Next Article in Journal
Novel Dithiocarbamic Flavanones with Antioxidant Properties—A Structure–Activity Relationship Study
Previous Article in Journal
EWSR1::ATF1 Translocation: A Common Tumor Driver of Distinct Human Neoplasms
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Selection of GABA-Producing Lactic Acid Bacteria Strains by Polymerase Chain Reaction Using Novel gadB and gadC Multispecies Primers for the Development of New Functional Foods

Food Technology Department, National Institute for Agricultural and Food Research and Technology (INIA-CSIC), Carretera de La Coruña Km 7.5, 28040 Madrid, Spain
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(24), 13696; https://doi.org/10.3390/ijms252413696
Submission received: 29 November 2024 / Revised: 16 December 2024 / Accepted: 19 December 2024 / Published: 21 December 2024

Abstract

:
Gamma-aminobutyric acid (GABA) has been attributed to health-promoting properties and has received attention from the food industry as an attractive bioactive compound for the development of functional foods. Some lactic acid bacteria (LAB) produce GABA through a glutamate decarboxylase encoded by gadB and a glutamate/GABA antiporter encoded by gadC. In this study, we develop a molecular screening method based on a polymerase chain reaction able to detect those genes in different LAB species through the use of novel multispecies primers. PCR was performed in 92 LAB strains of six different species. The primer pair designed for gadB allowed its identification in Lactiplantibacillus plantarum, Lactococcus cremoris, Lactococcus lactis, Levilactobacillus brevis, Limosilactobacillus fermentum, and Limosilactobacillus reuteri strains. For gadC, two different primer pairs were designed for its detection in different species. Glutamate decarboxylase activity (GAD assay) and GABase enzymatic quantification were also assessed. Among those strains showing glutamate decarboxylase activity, 93.2% harbored the gadB gene, and those showing GABA production had the gadB gene and exhibited glutamate decarboxylase activity. PCR detection of gadB correlates strongly with GABA production and constitutes a good strategy for the selection of LAB with high yields (>18 mM) that could be used for the development of GABA-enriched functional foods.

1. Introduction

GABA is a major inhibitory neurotransmitter in the adult mammalian brain, considered a functional molecule with different situational functions in the central nervous system, the peripheral nervous system, and some non-neuronal tissues [1]. It has been known as an antihypertensive for decades when orally administered in supplements or fermented foods [2,3,4,5]. Moreover, it has other attributed physiological properties as an antidepressant [6] and an attributed cholesterol-lowering effect [7].
The ability to produce y-aminobutyric acid (GABA) through glutamate decarboxylase (GAD) constitutes an acid resistance mechanism found in some Gram-negative and Gram-positive bacteria [8,9,10,11]. The transformation of glutamate into GABA consumes an intracellular proton, increasing intracellular pH and providing protection in acidic conditions, which is an advantage for survival in the gastrointestinal tract or in fermented foods [12]. The production of GABA has been reported previously in LAB strains of a wide variety of species, such as Lactococcus lactis, Lactiplantibacillus plantarum, Levilactobacillus brevis, and many others [12,13,14,15,16].
GABA-producing LAB strains have been applied to obtain enriched fermented foods throughout fermentation [17]. GABA content in fermented foods depends on very different factors, such as the food matrix (dairy or vegetable), time of ripening, temperature, pH, starter cultures, or indigenous microbiota [18,19]. Thus, isolating LAB strains that are able to produce high GABA yields is an essential preliminary step for the development of GABA-enriched fermented foods.
In LAB, the GAD system, encoded by the gad operon, is responsible for glutamate decarboxylation and GABA secretion. The organization of this operon varies among different species and consists of two important elements: GAD encoded by either gadA or gadB and glutamate/GABA antiporter encoded by gadC [12,20]. Different authors have designed primers for detections of gadB and/or gadC in LAB [11,21,22,23], but these primers were species-specific. Therefore, our objective was to develop a molecular method for the detection of the genes involved in GABA production that could be applied to identify potential GABA-producing strains belonging to different LAB species. For this purpose, we developed non-degenerate and degenerate primers, which were designed by multiple sequence alignments of gadB and gadC genes from strains of different LAB species and genera for the detection of these genes by polymerase chain reaction (PCR). This molecular method will be more specific and will enable faster screening for GABA-producing strains belonging to different LAB species.
Hence, in this work, we tested the ability to produce GABA in 92 LAB strains belonging to the INIA bacterial collection by detecting gadB and gadC genes by PCR using the designed primes as well as determining their glutamate decarboxylase activity via a colorimetric method [8] and by the quantification of GABA by means of the GABA enzymatic assay.

