Proanthocyanidins Ameliorate LPS-Inhibited Osteogenesis of PDLSCs by Restoring Lysine Lactylation
Abstract
1. Introduction
2. Results
2.1. Osteogenesis and Lactylation Levels Are Decreased in the Periodontal Tissue of Periodontitis Rats and LPS-Stimulated Human PDLSCs
2.2. Restoration of Lactylation by Trichostatin A Recovers the Osteogenesis of PDLSCs in the Inflammatory State
2.3. Proanthocyanidins Promote Osteogenesis and Elevate Lactylation of PDLSCs
2.4. Proanthocyanidins Promote PDLSC Osteogenesis by Restoring Lactylation of PDLSCs in Inflammatory States
2.5. Proanthocyanidins Restore Lactylation in Inflammatory States and May Promote Osteogenesis in PDLSCs via the Wnt/β-Catenin Pathway
3. Discussion
4. Materials and Methods
4.1. Animal Experiments
4.2. Isolation and Culture of PDLSCs and Relative Reagents
4.3. Immunohistochemistry
4.4. Lactate Concentration Detection
4.5. qRT-PCR Analysis
4.6. Western Blot Analysis
4.7. Alkaline Phosphatase (ALP) Staining
4.8. Alizarin Red S(ARS) Staining
4.9. Immunofluorescence
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Peres, M.A.; Macpherson, L.M.D.; Weyant, R.J.; Daly, B.; Venturelli, R.; Mathur, M.R.; Listl, S.; Celeste, R.K.; Guarnizo-Herreño, C.C.; Kearns, C.; et al. Oral diseases: A global public health challenge. Lancet 2019, 394, 249–260. [Google Scholar] [CrossRef] [PubMed]
- Slots, J. Periodontitis: Facts, fallacies and the future. Periodontol. 2000 2017, 75, 7–23. [Google Scholar] [CrossRef] [PubMed]
- Dannewitz, B.; Holtfreter, B.; Eickholz, P. Periodontitis-therapy of a widespread disease. Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz 2021, 64, 931–940. [Google Scholar] [CrossRef] [PubMed]
- Schulze-Späte, U.; Turner, R.; Wang, Y.; Chao, R.; Schulze, P.C.; Phipps, K.; Orwoll, E.; Dam, T.T. Relationship of Bone Metabolism Biomarkers and Periodontal Disease: The Osteoporotic Fractures in Men (MrOS) Study. J. Clin. Endocrinol. Metab. 2015, 100, 2425–2433. [Google Scholar] [CrossRef] [PubMed]
- Herrera, D.; Sanz, M.; Kebschull, M.; Jepsen, S.; Sculean, A.; Berglundh, T.; Papapanou, P.N.; Chapple, I.; Tonetti, M.S. Treatment of stage IV periodontitis: The EFP S3 level clinical practice guideline. J. Clin. Periodontol. 2022, 49 (Suppl. S24), 4–71. [Google Scholar] [CrossRef] [PubMed]
- Seo, B.M.; Miura, M.; Gronthos, S.; Bartold, P.M.; Batouli, S.; Brahim, J.; Young, M.; Robey, P.G.; Wang, C.Y.; Shi, S. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet 2004, 364, 149–155. [Google Scholar] [CrossRef] [PubMed]
- Queiroz, A.; Albuquerque-Souza, E.; Gasparoni, L.M.; de França, B.N.; Pelissari, C.; Trierveiler, M.; Holzhausen, M. Therapeutic potential of periodontal ligament stem cells. World J. Stem Cells 2021, 13, 605–618. [Google Scholar] [CrossRef]
- Tour, G.; Wendel, M.; Moll, G.; Tcacencu, I. Bone repair using periodontal ligament progenitor cell-seeded constructs. J. Dent. Res. 2012, 91, 789–794. [Google Scholar] [CrossRef]
