Safety and Efficacy of IL-12 Plasmid DNA Transfection into Pig Skin: Supportive Data for Human Clinical Trials on Gene Therapy and Vaccination
Abstract
1. Introduction
2. Results
2.1. IL-12 mRNA Expression and the Plasmid Copy Number Were Increased 7 Days after the Procedure, and the Use of Invasive Needles Resulted in Higher Expression of IL-12 at the Protein Level
2.2. Plasmid DNA Did Not Persist in the Majority of the Organs from Day 14 On
2.3. Plasmid DNA Is Not Retained at the Injection Site
2.4. PhIL12 GET Did Not Have Any Additional Effect on Whole Blood or Serum Parameters over 28 Days
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Anesthesia
4.3. Blood Sampling: Hematology and Biochemistry
4.4. Study Design
4.5. Euthanasia and Sampling
4.6. Isolation of RNA and DNA
4.7. qRT-PCR
4.8. ELISA hIL-12
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dermol-Černe, J.; Pirc, E.; Miklavčič, D. Mechanistic View of Skin Electroporation—Models and Dosimetry for Successful Applications: An Expert Review. Expert. Opin. Drug Deliv. 2020, 17, 689–704. [Google Scholar] [CrossRef]
- Strojan, P.; Grošelj, A.; Serša, G.; Plaschke, C.C.; Vermorken, J.B.; Nuyts, S.; de Bree, R.; Eisbruch, A.; Mendenhall, W.M.; Smee, R.; et al. Electrochemotherapy in Mucosal Cancer of the Head and Neck: A Systematic Review. Cancers 2021, 13, 1254. [Google Scholar] [CrossRef] [PubMed]
- Rangel, M.M.M.; Linhares, L.C.M.; de Oliveira, K.D.; Suzuki, D.O.H.; Maglietti, F.H.; de Nardi, A.B. Evaluation of the safety and feasibility of electrochemotherapy with intravenous bleomycin as local treatment of bladder cancer in dogs. Sci. Rep. 2023, 13, 21078. [Google Scholar] [CrossRef] [PubMed]
- Sersa, G.; Teissie, J.; Cemazar, M.; Signori, E.; Kamensek, U.; Marshall, G.; Miklavcic, D. Electrochemotherapy of Tumors as in Situ Vaccination Boosted by Immunogene Electrotransfer. Cancer Immunol. Immunother. 2015, 64, 1315–1327. [Google Scholar] [CrossRef] [PubMed]
- Mehrotra, P.T.; Wu, D.; Crim, J.A.; Mostowski, H.S.; Siegel, J.P. Effects of IL-12 on the Generation of Cytotoxic Activity in Human CD8+ T Lymphocytes. J. Immunol. 1993, 151, 2444–2452. [Google Scholar] [CrossRef] [PubMed]
- Maher, J.; Davies, E.T. Targeting Cytotoxic T Lymphocytes for Cancer Immunotherapy. Br. J. Cancer 2004, 91, 817–821. [Google Scholar] [CrossRef] [PubMed]
- Trapani, J.A.; Smyth, M.J. Functional Significance of the Perforin/Granzyme Cell Death Pathway. Nat. Rev. Immunol. 2002, 2, 735–747. [Google Scholar] [CrossRef] [PubMed]
- Jorgovanovic, D.; Song, M.; Wang, L.; Zhang, Y. Roles of IFN-γ in tumor progression and regression: A review. Biomark. Res. 2020, 8, 49. [Google Scholar] [CrossRef] [PubMed]
- Shi, G.; Edelblute, C.; Arpag, S.; Lundberg, C.; Heller, R. IL-12 Gene Electrotransfer Triggers a Change in Immune Response within Mouse Tumors. Cancers 2018, 10, 498. [Google Scholar] [CrossRef]
- Silva-Pilipich, N.; Lasarte-Cía, A.; Lozano, T.; Martín-Otal, C.; Lasarte, J.J.; Smerdou, C. Intratumoral electroporation of a self-amplifying RNA expressing IL-12 in-duces antitumor effects in mouse models of cancer. Mol. Ther. Nucleic Acids 2022, 29, 387–399. [Google Scholar] [CrossRef]
- Li, S.; Xia, X.; Mellieon, F.M.; Liu, J.; Steele, S. Candidate genes associated with tumor regression mediated by intratumoral IL-12 electroporation gene therapy. Mol. Ther. 2004, 9, 347–354. [Google Scholar] [CrossRef]