2. Results

2.1. Optimization of PCR Conditions and Subsequent Detection of gadB and gadC Genes in LAB Strains

The alignments of the genes gadB or gadC of LAB strains presented in Table 1 did not show conserved regions suitable for designing non-degenerate primers for all of those species. Hence, degenerate primers for gadB detection were designed with the sequences of gadB from strains belonging to Lactococcus sp., L. brevis, Limosilactobacillus fermentum, and L. plantarum, while for the detection of gadC in LAB strains, we designed two pairs of primers. Therefore, F.gadC1/R.gadC1 primers were designed for L. brevis and L. plantarum, and degenerate primers F.gadC2/R.gadC2 were designed for Lactococcus sp. or Limosilactobacillus reuteri stains (Table 1).
Optimization of PCR conditions using the designed primers is shown in Table 2. The primer pair for gadB detection required a lower concentration than the other two (0.25 M), since higher primer concentrations (0.5 or 1 M) improved gene amplification, but some non-specific bands appeared in some of the LAB strains. The pair F.gadB-R.gadB amplified a 304-nucleotide fragment from gadB in all of the strains used for the optimization, i.e., Lactococcus cremoris, L. lactis, L. brevis, and L. plantarum strains (Table 2). The pair F.gadC1/R.gadC1 amplified a 397-nucleotide fragment from gadC in L. brevis, while the pair F.gadC2/R.gadC2 amplified a 184-nucleotide fragment from gadC in. L. lactis and L. cremoris strains (Table 2).
We performed PCR using the designed primers and the optimized conditions in 92-LAB strains belonging to different species. PCR analysis revealed 63 positive strains for gadB, while only 29 were positive for both gadB and gadC (Table 3 and Table 4). The gene gadB was detected in L. plantarum, L. fermentum, L. reuteri, L. lactis, and L. cremoris strains. On the other hand, the primer pair F.gadC1/R.gadC2 showed amplification in only two L. plantarum strains, while the couple F.gadC2/RgadC2 resulted in positive results in 22 L. lactis and 5 L. cremoris strains (Figure 1).
Five out of the eight L. cremoris strains tested positive for gadB and gadC. Among the 42 strains tested, 27 harbored gadB, and 22 also had gadC. The gene gadB was detected in all except 2 of the 29 L. plantarum strains, but only 2 of them were positive for gadC. Among the L. brevis strains, none were positive for the presence of gadB or gadC. Three out of four L. fermentum strains and one out of four L. reuteri strains tested positive for gadB, while none of them were positive for gadC (Table 3 and Table 4).

2.2. Screening of GABA-Producing LAB Strains by the Glutamate Descarboxylase (GAD) Assay

Among the 92 LAB strains included in this study, 59 tested positive in the GAD assay as they showed color change after incubation in the GAD reagent (Table 3). Positive strains belonged to L. plantarum (28/29 strains), L. cremoris (1/8 strains), L. lactis (25/42 strains), L. fermentum (3/4 strains), and L. reuteri (2/4 strains). A total of 93.2% of the strains positive in the GAD assay harbored the gadB gene, while only 49.1% harbored gadC (Table 4). All L. lactis strains positive for the GAD assay were also positive for gadB, and most of them for gadC, while among the L. cremoris with gadB, only one showed GAD activity.

