pOsHAK1:OsSUT1 Promotes Sugar Transport and Enhances Drought Tolerance in Rice
Abstract
1. Introduction
2. Results
2.1. The Response of OsSUT1 to Drought Stress
2.2. Generation of the pHAK1:SUT1 Transgenic Rice Lines
2.3. Effects of pHAK1:SUT1 on Rice Seedling Growth
2.4. Effects of pHAK1:SUT1 on Sugar Synthesis in Rice
2.5. Effects of pHAK1:SUT1 on Sugar Transport in Rice
2.6. Effects of pHAK1:SUT1 on Total Root Length and Root Surface Area in Rice
2.7. Effects of pHAK1:SUT1 on Water Retention and Lipid Peroxidation in Rice
2.8. Effects of pHAK1:SUT1 on the Expression of Genes Related to Aging, Stress Response, and Anti-Oxidation
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Method
4.2.1. Determination of Pn
4.2.2. Determination of SPS Activity
4.2.3. Determination of the SER
4.2.4. Determination of Sucrose Content
4.2.5. Real-Time PCR (qRT-PCR)
4.2.6. Determination of Total Root Length and Root Surface Area
4.2.7. Determination of the RWC and the Water Loss Rate
4.2.8. Determination of H2O2 and MDA Contents
4.2.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Miyoshi, Y.; Soma, F.; Yin, Y.-G.; Suzui, N.; Noda, Y.; Enomoto, K.; Nagao, Y.; Yamaguchi, M.; Kawachi, N.; Yoshida, E.; et al. Rice immediately adapts the dynamics of photosynthates translocation to roots in response to changes in soil water environment. Front. Plant Sci. 2023, 13, 1024144. [Google Scholar] [CrossRef] [PubMed]
- Yan, T.; Wang, J.; Huang, J. Urbanization, agricultural water use, and regional and national crop production in China. Ecol. Model. 2015, 318, 226–235. [Google Scholar] [CrossRef]
- Tuong, T.P.; Bouman, B.A. Rice production in water-scarce environments. Water Product. Agric. Limits Oppor. Improv. 2003, 1, 13–42. [Google Scholar]
- Zhang, L.; Xu, Q. Research progress in transcription factors related to drought tolerance of rice. Acta Agric. Jiangxi 2014, 26, 5–11. [Google Scholar]
- Shim, J.S.; Jeong, H.I.; Bang, S.W.; Jung, S.E.; Kim, G.; Kim, Y.S.; Redillas, M.C.F.R.; Oh, S.-J.; Seo, J.S.; Kim, J.-K. Drought-induced branched-chain amino acid aminotransferase enhances drought tolerance in rice. Plant Physiol. 2023, 191, 1435–1447. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.S.; Ahmad, D.; Khan, M.A. Utilization of genes encoding osmoprotectants in transgenic plants for enhanced abiotic stress tolerance. Electron. J. Biotechnol. 2015, 18, 257–266. [Google Scholar] [CrossRef]
- Boriboonkaset, T.; Theerawitaya, C.; Yamada, N.; Pichakum, A.; Supaibulwatana, K.; Cha-Um, S.; Takabe, T.; Kirdmanee, C. Regulation of some carbohydrate metabolism-related genes, starch and soluble sugar contents, photosynthetic activities and yield attributes of two contrasting rice genotypes subjected to salt stress. Protoplasma 2013, 250, 1157–1167. [Google Scholar] [CrossRef]
- Gujjar, R.S.; Roytrakul, S.; Chuekong, W.; Supaibulwatana, K. A synthetic cytokinin influences the accumulation of leaf soluble sugars and sugar transporters, and enhances the drought adaptability in rice. 3 Biotech 2021, 11, 369. [Google Scholar] [CrossRef]
- Kaur, H.; Manna, M.; Thakur, T.; Gautam, V.; Salvi, P. Imperative role of sugar signaling and transport during drought stress responses in plants. Physiol. Plant. 2021, 171, 833–848. [Google Scholar] [CrossRef]