- Eleuterio, E.; Trubiani, O.; Sulpizio, M.; Di Giuseppe, F.; Pierdomenico, L.; Marchisio, M.; Giancola, R.; Giammaria, G.; Miscia, S.; Caputi, S.; et al. Proteome of human stem cells from periodontal ligament and dental pulp. PLoS ONE 2013, 8, e71101. [Google Scholar] [CrossRef]
- Liu, X.; Tan, G.R.; Yu, M.; Cai, X.; Zhou, Y.; Ding, H.; Xie, H.; Qu, F.; Zhang, R.; Lam, C.U.; et al. The Effect of Tumour Necrosis Factor-α on Periodontal Ligament Stem Cell Differentiation and the Related Signaling Pathways. Curr. Stem Cell Res. Ther. 2016, 11, 593–602. [Google Scholar] [CrossRef]
- Cheng, M.; Zhou, Q. Targeting EZH2 Ameliorates the LPS-Inhibited PDLSC Osteogenesis via Wnt/β-Catenin Pathway. Cells Tissues Organs 2020, 209, 227–235. [Google Scholar] [CrossRef]
- Rabinowitz, J.D.; Enerback, S. Lactate: The ugly duckling of energy metabolism. Nat. Metab. 2020, 2, 566–571. [Google Scholar] [CrossRef]
- Loeffler, J.; Duda, G.N.; Sass, F.A.; Dienelt, A. The Metabolic Microenvironment Steers Bone Tissue Regeneration. Trends Endocrinol. Metab. 2018, 29, 99–110. [Google Scholar] [CrossRef]
- Milovanova, T.N.; Bhopale, V.M.; Sorokina, E.M.; Moore, J.S.; Hunt, T.K.; Hauer-Jensen, M.; Velazquez, O.C.; Thom, S.R. Lactate stimulates vasculogenic stem cells via the thioredoxin system and engages an autocrine activation loop involving hypoxia-inducible factor 1. Mol. Cell Biol. 2008, 28, 6248–6261. [Google Scholar] [CrossRef]
- Rattigan, Y.I.; Patel, B.B.; Ackerstaff, E.; Sukenick, G.; Koutcher, J.A.; Glod, J.W.; Banerjee, D. Lactate is a mediator of metabolic cooperation between stromal carcinoma associated fibroblasts and glycolytic tumor cells in the tumor microenvironment. Exp. Cell Res. 2012, 318, 326–335. [Google Scholar] [CrossRef]
- Ghani, Q.P.; Wagner, S.; Hussain, M.Z. Role of ADP-ribosylation in wound repair. The contributions of Thomas K. Hunt, MD. Wound Repair Regen. 2003, 11, 439–444. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Tang, Z.; Huang, H.; Zhou, G.; Cui, C.; Weng, Y.; Liu, W.; Kim, S.; Lee, S.; Perez-Neut, M.; et al. Metabolic regulation of gene expression by histone lactylation. Nature 2019, 574, 575–580. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Chai, P.; Xie, M.; Ge, S.; Ruan, J.; Fan, X.; Jia, R. Histone lactylation drives oncogenesis by facilitating m(6)A reader protein YTHDF2 expression in ocular melanoma. Genome Biol. 2021, 22, 85. [Google Scholar] [CrossRef] [PubMed]
- Hagihara, H.; Shoji, H.; Otabi, H.; Toyoda, A.; Katoh, K.; Namihira, M.; Miyakawa, T. Protein lactylation induced by neural excitation. Cell Rep. 2021, 37, 109820. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Chen, K.; Wang, T.; Wu, Y.; Xing, G.; Chen, M.; Hao, Z.; Zhang, C.; Zhang, J.; Ma, B.; et al. Glis1 facilitates induction of pluripotency via an epigenome-metabolome-epigenome signalling cascade. Nat. Metab. 2020, 2, 882–892. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Hu, M.; Jiang, H.; Ma, J.; Xie, C.; Zhang, Z.; Zhou, X.; Zhao, J.; Tao, Z.; Meng, Y.; et al. Endothelial Cell-Derived Lactate Triggers Bone Mesenchymal Stem Cell Histone Lactylation to Attenuate Osteoporosis. Adv. Sci. 2023, 10, e2301300. [Google Scholar] [CrossRef]