2.3. Quantification of GABA in Supernatants of LAB Strains by GABase

GABA production in LAB strains was detected and quantified by the GABase enzymatic method. For this, we used supernatants obtained from cultures incubated in MRS-MSG. Detectable amounts of GABA were recorded by GABase in 44 LAB strains (Table 3). All strains tested positive for the GAD assay and gadB gene and belonged to L. plantarum (22 strains), L. lactis (20 strains), and L. fermentum (2 strains). Most of these strains exhibited low amounts of GABA in supernatants. Nevertheless, significantly higher GABA yields were observed in several L. lactis strains (INIA Z108, INIA Z109, INIA Z110, INIA Z111, and INIA Z1174), while the highest amount of GABA was exhibited by the L. plantarum DTA 369 strain (Table 4).

3. Discussion

The isolation of LAB strains able to produce high GABA yields is of great interest to the food and pharmaceutical industry because of their potential as psychobiotics, defined as living microorganisms able to improve mental wellness by the release of neuroactive substances, such as GABA [24]. This inhibitory neurotransmitter is known to produce a calming effect as it plays a significant role in controlling nerve cell hyperactivity associated with mental health issues like anxiety, fear, and stress. Moreover, studies with germ-free mice have highlighted the effect of gut microbiota on GABA production and the mental health of individuals [25,26].
In this study, we have developed a PCR method based on multispecies primers to detect LAB strains harboring the genes implicated in GABA production and, hence, potential GABA producers. This molecular method will be more specific and will enable faster screening for GABA-producing strains belonging to different LAB species, as it only requires a PCR reaction from colony suspensions without requiring a previous DNA extraction protocol. This method has been tested with only 92 strains, and it is limited to 6 LAB species. A higher number of strains and species should be tested to evaluate this method in other LAB species, especially in the case of primers specifically designed for gadB.
A detection method for the gadB gene in GABA-producing strains using species-specific primers for L. lactis, L. plantarum, and S. thermophilus was previously developed by Valenzuela et al. [22]. On the other hand, Laroute et al. [21] designed specific primers for the detection of gadB and gadC in L. lactis and L. cremoris. In the present study, we aligned the gadB sequences from L. brevis ATCC376, L. lactis IL1403, L. fermentum F6, and L. plantarum KACC92189, not finding suitable consensus sequences for the development of primers that would allow the detection of these genes. Therefore, it was necessary to develop degenerate primers to overcome variations between sequences of different LAB species. The design of degenerate primers in this study for the detection of gadB in different LAB species and genera allowed us to detect this gene in strains belonging to L. brevis, L. cremoris, L. fermentum, L. reuteri, L. lactis, and L. plantarum.
The development of specific primers for gadC detection has been more complex as the alignment of gadC sequences of different LAB species showed the difficulty of developing a single primer pair that could work for the different LAB species mentioned above. Thus, in this case, we designed two different primer couples for gadC detection. Primer pair F.gadC1/R.gadC1 was designed for gadC detection in L. brevis and L. plantarum strains. The other pair of degenerate primers for gadC (F.gadC2/R.gadC2) was designed for lactococci and L. reuteri and worked with L. cremoris and L. lactis, but we could not detect gadC in any L. reuteri or L. fermentum strain tested.