- Hennion, N.; Durand, M.; Vriet, C.; Doidy, J.; Maurousset, L.; Lemoine, R.; Pourtau, N. Sugars en route to the roots. Transport, metabolism and storage within plant roots and towards microorganisms of the rhizosphere. Physiol. Plant. 2019, 165, 44–57. [Google Scholar] [CrossRef]
- Scofield, G.N.; Hirose, T.; Aoki, N.; Furbank, R.T. Involvement of the sucrose transporter, OsSUT1, in the long distance pathway for assimilate transport in rice. J. Exp. Bot. 2007, 58, 3155–3169. [Google Scholar] [CrossRef]
- Eom, J.-S.; Nguyen, C.D.; Lee, D.-W.; Lee, S.-K.; Jeon, J.-S. Genetic complementation analysis of rice sucrose transporter genes in Arabidopsis SUC2 mutant atsuc2. J. Plant Biol. 2016, 59, 231–237. [Google Scholar] [CrossRef]
- Ibraheem, O.; Dealtry, G.; Roux, S.; Bradley, G. The effect of drought and salinity on the expressional levels of sucrose transporters in rice (‘Oryza sativa’ Nipponbare) cultivar plants. Plant Omics 2011, 4, 68–74. [Google Scholar]
- Chen, G.; Li, J.; Du, R.; Wang, X. pOsHAK1:OsFLN2 expression enhances the drought tolerance by altering sugar metabolism in rice. Biotechnol. Bull. 2022, 38, 92–100. [Google Scholar]
- Chen, G.; Hu, J.; Dong, L.; Zeng, D.; Guo, L.; Zhang, G.; Zhu, L.; Qian, Q. The tolerance of salinity in rice requires the presence of a functional copy of FLN2. Biomolecules 2020, 10, 17. [Google Scholar] [CrossRef]
- Chen, G.; Hu, J.; Lian, J.; Zhang, Y.; Zhu, L.; Zeng, D.; Guo, L.; Yu, L.; Xu, G.; Qian, Q. Functional characterization of OsHAK1 promoter in response to osmotic/drought stress by deletion analysis in transgenic rice. Plant Growth Regul. 2019, 88, 241–251. [Google Scholar] [CrossRef]
- Braun, D.M.; Wang, L.; Ruan, Y.-L. Understanding and manipulating sucrose phloem loading, unloading, metabolism, and signalling to enhance crop yield and food security. J. Exp. Bot. 2014, 65, 1713–1735. [Google Scholar] [CrossRef]
- Lemoine, R.; La Camera, S.; Atanassova, R.; Dédaldéchamp, F.; Allario, T.; Pourtau, N.; Bonnemain, J.L.; Laloi, M.; Coutos-Thévenot, P.; Maurousset, L.; et al. Source-to-sink transport of sugar and regulation by environmental factors. Front. Plant Sci. 2013, 4, 272. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Wang, M.; Zhou, H.; Li, M.; Huang, L.; Yin, X.; Zhao, G.; Lin, F.; Xia, X.; Xu, G. OsSGL, a novel DUF1645 domain-containing protein, confers enhanced drought tolerance in transgenic rice and Arabidopsis. Front. Plant Sci. 2016, 7, 2001. [Google Scholar] [CrossRef] [PubMed]
- Mathan, J.; Singh, A.; Ranjan, A. Sucrose transport in response to drought and salt stress involves ABA-mediated induction of OsSWEET13 and OsSWEET15 in rice. Physiol. Plant. 2021, 171, 620–637. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Yu, J.; Qian, Q.; Shang, L. Enhancement of heat and drought stress tolerance in rice by genetic manipulation: A systematic review. Rice 2022, 15, 1–18. [Google Scholar] [CrossRef]
- Yang, P.M.; Huang, Q.C.; Qin, G.Y.; Zhao, S.P.; Zhou, J.G. Different drought-stress responses in photosynthesis and reactive oxygen metabolism between autotetraploid and diploid rice. Photosynthetica 2014, 52, 193–202. [Google Scholar] [CrossRef]