- Lampreht Tratar, U.; Milevoj, N.; Cemazar, M.; Znidar, K.; Ursic Valentinuzzi, K.; Brozic, A.; Tomsic, K.; Sersa, G.; Tozon, N. Treatment of spontaneous canine mast cell tumors by electrochemotherapy combined with IL-12 gene electrotransfer: Comparison of intratumoral and peritumoral application of IL-12. Int. Immunopharmacol. 2023, 120, 110274. [Google Scholar] [CrossRef]
- Daud, A.I.; DeConti, R.C.; Andrews, S.; Urbas, P.; Riker, A.I.; Sondak, V.K.; Munster, P.N.; Sullivan, D.M.; Ugen, K.E.; Messina, J.L.; et al. Phase I Trial of Interleukin-12 Plasmid Electroporation in Patients with Metastatic Melanoma. J. Clin. Oncol. 2008, 26, 5896–5903. [Google Scholar] [CrossRef]
- Lucas, M.L.; Heller, L.; Coppola, D.; Heller, R. IL-12 Plasmid Delivery by in Vivo Electroporation for the Successful Treatment of Established Subcutaneous B16.F10 Melanoma. Mol. Ther. 2002, 5, 668–675. [Google Scholar] [CrossRef]
- Heller, R.; Schultz, J.; Lucas, M.L.; Jaroszeski, M.J.; Heller, L.C.; Gilbert, R.A.; Moelling, K.; Nicolau, C. Intradermal delivery of interleukin-12 plasmid DNA by in vivo electroporation. DNA Cell Biol. 2001, 20, 21–26. [Google Scholar] [CrossRef] [PubMed]
- Vandermeulen, G.; Staes, E.; Vanderhaeghen, M.L.; Bureau, M.F.; Scherman, D.; Préat, V. Optimisation of Intradermal DNA Electrotransfer for Immunisation. J. Control. Release 2007, 124, 81–87. [Google Scholar] [CrossRef] [PubMed]
- Gothelf, A.; Gehl, J. Gene Electrotransfer to Skin; Review of Existing Literature and Clinical Perspectives. Curr. Gene Ther. 2010, 10, 287–299. [Google Scholar] [CrossRef] [PubMed]
- Heller, L.C.; Jaroszeski, M.J.; Coppola, D.; Mccray, A.N.; Hickey, J.; Heller, R. Optimization of Cutaneous Electrically Mediated Plasmid DNA Delivery Using Novel Electrode. Gene Ther. 2007, 14, 275–280. [Google Scholar] [CrossRef] [PubMed]
- Mazeres, S.; Sel, D.; Golzio, M.; Pucihar, G.; Tamzali, Y.; Miklavcic, D.; Teissie, J. Non Invasive Contact Electrodes for in Vivo Localized Cutaneous Electropulsation and Associated Drug and Nucleic Acid Delivery. J. Control. Release 2009, 134, 125–131. [Google Scholar] [CrossRef] [PubMed]
- Drabick, J.J.; Glasspool-Malone, J.; Somiari, S.; King, A.; Malone, R.W. Cutaneous Transfection and Immune Responses to Intradermal Nucleic Acid Vaccination Are Significantly Enhanced by in Vivo Electropermeabilization. Mol. Ther. 2001, 3, 249–255. [Google Scholar] [CrossRef] [PubMed]
- Glasspool-Malone, J.; Somiari, S.; Drabick, J.J.; Malone, R.W. Efficient Nonviral Cutaneous Transfection. Mol. Ther. 2000, 2, 140–146. [Google Scholar] [CrossRef] [PubMed]
- Maruyama, H.; Ataka, K.; Higuchi, N.; Sakamoto, F.; Gejyo, F.; Miyazaki, J. Skin-Targeted Gene Transfer Using In Vivo Electroporation. Gene Ther. 2001, 8, 1808–1812. [Google Scholar] [CrossRef] [PubMed]
- Gill, D.R.; Pringle, I.A.; Hyde, S.C. Progress and Prospects: The Design and Production of Plasmid Vectors. Gene Ther. 2009, 16, 165–171. [Google Scholar] [CrossRef] [PubMed]
- Mignon, C.; Sodoyer, R.; Werle, B. Antibiotic-Free Selection in Biotherapeutics: Now and Forever. Pathogens 2015, 4, 157. [Google Scholar] [CrossRef] [PubMed]
- Kamensek, U.; Tesic, N.; Sersa, G.; Kos, S.; Cemazar, M. Tailor-Made Fibroblast-Specific and Antibiotic-Free Interleukin 12 Plasmid for Gene Electrotransfer-Mediated Cancer Immunotherapy. Plasmid 2017, 89, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Groselj, A.; Bosnjak, M.; Jesenko, T.; Cemazar, M.; Markelc, B.; Strojan, P.; Sersa, G. Treatment of Skin Tumors with Intratumoral Interleukin 12 Gene Electrotransfer in the Head and Neck Region: A First-in-Human Clinical Trial Protocol. Radiol. Oncol. 2022, 56, 398–408. [Google Scholar] [CrossRef] [PubMed]