From this analysis, we can conclude that L. plantarum DTA 369, with only gadB, exhibited the highest GABA yields of all strains tested, while other L. plantarum strains with both gadB and gadC showed significantly lower yields. In contrast, L. lactis INIA Z108, INIA Z109, INIA Z110, INIA Z111, and INIA Z174 strains, with the highest GABA yields (>18 mM), were positive for both genes and to the GAD assay, while strains with gadB, but not gadC, had significantly lower GABA production.
Results showed a good correlation between the detection of gadB and GAD activity. A total of 87.3% of the strains with the gene tested positive in the GAD assay, while GABA production was detected in 69.8% of the strains positive for gadB. Moreover, L. lactis INIA Z108, INIA Z109, INIA Z110, INIA Z111, and INIA Z174 strains, with the highest GABA yields (>18 mM) among the L. lactis species, were positive for gadB and gadC. In contrast, the only two L. plantarum strains harboring both gadB and gadC had significantly lower GABA production than the strain L. plantarum DTA 369, only positive for gadB, which exhibited the highest GABA yield of all of the strains tested (24.68 mM). This strain is interesting as it also has the ability to produce riboflavin. Moreover, riboflavin overproducing spontaneous mutants from this strain have been used to ferment soy beverages, showing not only the capacity to grow and ferment soy beverages but also to produce high yields of riboflavin during fermentation in a previous study [27].
Regarding L. cremoris strains, the lack of GABA production, in spite of the presence of the genes gadB and gadC in many of the strains tested, is in concordance with the finding of other authors, who describe that the gene gadB may be inactive in many L. cremoris strains, while strains belonging to L. lactis are better GABA producers [21,22,28].
Surprisingly, none of the L. brevis strains tested were positive for the genes of the production of GABA, even though this species has been described to have a high GABA-producing capability [29].
Typically, the gad operon is located on the chromosomes of LAB species, with its organization being highly variable among different species and strains [12]. In lactococci, there is a similar genetic organization of the GAD system [21,30] with a positive regulator encoded by gadR and expressed from the PgadR promoter and the gadCB operon consisting of gadC (encoding glutamate GABA antiporter) and gadB (encoding GAD) located downstream of the PgadCB promoter, ensuring that gadB and gadC genes are co-transcribed under the same promoter, similar to the GAD system described for L. brevis [31,32]. Regarding GABA-producing L. plantarum, some authors have already described the lack of a specific glutamate/GABA antiporter gene (gadC) next to gadB [11,32], which is consistent with the results obtained in this work, as only 2 out of the 22 GABA-producing strains were positive for this gene.
Based on these results, the PCR detection of gadB constitutes a good strategy for the selection of potential GABA-producing LAB strains, reducing the number of strains to be further analyzed for GABA quantification. Finding GABA-producing LAB strains is of great importance to the food industry as most of their species are recognized as safe, hold the QPS status [33], and are able to ferment different food matrixes. In this study, we have selected up to five high GABA-producing strains, four L. lactis, and one L. plantarum, which will be used in further studies for the development of functional foods, such as GABA-enriched fermented vegetable beverages, as previously developed with other bioactive compounds by our group [27]. On the other hand, the optimization of fermentation conditions, such as temperature, pH, or glutamate addition, and/or the heterologous expression of gadB and/or gadC will be of great interest for obtaining higher GABA yields in these functional beverages.