- Willekens, H.; Chamnongpol, S.; Davey, M.; Schraudner, M.; Langebartels, C.; Van Montagu, M.; Inzé, D.; Van Camp, W. Catalase is a sink for H2O2 and is indispensable for stress defence in C3 plants. EMBO J. 1997, 16, 4806–4816. [Google Scholar] [CrossRef]
- Ye, N.; Zhu, G.; Liu, Y.; Li, Y.; Zhang, J. ABA controls H2O2 accumulation through the induction of OsCATB in rice leaves under water stress. Plant Cell Physiol. 2011, 52, 689–698. [Google Scholar] [CrossRef]
- Liu, J.; Shen, J.; Xu, Y.; Li, X.; Xiao, J.; Xiong, L. Ghd2, a CONSTANS-like gene, confers drought sensitivity through regulation of senescence in rice. J. Exp. Bot. 2016, 67, 5785–5798. [Google Scholar] [CrossRef]
- Wang, Z.; Wang, Y.; Hong, X.; Hu, D.; Liu, C.; Yang, J.; Li, Y.; Huang, Y.; Feng, Y.; Gong, H.; et al. Functional inactivation of UDP-N-acetylglucosamine pyrophosphorylase 1 (UAP1) induces early leaf senescence and defence responses in rice. J. Exp. Bot. 2015, 66, 973–987. [Google Scholar] [CrossRef]
- Jiang, H.; Chen, Y.; Li, M.; Xu, X.; Wu, G. Overexpression of SGR results in oxidative stress and lesion-mimic cell death in rice seedlings. J. Integr. Plant Biol. 2011, 53, 375–387. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Qiu, Y.; Hu, Y.; Yu, D. Heterologous expression of AtWRKY57 confers drought tolerance in Oryza sativa. Front. Plant Sci. 2016, 7, 145. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Lv, B.; Luo, L.; He, J.; Mao, C.; Xi, D.; Ming, F. The NAC-type transcription factor OsNAC2 regulates ABA-dependent genes and abiotic stress tolerance in rice. Sci. Rep. 2017, 7, 40641. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Han, S.; Sun, X.; Khan, N.U.; Zhong, Q.; Zhang, Z.; Zhang, H.; Ming, F.; Li, Z.; Li, J. Variations in OsSPL10 confer drought tolerance by directly regulating OsNAC2 expression and ROS production in rice. J. Integr. Plant Biol. 2023, 65, 918–933. [Google Scholar] [CrossRef] [PubMed]
- Xiang, Y.; Tang, N.; Du, H.; Ye, H.; Xiong, L. Characterization of OsbZIP23 as a key player of the basic leucine zipper transcription factor family for conferring abscisic acid sensitivity and salinity and drought tolerance in rice. Plant Physiol. 2008, 148, 1938–1952. [Google Scholar] [CrossRef] [PubMed]
- Zong, W.; Tang, N.; Yang, J.; Peng, L.; Ma, S.; Xu, Y.; Li, G.; Xiong, L. Feedback regulation of ABA signaling and biosynthesis by a bZIP transcription factor targets drought-resistance-related genes. Plant Physiol. 2016, 171, 2810–2825. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Xin, W.; Sun, S.; Shen, Q.; Xu, G. Physiological and molecular responses of nitrogen-starved rice plants to re-supply of different nitrogen sources. Plant Soil 2006, 287, 145–159. [Google Scholar] [CrossRef]
- Li, Q.; Yang, A.; Zhang, W.H. Efficient acquisition of iron confers greater tolerance to saline-alkaline stress in rice (Oryza sativa L.). J. Exp. Bot. 2016, 67, 6431–6444. [Google Scholar] [CrossRef]
- Chen, G.; Zhang, Y.; Ruan, B.; Guo, L.; Zeng, D.; Gao, Z.; Zhu, L.; Hu, J.; Ren, D.; Yu, L.; et al. OsHAK1 controls the vegetative growth and panicle fertility of rice by its effect on potassium-mediated sugar metabolism. Plant Sci. 2018, 274, 261–270. [Google Scholar] [CrossRef]