- Rauf, A.; Imran, M.; Abu-Izneid, T.; Iahtisham Ul, H.; Patel, S.; Pan, X.; Naz, S.; Sanches Silva, A.; Saeed, F.; Rasul Suleria, H.A. Proanthocyanidins: A comprehensive review. Biomed. Pharmacother. 2019, 116, 108999. [Google Scholar] [CrossRef]
- Kwak, S.C.; Cheon, Y.H.; Lee, C.H.; Jun, H.Y.; Yoon, K.H.; Lee, M.S.; Kim, J.Y. Grape Seed Proanthocyanidin Extract Prevents Bone Loss via Regulation of Osteoclast Differentiation, Apoptosis, and Proliferation. Nutrients 2020, 12, 3164. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Liu, L.; Jin, S.; Zhang, Y.; Zhang, L.; Li, S.; Song, A.; Yang, P. Proanthocyanidins Promote Osteogenic Differentiation of Human Periodontal Ligament Fibroblasts in Inflammatory Environment Via Suppressing NF-kappaB Signal Pathway. Inflammation 2020, 43, 892–902. [Google Scholar] [CrossRef]
- Liu, Z.; Li, Q.; Wang, X.; Wu, Y.; Zhang, Z.; Mao, J.; Gong, S. Proanthocyanidin enhances the endogenous regeneration of alveolar bone by elevating the autophagy of PDLSCs. J. Periodontal Res. 2023, 58, 1300–1314. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Xie, M.; Xie, Y.; Mei, F.; Lu, X.; Li, X.; Chen, L. The roles of osteocytes in alveolar bone destruction in periodontitis. J. Transl. Med. 2020, 18, 479. [Google Scholar] [CrossRef] [PubMed]
- Delgado-Calle, J.; Sañudo, C.; Sánchez-Verde, L.; García-Renedo, R.J.; Arozamena, J.; Riancho, J.A. Epigenetic regulation of alkaline phosphatase in human cells of the osteoblastic lineage. Bone 2011, 49, 830–838. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.P.; Shao, J.Z.; Xiang, L.X. GADD45A protein plays an essential role in active DNA demethylation during terminal osteogenic differentiation of adipose-derived mesenchymal stem cells. J. Biol. Chem. 2011, 286, 41083–41094. [Google Scholar] [CrossRef]
- Hassan, M.Q.; Tare, R.; Lee, S.H.; Mandeville, M.; Weiner, B.; Montecino, M.; van Wijnen, A.J.; Stein, J.L.; Stein, G.S.; Lian, J.B. HOXA10 controls osteoblastogenesis by directly activating bone regulatory and phenotypic genes. Mol. Cell. Biol. 2007, 27, 3337–3352. [Google Scholar] [CrossRef]
- Li, W.; Huang, X.; Yu, W.; Xu, Y.; Huang, R.; Park, J.; Moshaverinia, A.; Arora, P.; Chen, C. Activation of Functional Somatic Stem Cells Promotes Endogenous Tissue Regeneration. J. Dent. Res. 2022, 101, 802–811. [Google Scholar] [CrossRef]
- Li, J.; Wang, Z.; Huang, X.; Wang, Z.; Chen, Z.; Wang, R.; Chen, Z.; Liu, W.; Wu, B.; Fang, F.; et al. Dynamic proteomic profiling of human periodontal ligament stem cells during osteogenic differentiation. Stem Cell Res. Ther. 2021, 12, 98. [Google Scholar] [CrossRef] [PubMed]
- Arora, P.; Li, W.; Huang, X.; Yu, W.; Huang, R.; Jiang, Q.; Chen, C. Metabolic Reconfiguration Activates Stemness and Immunomodulation of PDLSCs. Int. J. Mol. Sci. 2022, 23, 4038. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.; Jin, W.; Shi, H. Oligomeric proanthocyanidins protects A549 cells against H2O2-induced oxidative stress via the Nrf2-ARE pathway. Int. J. Mol. Med. 2017, 39, 1548–1554. [Google Scholar] [CrossRef] [PubMed]
