Mitophagy Regulates the Circadian Rhythms by Degrading NR1D1 in Simulated Microgravity and Isolation Environments
Abstract
1. Introduction
2. Results
2.1. TSI Environment Reduces the Amplitude of Circadian Rhythms of Rats
2.2. TSI Environment Leads to the Aberrant Expression of NR1D1 and BMAL1 in SCN Tissues
2.3. Autophagy Degrades NR1D1 through Directly Binding to Its LIR Motifs
2.4. TSI Environment Causes Mitochondrial Dysfunction and Mitophagy Deficiency in Neurons of SCN
2.5. UA Ameliorates the Disturbance of SCN Rhythms
2.6. UA Mitigates SCN Rhythm Disruption and Mitochondrial Dysfunction through Activating Mitophagy
3. Discussion
4. Materials and Methods
4.1. Animals and Cell Lines
4.2. VitalViewTM Data-Acquisition System and Tail-Suspension-and-Isolation (TSI) Model
4.3. Reagents and UA Administration
4.4. Immunofluorescence Microscopy
4.5. SCN Sections Immunofluorescence Microscopy
4.6. Real-Time PCR
4.7. Western Blotting
4.8. Immunoprecipitation
4.9. Transmission Electron Microscopy
4.10. SiRNA Transient Transfection
4.11. Plasmids
4.12. The T-SOD and MDA Activity of SCN
4.13. Statistical and Rhythms Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- da Silveira, W.A.; Fazelinia, H.; Rosenthal, S.B.; Laiakis, E.C.; Kim, M.S.; Meydan, C.; Kidane, Y.; Rathi, K.S.; Smith, S.M.; Stear, B.; et al. Comprehensive Multi-omics Analysis Reveals Mitochondrial Stress as a Central Biological Hub for Spaceflight Impact. Cell 2020, 183, 1185–1201.e20. [Google Scholar] [CrossRef] [PubMed]
- Hirayama, J.; Hattori, A.; Takahashi, A.; Furusawa, Y.; Tabuchi, Y.; Shibata, M.; Nagamatsu, A.; Yano, S.; Maruyama, Y.; Matsubara, H.; et al. Physiological consequences of space flight, including abnormal bone metabolism, space radiation injury, and circadian clock dysregulation: Implications of melatonin use and regulation as a countermeasure. J. Pineal Res. 2023, 74, e12834. [Google Scholar] [CrossRef] [PubMed]
- Wu, B.; Wang, Y.; Wu, X.; Liu, D.; Xu, D.; Wang, F. On-orbit sleep problems of astronauts and countermeasures. Mil. Med. Res. 2018, 5, 17. [Google Scholar] [CrossRef] [PubMed]
- Mendt, S.; Gunga, H.C.; Felsenberg, D.; Belavy, D.L.; Steinach, M.; Stahn, A.C. Regular exercise counteracts circadian shifts in core body temperature during long-duration bed rest. NPJ Microgravity 2021, 7, 1. [Google Scholar] [CrossRef] [PubMed]
- Patke, A.; Young, M.W.; Axelrod, S. Molecular mechanisms and physiological importance of circadian rhythms. Nat. Rev. Mol. Cell Biol. 2020, 21, 67–84. [Google Scholar] [CrossRef] [PubMed]
- Masri, S.; Sassone-Corsi, P. The emerging link between cancer, metabolism, and circadian rhythms. Nat. Med. 2018, 24, 1795–1803. [Google Scholar] [CrossRef] [PubMed]
- de Goede, P.; Wefers, J.; Brombacher, E.C.; Schrauwen, P.; Kalsbeek, A. Circadian rhythms in mitochondrial respiration. J. Mol. Endocrinol. 2018, 60, R115–R130. [Google Scholar] [CrossRef]