- Kalams, S.A.; Parker, S.D.; Elizaga, M.; Metch, B.; Edupuganti, S.; Hural, J.; De Rosa, S.; Carter, D.K.; Rybczyk, K.; Frank, I.; et al. Safety and Comparative Immunogenicity of an HIV-1 DNA Vaccine in Combination with Plasmid Interleukin 12 and Impact of Intramuscular Electroporation for Delivery. J. Infect. Dis. 2013, 208, 818–829. [Google Scholar] [CrossRef]
- Jalah, R.; Patel, V.; Kulkarni, V.; Rosati, M.; Alicea, C.; Ganneru, B.; Von Gegerfelt, A.; Huang, W.; Guan, Y.; Broderick, K.E.; et al. IL-12 DNA as Molecular Vaccine Adjuvant Increases the Cytotoxic T Cell Responses and Breadth of Humoral Immune Responses in SIV DNA Vaccinated Macaques. Hum. Vaccin. Immunother. 2012, 8, 1620. [Google Scholar] [CrossRef]
- Kos, S.; Bosnjak, M.; Jesenko, T.; Markelc, B.; Kamensek, U.; Znidar, K.; Matkovic, U.; Rencelj, A.; Sersa, G.; Hudej, R.; et al. Non-Clinical In Vitro Evaluation of Antibiotic Resistance Gene-Free Plasmids Encoding Human or Murine IL-12 Intended for First-in-Human Clinical Study. Pharmaceutics 2021, 13, 1739. [Google Scholar] [CrossRef]
- Foss, D.L.; Murtaugh, M.P. Molecular cloning and mRNA expression of porcine interleukin-12. Vet. Immunol. Immunopathol. 1997, 57, 121–134. [Google Scholar] [CrossRef] [PubMed]
- Summerfield, A.; Meurens, F.; Ricklin, M.E. The immunology of the porcine skin and its value as a model for human skin. Mol. Immunol. 2015, 66, 14–21. [Google Scholar] [CrossRef] [PubMed]
- Schwanhüusser, B.; Busse, D.; Li, N.; Dittmar, G.; Schuchhardt, J.; Wolf, J.; Chen, W.; Selbach, M. Global Quantification of Mammalian Gene Expression Control. Nature 2011, 473, 337–342. [Google Scholar] [CrossRef]
- Gothelf, A.; Mahmood, F.; Dagnaes-Hansen, F.; Gehl, J. Efficacy of Transgene Expression in Porcine Skin as a Function of Electrode Choice. Bioelectrochemistry 2011, 82, 95–102. [Google Scholar] [CrossRef] [PubMed]
- Fischer, H.; Scherz, J.; Szabo, S.; Mildner, M.; Benarafa, C. DNase 2 Is the Main DNA-Degrading Enzyme of the Stratum Corneum. PLoS ONE 2011, 6, 17581. [Google Scholar] [CrossRef] [PubMed]
- Hengge, U.R.; Dexling, B.; Mirmohammadsadegh, A. Safety and Pharmacokinetics of Naked Plasmid DNA in the Skin: Studies on Dissemination and Ectopic Expression. JID 2001, 116, 979–982. [Google Scholar] [CrossRef] [PubMed]
- Tam, P.; Monck, M.; Lee, D.; Ludkovski, O.; Leng, E.C.; Clow, K.; Stark, H.; Scherrer, P.; Graham, R.W.; Cullis, P.R. Stabilized Plasmid-Lipid Particles for Systemic Gene Therapy. Gene Ther. 2000, 7, 1867–1874. [Google Scholar] [CrossRef] [PubMed]
- Huard, J.; Lochmüller, H.; Acsadi, G.; Jani, A.; Massie, B.; Karpati, G. The Route of Administration Is a Major Determinant of the Transduction Efficiency of Rat Tissues by Adenoviral Recombinants. Gene Ther. 1995, 2, 107–115. [Google Scholar]
- Worgall, S.; Wolff, G.; Falck-Pedersen, E.; Crystal, R.G. Innate Immune Mechanisms Dominate Elimination of Adenoviral Vectors Following In Vivo Administration. Hum. Gene Ther. 2008, 8, 37–44. [Google Scholar] [CrossRef]
- Stupan, U.; Čemažar, M.; Trotovšek, B.; Petrič, M.; Tomažič, A.; Gašljević, G.; Ranković, B.; Seliškar, A.; Plavec, T.; Sredenšek, J.; et al. Histologic Changes of Porcine Portal Vein Anastomosis after Electrochemotherapy with Bleomycin. Bioelectrochemistry 2023, 154, 108509. [Google Scholar] [CrossRef]
- ClinicalTrials.org. Available online: https://clinicaltrials.gov/ (accessed on 20 November 2023).