- Padumadasa, C.; Dharmadana, D.; Abeysekera, A.; Thammitiyagodage, M. In vitro antioxidant, anti-inflammatory and anticancer activities of ethyl acetate soluble proanthocyanidins of the inflorescence of Cocos nucifera L. BMC Complement. Altern. Med. 2016, 16, 345. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Xian, D.; Xiong, X.; Lai, R.; Song, J.; Zhong, J. Proanthocyanidins against Oxidative Stress: From Molecular Mechanisms to Clinical Applications. Biomed Res. Int. 2018, 2018, 8584136. [Google Scholar] [CrossRef] [PubMed]
- Nichols, J.A.; Katiyar, S.K. Skin photoprotection by natural polyphenols: Anti-inflammatory, antioxidant and DNA repair mechanisms. Arch. Dermatol. Res. 2010, 302, 71–83. [Google Scholar] [CrossRef]
- Wieczfinska, J.; Sitarek, P.; Kowalczyk, T.; Skała, E.; Pawliczak, R. The Anti-inflammatory Potential of Selected Plant-derived Compounds in Respiratory Diseases. Curr. Pharm. Des. 2020, 26, 2876–2884. [Google Scholar] [CrossRef]
- Yang, K.; Chan, C.B. Proposed mechanisms of the effects of proanthocyanidins on glucose homeostasis. Nutr. Rev. 2017, 75, 642–657. [Google Scholar] [CrossRef]
- Akaberi, M.; Hosseinzadeh, H. Grapes (Vitis vinifera) as a Potential Candidate for the Therapy of the Metabolic Syndrome. Phytother. Res. 2016, 30, 540–556. [Google Scholar] [CrossRef]
- Zhao, J.; Wang, G.; Han, K.; Wang, Y.; Wang, L.; Gao, J.; Zhao, S.; Wang, G.; Chen, S.; Luo, A.; et al. Mitochondrial PKM2 deacetylation by procyanidin B2-induced SIRT3 upregulation alleviates lung ischemia/reperfusion injury. Cell Death Dis. 2022, 13, 594. [Google Scholar] [CrossRef]
- Zahra, K.; Dey, T.; Ashish; Mishra, S.P.; Pandey, U. Pyruvate Kinase M2 and Cancer: The Role of PKM2 in Promoting Tumorigenesis. Front. Oncol. 2020, 10, 159. [Google Scholar] [CrossRef]
- Shen, J.; Hovhannisyan, H.; Lian, J.B.; Montecino, M.A.; Stein, G.S.; Stein, J.L.; Van Wijnen, A.J. Transcriptional induction of the osteocalcin gene during osteoblast differentiation involves acetylation of histones h3 and h4. Mol. Endocrinol. 2003, 17, 743–756. [Google Scholar] [CrossRef]
- Reik, W. Stability and flexibility of epigenetic gene regulation in mammalian development. Nature 2007, 447, 425–432. [Google Scholar] [CrossRef] [PubMed]
- Yin, X.; Li, J.; Salmon, B.; Huang, L.; Lim, W.H.; Liu, B.; Hunter, D.J.; Ransom, R.C.; Singh, G.; Gillette, M.; et al. Wnt Signaling and Its Contribution to Craniofacial Tissue Homeostasis. J. Dent. Res. 2015, 94, 1487–1494. [Google Scholar] [CrossRef] [PubMed]
- Vaid, M.; Singh, T.; Prasad, R.; Katiyar, S.K. Bioactive proanthocyanidins inhibit growth and induce apoptosis in human melanoma cells by decreasing the accumulation of β-catenin. Int. J. Oncol. 2016, 48, 624–634. [Google Scholar] [CrossRef] [PubMed]
- Liberti, M.V.; Locasale, J.W. The Warburg Effect: How Does it Benefit Cancer Cells? Trends Biochem. Sci. 2016, 41, 211–218. [Google Scholar] [CrossRef] [PubMed]