4. Materials and Methods

4.1. Bacterial Strains

LAB strains used in this work were obtained from the bacterial collection of the National Institute for Agricultural and Food Research and Technology (INIA-CSIC). Ninety-two strains were selected belonging to the species L. brevis, L. cremoris, L. lactis, L. fermentum, L. reuteri, and L. plantarum (Table 3). L. cremoris MG1363, L. lactis IL1403, and L. brevis ATCC367, with gadB and gadC genes, and L. plantarum WCFS1, with gadB, were included as positive controls. L. rhamnosus DSM 20021, without gadB and gadC genes, was used as a negative control. The strains were maintained at 30 °C with 5% glycerol and grown in MRS (de Man, Rogosa and Sharpe) at 37 °C under anaerobic conditions, with the exception of Lactococcus sp. strains, which were grown in M17 broth supplemented with 0.5% glucose (GM17) for 24 h at 30 °C under aerobic conditions. All media were purchased from BD Biosciences (Le Pont de Claix, France).

4.2. Detection of gadB and gadC Genes in LAB Strains by PCR Using Multispecies Primer

The sequences of the genes gadB and gadC of LAB strains were retrieved from the NCBI GenBank database. Multiple sequence alignments of these sequences with Clone Manager Suite 7 (Sci Ed Central, Cary, NC, USA) were used to design the primers. Three pairs of primers were designed (Table 2), two of them being degenerated following UPAC nomenclature: R (AG), Y (C/T), E (T/G).
For DNA preparation, 2–3 colonies growing on solid media were resuspended in 50 µL of sterile water to be directly added to the PCR mix. Initial PCR conditions tested for gad genes detection were as follows: initial denaturation at 95 °C for 5 min; 35 cycles of denaturation at 94 °C for 20 s., annealing at 48 °C for 30 s and elongation at 72 °C for 30 s; and final elongation at 72 °C for 7 min, using DNA AmpliTools Master Mix (Bigtools B&M Labs., Madrid, Spain) and following the manufacturer’s instructions. In the case of the degenerate primers for the detection of gadB and gadC, different concentrations of primers (0.25–1.0 µM) and annealing temperatures (40–50 °C) were tested. PCRs were performed in a 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA), and products were visualized using a 2% agarose gel in 0.5 X TAE (all from Sigma-Aldrich, St. Louis, MO, USA) with gel RedTM (EMD Millipore, Burlington, MA, USA). Samples and a 100 bp DNA ladder were loaded using a dye purple loading buffer (New England Biolabs, Ipswich, MA, EEUU). After running at 130 V for 30 min, gels were visualized using Gel DoTM XR+ (Bio-Rad, Hercules, CA, USA).
Once the PCR conditions were set up, we tested the presence of gadB and gadC genes with the designed primers in the 92 LAB strains. L. cremoris MG1363 and L. brevis ATCC367, and L. rhamnosus DSM 20021, were included as positive and negative controls, respectively.

4.3. Determination of the Glutamate Decarboxylase Activity (GAD Assay)

The 92 LAB strains (Table 1) were tested for glutamate decarboxylase activity by the colorimetric method described by Cotter et al. [8] and adapted to lactococci by Lacroix et al. [34]. Briefly, 5 mL of overnight cultures were centrifuged (5000× g, 20 min, 25 °C) and washed twice with 5 mL of 0.9% (w/v) NaCl solution. The resulting pellets were resuspended in 0.5 mL of the GAD reagent solution (1 g of L-glutamic acid, 0.3 mL/L of Triton X-100, 90 g/L of NaCl, and 0.05 g/L of bromocresol green, pH 4). All reagents used were purchased from Merck (Barcelona, Spain). After 4 h of incubation at 37 °C under anaerobic conditions, samples were examined for color change to green or blue, indicating GAD activity. Three independent experiments were carried out for each strain tested.

4.4. Determination and Quantification of GABA Production by the GABase Enzymatic Method

LAB strains were grown in their corresponding media for 24 h and then in MRS supplemented with 3.5% sodium glutamate (Merck) (MRS-MSG) under their optimal conditions for 48 h. Then, supernatants were obtained by centrifugation at 12,000× g, filter sterilized (0.22 µM), and frozen at −20 °C until further analysis. The quantification of GABA in supernatants was performed using a GABase microtiter plate assay as described by Tsukatani et al. [35] with some modifications. A GABase reagent was prepared in Tris-HCI buffer (80 mM, pH 9.0) containing 750 mL sodium sulfate, 10 mM dithiothreitol, 1.4 mM NADP+, 20 mM α-ketoglutarate, and GABase (0.07 U/mL). All reagents used were purchased from Merck. A total volume of 90 µL of the GABase reagent and 10 µL of a standard or sample solution, both diluted 1:2 in water, were added to each well of a 96-well microtiter plate (Thermo Fisher Scientific, Waltham, MA, USA). Blank wells without enzymes were included for each sample or standard. After 120 min of incubation at 30 °C, NADPH formation was measured at 340 nm using a microplate reader (Varioskan Flash, Thermo Electron Corporation, Helsinki, Finland). Data obtained (n = 6) were analyzed by ANOVA using a general linear model (SPSS Statistics 22.0. IBM Corp., New York, NY, USA). Comparison of means between different GABA-producing strains was carried out by Tukey’s multiple range test at p < 0.01.

5. Conclusions

In this study, we have developed different multispecies primers for the PCR detection of gadB and gadC genes in LAB, involved in the production and transport of GABA, respectively. By performing PCR using the designed primers for gadB, we were able to detect this gene within a pool of 92 strains belonging to six different LAB species. Similarly, the two primer pairs designed for gadC allowed the detection of this gene by PCR in four different LAB species. Based on these results, the PCR detection of gadB constitutes a good strategy for the selection of GABA-producing LAB strains, reducing the number of strains to be further analyzed for GABA quantification. Selected strains could be used for the development of GABA-enriched functional foods.