Primer | Primer Details | Sequence |
---|---|---|
Transgene expression | ||
pBA forward | Porcine internal/housekeeping expression control (beta actin) | TCCACGAAACTACCTTCAACTC |
pBA reverse | Porcine internal/housekeeping expression control (beta actin) | GATCTCCTTCTGCATCCTGTC |
pB2M forward | Porcine internal/housekeeping expression control (beta 2-microglobulin) | CCACACTGAGTTCACTCCTAAC |
pB2M reverse | Porcine internal/housekeeping expression control (beta 2-microglobulin) | GGTCTCGATCCCACTTAACTATC |
hIL-12 forward | Expression primer: specific to the linker region between the p40 and p35 IL-12 subunits (phIL12) | CTGCAGTGTTCCTGGAGTAG |
hIL-12 reverse | Expression primer: specific to the linker region between the p40 and p35 IL-12 subunits (phIL12) | GAACATTCCTGGGTCTGGAG |
Copy number | ||
phIL12 forward | Copy number primer: specific to the plasmid backbone (ori) | GCAGAGCGCAGATACCAAATA |
phIL12 reverse | Copy number primer: specific to the plasmid backbone (ori) | GCGCCTTATCCGGTAACTATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lampreht Tratar, U.; Jesenko, T.; Omerzel, M.; Seliskar, A.; Stupan, U.; Djokic, M.; Sredensek, J.; Trotovsek, B.; Sersa, G.; Cemazar, M. Safety and Efficacy of IL-12 Plasmid DNA Transfection into Pig Skin: Supportive Data for Human Clinical Trials on Gene Therapy and Vaccination. Int. J. Mol. Sci. 2024, 25, 3151. https://doi.org/10.3390/ijms25063151
Lampreht Tratar U, Jesenko T, Omerzel M, Seliskar A, Stupan U, Djokic M, Sredensek J, Trotovsek B, Sersa G, Cemazar M. Safety and Efficacy of IL-12 Plasmid DNA Transfection into Pig Skin: Supportive Data for Human Clinical Trials on Gene Therapy and Vaccination. International Journal of Molecular Sciences. 2024; 25(6):3151. https://doi.org/10.3390/ijms25063151
Chicago/Turabian StyleLampreht Tratar, Ursa, Tanja Jesenko, Masa Omerzel, Alenka Seliskar, Urban Stupan, Mihajlo Djokic, Jerneja Sredensek, Blaz Trotovsek, Gregor Sersa, and Maja Cemazar. 2024. "Safety and Efficacy of IL-12 Plasmid DNA Transfection into Pig Skin: Supportive Data for Human Clinical Trials on Gene Therapy and Vaccination" International Journal of Molecular Sciences 25, no. 6: 3151. https://doi.org/10.3390/ijms25063151
APA StyleLampreht Tratar, U., Jesenko, T., Omerzel, M., Seliskar, A., Stupan, U., Djokic, M., Sredensek, J., Trotovsek, B., Sersa, G., & Cemazar, M. (2024). Safety and Efficacy of IL-12 Plasmid DNA Transfection into Pig Skin: Supportive Data for Human Clinical Trials on Gene Therapy and Vaccination. International Journal of Molecular Sciences, 25(6), 3151. https://doi.org/10.3390/ijms25063151