- Icard, P.; Shulman, S.; Farhat, D.; Steyaert, J.M.; Alifano, M.; Lincet, H. How the Warburg effect supports aggressiveness and drug resistance of cancer cells? Drug Resist. Updates 2018, 38, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Lv, X.; Lv, Y.; Dai, X. Lactate, histone lactylation and cancer hallmarks. Expert Rev. Mol. Med. 2023, 25, e7. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Zhang, Y.; Yang, B.; Sun, S.; Zhang, P.; Luo, Z.; Feng, T.; Cui, Z.; Zhu, T.; Li, Y.; et al. Lactylation of METTL16 promotes cuproptosis via m(6)A-modification on FDX1 mRNA in gastric cancer. Nat. Commun. 2023, 14, 6523. [Google Scholar] [CrossRef] [PubMed]
- Pan, L.; Feng, F.; Wu, J.; Fan, S.; Han, J.; Wang, S.; Yang, L.; Liu, W.; Wang, C.; Xu, K. Demethylzeylasteral targets lactate by inhibiting histone lactylation to suppress the tumorigenicity of liver cancer stem cells. Pharmacol. Res. 2022, 181, 106270. [Google Scholar] [CrossRef]
- Deng, J.; Liao, X. Lysine lactylation (Kla) might be a novel therapeutic target for breast cancer. BMC Med. Genom. 2023, 16, 283. [Google Scholar] [CrossRef] [PubMed]
- Pandkar, M.R.; Sinha, S.; Samaiya, A.; Shukla, S. Oncometabolite lactate enhances breast cancer progression by orchestrating histone lactylation-dependent c-Myc expression. Transl. Oncol. 2023, 37, 101758. [Google Scholar] [CrossRef] [PubMed]
Genes | Forward Primer Sequences (5′-3′) | Reverse Primer Sequences (5′-3′) |
---|---|---|
COL1A1 | TAGGGTCTAGCATGTTCAGCTTTG | CGTTCTGTACGCAGGTGATTG |
ALPL | GGACCATTCCCACGTCTTCA | CAGGCCCATTGCCATACA |
RUNX2 | CACTGGCGCTGCAACAAGA | CATTCCGGAGCTCAGCAGATAA |
BMP2 | CCACCATGAAGAATCTTTGGA | GAGTTGGCTGTTGCAGGTTT |
GAPDH | GGTGAAGGTCGGAGTCAACG | CAAAGTTGTCATGGATGHACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, Y.; Wang, X.; Zhang, Y.; Wen, Z.; Li, Y.; Zhang, K.; Gosar, N.; Li, Q.; Mao, J.; Gong, S. Proanthocyanidins Ameliorate LPS-Inhibited Osteogenesis of PDLSCs by Restoring Lysine Lactylation. Int. J. Mol. Sci. 2024, 25, 2947. https://doi.org/10.3390/ijms25052947
Wu Y, Wang X, Zhang Y, Wen Z, Li Y, Zhang K, Gosar N, Li Q, Mao J, Gong S. Proanthocyanidins Ameliorate LPS-Inhibited Osteogenesis of PDLSCs by Restoring Lysine Lactylation. International Journal of Molecular Sciences. 2024; 25(5):2947. https://doi.org/10.3390/ijms25052947
Chicago/Turabian StyleWu, Yaxin, Xiangyao Wang, Yuxiao Zhang, Zhihao Wen, Yuanyuan Li, Kehan Zhang, Nuerlan Gosar, Qilin Li, Jing Mao, and Shiqiang Gong. 2024. "Proanthocyanidins Ameliorate LPS-Inhibited Osteogenesis of PDLSCs by Restoring Lysine Lactylation" International Journal of Molecular Sciences 25, no. 5: 2947. https://doi.org/10.3390/ijms25052947
APA StyleWu, Y., Wang, X., Zhang, Y., Wen, Z., Li, Y., Zhang, K., Gosar, N., Li, Q., Mao, J., & Gong, S. (2024). Proanthocyanidins Ameliorate LPS-Inhibited Osteogenesis of PDLSCs by Restoring Lysine Lactylation. International Journal of Molecular Sciences, 25(5), 2947. https://doi.org/10.3390/ijms25052947