- Chen, G.; Hu, Q.; Luo, L.; Yang, T.; Zhang, S.; Hu, Y.; Yu, L.; Xu, G. Rice potassium transporter OsHAK1 is essential for maintaining potassium-mediated growth and functions in salt tolerance over low and high potassium concentration ranges. Plant Cell Environ. 2015, 38, 2747–2765. [Google Scholar] [CrossRef]
- Li, Y.; Gu, M.; Zhang, X.; Zhang, J.; Fan, H.; Li, P.; Li, Z.; Xu, G. Engineering a sensitive visual-tracking reporter system for real-time monitoring phosphorus deficiency in tobacco. Plant Biotechnol. J. 2014, 12, 674–684. [Google Scholar] [CrossRef]
- Song, W.; Makeen, K.; Wang, D.; Zhang, C.; Xu, Y.; Zhao, H.; Tu, E.; Zhang, Y.; Shen, Q.; Xu, G. Nitrate supply affects root growth differentially in two rice cultivars differing in nitrogen use efficiency. Plant Soil 2011, 343, 357–368. [Google Scholar] [CrossRef]
- Zhao, Y.; Ma, Q.; Jin, X.; Peng, X.; Liu, J.; Deng, L.; Yan, H.; Sheng, L.; Jiang, H.; Cheng, B. A novel maize homeodomain–leucine zipper (HD-Zip) I gene, Zmhdz10, positively regulates drought and salt tolerance in both rice and Arabidopsis. Plant Cell Physiol. 2014, 55, 1142–1156. [Google Scholar] [CrossRef] [PubMed]
- Guo, C.; Luo, C.; Guo, L.; Li, M.; Guo, X.; Zhang, Y.; Wang, L.; Chen, L. OsSIDP366, a DUF1644 gene, positively regulates responses to drought and salt stresses in rice. J. Integr. Plant Biol. 2016, 58, 492–502. [Google Scholar] [CrossRef] [PubMed]
- Mostofa, M.G.; Fujita, M. Salicylic acid alleviates copper toxicity in rice (Oryza sativa L.) seedlings by up-regulating antioxidative and glyoxalase systems. Ecotoxicology 2013, 22, 959–973. [Google Scholar] [CrossRef] [PubMed]








| Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| UBQ5 | CTCGCCGACTACAACATCCA | TCTTGGGCTTGGTGTACGTCTT |
| OsSUT1 | CGGTGACCCAAAGGGAACT | TGCCCTGACACCCTGGTT |
| SGR | GCAATGTCGCCAAATGACG | GCTCACCACACTCATTCCCTAAAG |
| OsNAC2 | AAAAACAACCGCATTGGCAG | AGTCCTCATCTCCTCTGTCTAATCC |
| OsbZIP23 | GGAGCAGCAAAAGAATGAGG | GGTCTTCAGCTTCACCATCC |
| OsCATB | GGTGGGTTGATGCTCTCTCA | ATTCCTCCTGGCCGATCTAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, G.; Lian, W.; Geng, A.; Wang, Y.; Liu, M.; Zhang, Y.; Wang, X. pOsHAK1:OsSUT1 Promotes Sugar Transport and Enhances Drought Tolerance in Rice. Int. J. Mol. Sci. 2024, 25, 2158. https://doi.org/10.3390/ijms25042158
Chen G, Lian W, Geng A, Wang Y, Liu M, Zhang Y, Wang X. pOsHAK1:OsSUT1 Promotes Sugar Transport and Enhances Drought Tolerance in Rice. International Journal of Molecular Sciences. 2024; 25(4):2158. https://doi.org/10.3390/ijms25042158
Chicago/Turabian StyleChen, Guang, Wenli Lian, Anjing Geng, Yihan Wang, Minghao Liu, Yue Zhang, and Xu Wang. 2024. "pOsHAK1:OsSUT1 Promotes Sugar Transport and Enhances Drought Tolerance in Rice" International Journal of Molecular Sciences 25, no. 4: 2158. https://doi.org/10.3390/ijms25042158
APA StyleChen, G., Lian, W., Geng, A., Wang, Y., Liu, M., Zhang, Y., & Wang, X. (2024). pOsHAK1:OsSUT1 Promotes Sugar Transport and Enhances Drought Tolerance in Rice. International Journal of Molecular Sciences, 25(4), 2158. https://doi.org/10.3390/ijms25042158