- Curtis, A.M.; Bellet, M.M.; Sassone-Corsi, P.; O’Neill, L.A. Circadian clock proteins and immunity. Immunity 2014, 40, 178–186. [Google Scholar] [CrossRef] [PubMed]
- Tamaru, T.; Hattori, M.; Honda, K.; Nakahata, Y.; Sassone-Corsi, P.; van der Horst, G.T.; Ozawa, T.; Takamatsu, K. CRY Drives Cyclic CK2-Mediated BMAL1 Phosphorylation to Control the Mammalian Circadian Clock. PLoS Biol. 2015, 13, e1002293. [Google Scholar] [CrossRef]
- Toledo, M.; Batista-Gonzalez, A.; Merheb, E.; Aoun, M.L.; Tarabra, E.; Feng, D.; Sarparanta, J.; Merlo, P.; Botre, F.; Schwartz, G.J.; et al. Autophagy Regulates the Liver Clock and Glucose Metabolism by Degrading CRY1. Cell Metab. 2018, 28, 268–281.e4. [Google Scholar] [CrossRef]
- Wang, S.; Li, F.; Lin, Y.; Wu, B. Targeting REV-ERBα for therapeutic purposes: Promises and challenges. Theranostics 2020, 10, 4168–4182. [Google Scholar] [CrossRef] [PubMed]
- Gerhart-Hines, Z.; Feng, D.; Emmett, M.J.; Everett, L.J.; Loro, E.; Briggs, E.R.; Bugge, A.; Hou, C.; Ferrara, C.; Seale, P.; et al. The nuclear receptor Rev-erbα controls circadian thermogenic plasticity. Nature 2013, 503, 410–413. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.; Chen, L.; Grant, G.R.; Paschos, G.; Song, W.L.; Musiek, E.S.; Lee, V.; McLoughlin, S.C.; Grosser, T.; Cotsarelis, G.; et al. Timing of expression of the core clock gene Bmal1 influences its effects on aging and survival. Sci. Transl. Med. 2016, 8, 324ra316. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Hirota, T.; Han, X.; Cho, H.; Chong, L.-W.; Lamia, K.; Liu, S.; Atkins, A.R.; Banayo, E.; Liddle, C.; et al. Circadian Amplitude Regulation via FBXW7-Targeted REV-ERBα Degradation. Cell 2016, 165, 1644–1657. [Google Scholar] [CrossRef] [PubMed]
- Le Martelot, G.; Claudel, T.; Gatfield, D.; Schaad, O.; Kornmann, B.; Lo Sasso, G.; Moschetta, A.; Schibler, U. REV-ERBalpha participates in circadian SREBP signaling and bile acid homeostasis. PLoS Biol. 2009, 7, e1000181. [Google Scholar] [CrossRef] [PubMed]
- Preitner, N.; Damiola, F.; Lopez-Molina, L.; Zakany, J.; Duboule, D.; Albrecht, U.; Schibler, U. The orphan nuclear receptor REV-ERBalpha controls circadian transcription within the positive limb of the mammalian circadian oscillator. Cell 2002, 110, 251–260. [Google Scholar] [CrossRef]
- Solt, L.A.; Wang, Y.; Banerjee, S.; Hughes, T.; Kojetin, D.J.; Lundasen, T.; Shin, Y.; Liu, J.; Cameron, M.D.; Noel, R.; et al. Regulation of circadian behaviour and metabolism by synthetic REV-ERB agonists. Nature 2012, 485, 62–68. [Google Scholar] [CrossRef]
- Palikaras, K.; Lionaki, E.; Tavernarakis, N. Mechanisms of mitophagy in cellular homeostasis, physiology and pathology. Nat. Cell Biol. 2018, 20, 1013–1022. [Google Scholar] [CrossRef] [PubMed]
- Onishi, M.; Yamano, K.; Sato, M.; Matsuda, N.; Okamoto, K. Molecular mechanisms and physiological functions of mitophagy. EMBO J. 2021, 40, e104705. [Google Scholar] [CrossRef]
