGGA | Forward |
MR-4R | GCAAATATTTATACCTATCCACCCAGGCTTCCACGTCGTTGTGCACGAAGATGCCACTTCCACATCTCATCTCTTTTCTTGTGATGTCAATGGCACATCCAGTGTCAGCAGAAACAGCCGTGGAGAGGAAGATCAT | Reverse |
P6-2R | TCTGGTGACCTCCACGGCTCCTGCACAAGCTATGACA | Reverse |
P6-3F | GCTTGTGCAGGAGCCGTGGAGGTCACCAGACGTGGGA | Forward |
P6-4R | GCAAATATTTATACCTATCCACCCAGGCTTCCACGTCGTTGTGCACGAAGATGCCACTTCCACATCTCATCTCTTTTCTTGTGATGTCAATGGCACATCCAGTGTCAGCAGAGACGGCTGTAGATAGGAAGATCAA | Reverse |
PRVABC-2R | TCTAGTGACCTCCGCGGCTCCTGCACAAGCTATGACA | Reverse |
PRVABC-3F | GCTTGTGCAGGAGCCGCGGAGGTCACTAGACGTGGGA | Forward |
PRVABC-4R | GCAAATATTTATACCTATCCACCCAGGCTTCCACGTCGTTGTGCACGAAGATGCCACTTCCACATCTCATCTCTTTTCTTGTGATGTCAATGGCACATCCAGTGTCAGCAGAGACGGCTGTGGATAAGAAGATCAA | Reverse |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, B.-H.; Frank, J.C.; Yun, S.-I.; Julander, J.G.; Mason, J.B.; Polejaeva, I.A.; Davies, C.J.; White, K.L.; Dai, X.; Lee, Y.-M. Comparison of Three Chimeric Zika Vaccine Prototypes Developed on the Genetic Background of the Clinically Proven Live-Attenuated Japanese Encephalitis Vaccine SA14-14-2. Int. J. Mol. Sci. 2025, 26, 195. https://doi.org/10.3390/ijms26010195
Song B-H, Frank JC, Yun S-I, Julander JG, Mason JB, Polejaeva IA, Davies CJ, White KL, Dai X, Lee Y-M. Comparison of Three Chimeric Zika Vaccine Prototypes Developed on the Genetic Background of the Clinically Proven Live-Attenuated Japanese Encephalitis Vaccine SA14-14-2. International Journal of Molecular Sciences. 2025; 26(1):195. https://doi.org/10.3390/ijms26010195
Chicago/Turabian StyleSong, Byung-Hak, Jordan C. Frank, Sang-Im Yun, Justin G. Julander, Jeffrey B. Mason, Irina A. Polejaeva, Christopher J. Davies, Kenneth L. White, Xin Dai, and Young-Min Lee. 2025. "Comparison of Three Chimeric Zika Vaccine Prototypes Developed on the Genetic Background of the Clinically Proven Live-Attenuated Japanese Encephalitis Vaccine SA14-14-2" International Journal of Molecular Sciences 26, no. 1: 195. https://doi.org/10.3390/ijms26010195
APA StyleSong, B.-H., Frank, J. C., Yun, S.-I., Julander, J. G., Mason, J. B., Polejaeva, I. A., Davies, C. J., White, K. L., Dai, X., & Lee, Y.-M. (2025). Comparison of Three Chimeric Zika Vaccine Prototypes Developed on the Genetic Background of the Clinically Proven Live-Attenuated Japanese Encephalitis Vaccine SA14-14-2. International Journal of Molecular Sciences, 26(1), 195. https://doi.org/10.3390/ijms26010195