- Liang, L.; Li, H.; Cao, T.; Qu, L.; Zhang, L.; Fan, G.C.; Greer, P.A.; Li, J.; Jones, D.L.; Peng, T. Calpain activation mediates microgravity-induced myocardial abnormalities in mice via p38 and ERK1/2 MAPK pathways. J. Biol. Chem. 2020, 295, 16840–16851. [Google Scholar] [CrossRef]
- Ji, G.; Chang, H.; Yang, M.; Chen, H.; Wang, T.; Liu, X.; Lv, K.; Li, Y.; Song, B.; Qu, L. The mitochondrial proteomic changes of rat hippocampus induced by 28-day simulated microgravity. PLoS ONE 2022, 17, e0265108. [Google Scholar] [CrossRef]
- D’Amico, D.; Andreux, P.A.; Valdés, P.; Singh, A.; Rinsch, C.; Auwerx, J. Impact of the Natural Compound Urolithin A on Health, Disease, and Aging. Trends Mol. Med. 2021, 27, 687–699. [Google Scholar] [CrossRef] [PubMed]
- Mohawk, J.A.; Green, C.B.; Takahashi, J.S. Central and peripheral circadian clocks in mammals. Annu. Rev. Neurosci. 2012, 35, 445–462. [Google Scholar] [CrossRef] [PubMed]
- Hastings, M.H.; Maywood, E.S.; Brancaccio, M. Generation of circadian rhythms in the suprachiasmatic nucleus. Nat. Rev. Neurosci. 2018, 19, 453–469. [Google Scholar] [CrossRef] [PubMed]
- Adlanmerini, M.; Carpenter, B.J.; Remsberg, J.R.; Aubert, Y.; Peed, L.C.; Richter, H.J.; Lazar, M.A. Circadian lipid synthesis in brown fat maintains murine body temperature during chronic cold. Proc. Natl. Acad. Sci. USA 2019, 116, 18691–18699. [Google Scholar] [CrossRef] [PubMed]
- Juste, Y.R.; Kaushik, S.; Bourdenx, M.; Aflakpui, R.; Bandyopadhyay, S.; Garcia, F.; Diaz, A.; Lindenau, K.; Tu, V.; Krause, G.J.; et al. Reciprocal regulation of chaperone-mediated autophagy and the circadian clock. Nat. Cell Biol. 2021, 23, 1255–1270. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Chen, P.; Liu, J.; Zhu, S.; Kroemer, G.; Klionsky, D.J.; Lotze, M.T.; Zeh, H.J.; Kang, R.; Tang, D. Clockophagy is a novel selective autophagy process favoring ferroptosis. Sci. Adv. 2019, 5, eaaw2238. [Google Scholar] [CrossRef] [PubMed]
- Dikic, I. Proteasomal and Autophagic Degradation Systems. Annu. Rev. Biochem. 2017, 86, 193–224. [Google Scholar] [CrossRef]
- Birgisdottir, Å.B.; Lamark, T.; Johansen, T. The LIR motif—Crucial for selective autophagy. J. Cell Sci. 2013, 126, 3237–3247. [Google Scholar] [CrossRef]
- Kalvari, I.; Tsompanis, S.; Mulakkal, N.C.; Osgood, R.; Johansen, T.; Nezis, I.P.; Promponas, V.J. iLIR: A web resource for prediction of Atg8-family interacting proteins. Autophagy 2014, 10, 913–925. [Google Scholar] [CrossRef]
- Sun, N.; Youle, R.J.; Finkel, T. The Mitochondrial Basis of Aging. Mol. Cell 2016, 61, 654–666. [Google Scholar] [CrossRef] [PubMed]
- Miwa, S.; Kashyap, S.; Chini, E.; von Zglinicki, T. Mitochondrial dysfunction in cell senescence and aging. J. Clin. Investig. 2022, 132, e158447. [Google Scholar] [CrossRef] [PubMed]
- Capri, M.; Conte, M.; Ciurca, E.; Pirazzini, C.; Garagnani, P.; Santoro, A.; Longo, F.; Salvioli, S.; Lau, P.; Moeller, R.; et al. Long-term human spaceflight and inflammaging: Does it promote aging? Ageing Res. Rev. 2023, 87, 101909. [Google Scholar] [CrossRef]
- Globus, R.K.; Morey-Holton, E. Hindlimb unloading: Rodent analog for microgravity. J. Appl. Physiol. 2016, 120, 1196–1206. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, R. Regulation of circadian blood pressure: From mice to astronauts. Curr. Opin. Nephrol. Hypertens. 2010, 19, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Gros, A.; Lavenu, L.; Morel, J.L.; De Deurwaerdère, P. Simulated Microgravity Subtlety Changes Monoamine Function across the Rat Brain. Int. J. Mol. Sci. 2021, 22, 11759. [Google Scholar] [CrossRef]
- Rabinovich-Nikitin, I.; Rasouli, M.; Reitz, C.J.; Posen, I.; Margulets, V.; Dhingra, R.; Khatua, T.N.; Thliveris, J.A.; Martino, T.A.; Kirshenbaum, L.A. Mitochondrial autophagy and cell survival is regulated by the circadian Clock gene in cardiac myocytes during ischemic stress. Autophagy 2021, 17, 3794–3812. [Google Scholar] [CrossRef]
- Chen, Y.; Li, J.; Li, S.; Cheng, Y.; Fu, X.; Li, J.; Zhu, L. Uncovering the Novel Role of NR1D1 in Regulating BNIP3-Mediated Mitophagy in Ulcerative Colitis. Int. J. Mol. Sci. 2023, 24, 14222. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Z.; Ming, H.; Lei, S.; Zhou, B.; Zhao, B.; Yu, Y.; Xue, R.; Xia, Z. Roles of HDAC3-orchestrated circadian clock gene oscillations in diabetic rats following myocardial ischaemia/reperfusion injury. Cell Death Dis. 2021, 12, 43. [Google Scholar] [CrossRef]
- Crnko, S.; Du Pré, B.C.; Sluijter, J.P.G.; Van Laake, L.W. Circadian rhythms and the molecular clock in cardiovascular biology and disease. Nat. Rev. Cardiol. 2019, 16, 437–447. [Google Scholar] [CrossRef]
- Chen, L.; Zhang, B.; Yang, L.; Bai, Y.G.; Song, J.B.; Ge, Y.L.; Ma, H.Z.; Cheng, J.H.; Ma, J.; Xie, M.J. BMAL1 Disrupted Intrinsic Diurnal Oscillation in Rat Cerebrovascular Contractility of Simulated Microgravity Rats by Altering Circadian Regulation of miR-103/Ca(V)1.2 Signal Pathway. Int. J. Mol. Sci. 2019, 20, 3947. [Google Scholar] [CrossRef] [PubMed]
- DeBruyne, J.P.; Baggs, J.E.; Sato, T.K.; Hogenesch, J.B. Ubiquitin ligase Siah2 regulates RevErbα degradation and the mammalian circadian clock. Proc. Natl. Acad. Sci. USA 2015, 112, 12420–12425. [Google Scholar] [CrossRef] [PubMed]
- Cerdá, B.; Tomás-Barberán, F.A.; Espín, J.C. Metabolism of antioxidant and chemopreventive ellagitannins from strawberries, raspberries, walnuts, and oak-aged wine in humans: Identification of biomarkers and individual variability. J. Agric. Food Chem. 2005, 53, 227–235. [Google Scholar] [CrossRef] [PubMed]
- Totiger, T.M.; Srinivasan, S.; Jala, V.R.; Lamichhane, P.; Dosch, A.R.; Gaidarski, A.A., 3rd; Joshi, C.; Rangappa, S.; Castellanos, J.; Vemula, P.K.; et al. Urolithin A, a Novel Natural Compound to Target PI3K/AKT/mTOR Pathway in Pancreatic Cancer. Mol. Cancer Ther. 2019, 18, 301–311. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Chandrashekharappa, S.; Bodduluri, S.R.; Baby, B.V.; Hegde, B.; Kotla, N.G.; Hiwale, A.A.; Saiyed, T.; Patel, P.; Vijay-Kumar, M.; et al. Enhancement of the gut barrier integrity by a microbial metabolite through the Nrf2 pathway. Nat. Commun. 2019, 10, 89. [Google Scholar] [CrossRef] [PubMed]
- Larrosa, M.; González-Sarrías, A.; Yáñez-Gascón, M.J.; Selma, M.V.; Azorín-Ortuño, M.; Toti, S.; Tomás-Barberán, F.; Dolara, P.; Espín, J.C. Anti-inflammatory properties of a pomegranate extract and its metabolite urolithin-A in a colitis rat model and the effect of colon inflammation on phenolic metabolism. J. Nutr. Biochem. 2010, 21, 717–725. [Google Scholar] [CrossRef] [PubMed]
- Ryu, D.; Mouchiroud, L.; Andreux, P.A.; Katsyuba, E.; Moullan, N.; Nicolet-Dit-Félix, A.A.; Williams, E.G.; Jha, P.; Lo Sasso, G.; Huzard, D.; et al. Urolithin A induces mitophagy and prolongs lifespan in C. elegans and increases muscle function in rodents. Nat. Med. 2016, 22, 879–888. [Google Scholar] [CrossRef]
- Lee, P.M.Y.; Huang, B.; Liao, G.; Chan, C.K.; Tai, L.B.; Tsang, C.Y.J.; Leung, C.C.; Kwan, M.P.; Tse, L.A. Changes in physical activity and rest-activity circadian rhythm among Hong Kong community aged population before and during COVID-19. BMC Public Health 2021, 21, 836. [Google Scholar] [CrossRef]
Gene Name | Forward Primer (5′-3′) | Reverse Primer (3′-5′) |
---|---|---|
Nr1d1 | AGGTGACCCTGCTTAAGGCTG | ACTGTCTGGTCCTTCACGTTGA |
β-actin | CCCTGGCTCCTAGCACCAT | GAGCCACCAATCCACACAGA |
COX II | GATGACGAGCGACTGTTCCA | TGGTAACCGCTCAGGTGTTG |
Rpl13a | GGTGGTGGTTGTACGCTGTGAG | CGAGACGGGTTGGTGTTCATCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, S.; Li, X.; Liang, F.; Ji, G.; Lv, K.; Yuan, Y.; Zhao, Y.; Yan, N.; Zhang, C.; Cai, S.; et al. Mitophagy Regulates the Circadian Rhythms by Degrading NR1D1 in Simulated Microgravity and Isolation Environments. Int. J. Mol. Sci. 2024, 25, 4853. https://doi.org/10.3390/ijms25094853
Zhou S, Li X, Liang F, Ji G, Lv K, Yuan Y, Zhao Y, Yan N, Zhang C, Cai S, et al. Mitophagy Regulates the Circadian Rhythms by Degrading NR1D1 in Simulated Microgravity and Isolation Environments. International Journal of Molecular Sciences. 2024; 25(9):4853. https://doi.org/10.3390/ijms25094853
Chicago/Turabian StyleZhou, Sihai, Xiaopeng Li, Fengji Liang, Guohua Ji, Ke Lv, Yanhong Yuan, Yujie Zhao, Na Yan, Chuanjie Zhang, Shiou Cai, and et al. 2024. "Mitophagy Regulates the Circadian Rhythms by Degrading NR1D1 in Simulated Microgravity and Isolation Environments" International Journal of Molecular Sciences 25, no. 9: 4853. https://doi.org/10.3390/ijms25094853
APA StyleZhou, S., Li, X., Liang, F., Ji, G., Lv, K., Yuan, Y., Zhao, Y., Yan, N., Zhang, C., Cai, S., Zhang, S., Liu, X., Song, B., & Qu, L. (2024). Mitophagy Regulates the Circadian Rhythms by Degrading NR1D1 in Simulated Microgravity and Isolation Environments. International Journal of Molecular Sciences, 25(9), 4853. https://doi.org/10.3390/ijms25094853