Author Contributions

Conceptualization, S.L. and J.M.L.; methodology, S.L., S.S., S.R., J.A.F., Á.P. and J.M.L.; formal analysis, S.L., S.S., J.A.F., S.R. and Á.P.; curation, S.S., J.A.F., Á.P. and S.R.; writing original draft preparation, S.L., Á.P., J.A.C. and J.M.L.; writing-review and editing, S.L., Á.P., J.A.C. and J.M.L.; Supervision, S.L. and J.M.L.; project administration, J.M.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the project PID2020-11960RB-100 from the Spanish Ministry of Science and Innovation.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Watanabe, M.; Maemura, K.; Kanbara, K.; Tamayama, T.; Hayasaki, H. GABA and GABA receptors in the central nervous system and other organs. Int. Rev. Cytol. 2002, 213, 1–47. [Google Scholar] [CrossRef]
  2. Inoue, K.; Shirai, T.; Ochiai, H.; Kasao, M.; Hayakawa, K.; Kimura, M.; Sansawa, H. Blood-pressure-lowering effect of a novel fermented milk containing gamma-aminobutyric acid (GABA) in mild hypertensives. Eur. J. Clin. Nutr. 2003, 57, 490–495. [Google Scholar] [CrossRef] [PubMed]
  3. Liu, C.F.; Tung, Y.T.; Wu, C.L.; Lee, B.H.; Hsu, W.H.; Pan, T.M. Antihypertensive effects of Lactobacillus fermented milk orally administered to spontaneously hypertensive rats. J. Agric. Food Chem. 2011, 59, 4537–4543. [Google Scholar] [CrossRef]
  4. Matsubara, F.; Ueno, H.; Tadano, K.; Suyama, T.; Imaizumi, K.; Suzuki, T.; Magata, K.; Kikuchi, N.; Muneyuki, K.; Nakamichi, N.; et al. Effects of GABA supplementation on blood pressure and safety in adults with mild hypertension. Jpn. J. Pharmacol. Ther. 2002, 30, 963–972. [Google Scholar]
  5. Watanabe, T.; Yamada, T.; Tanaka, H.; Hang, S.; Mazumder, T.K.; Nagai, S.; Tsuji, K. Antihypertensive effect of γ-aminobutyric acid-enriched on spontaneously hypertensive rats. J. Jpn. Soc. Food Sci. 2002, 49, 166–173. [Google Scholar] [CrossRef]
  6. Wu, S.-J.; Chang, C.Y.; Lai, Y.T.; Shyu, Y.T. Increasing γ-aminobutyric acid content in vegetable soybeans via high-pressure processing and efficacy of their antidepressant like activity in mice. Food 2020, 9, 1673. [Google Scholar] [CrossRef] [PubMed]
  7. Watanabe, S.; Katsube, T.; Sonomoto, K. Cholesterol-lowering effects of isolated from Turnip “Tsuda Kabu”. Food Sci. Technol. Res. 2012, 18, 825–834. [Google Scholar] [CrossRef]
  8. Cotter, P.D.; Gahan, C.G.; Hill, C.A. glutamate decarboxylase system protects Listeria monocytogenes in gastric fluid. Mol. Microbiol. 2001, 40, 465–475. [Google Scholar] [CrossRef]
  9. Cotter, P.D.; Hill, C. Surviving the acid test. Responses of Gram-positive bacteria to low pH. Microbiol. Mol. Biol. Rev. 2003, 67, 429–433. [Google Scholar] [CrossRef] [PubMed]
  10. Foster, L.W. Escherichia coli acid resistance tales of an amateur acidophile. Nat. Rev. Microbiol. 2004, 2, 898–907. [Google Scholar] [CrossRef]
  11. Yunes, R.A.; Poluektova, E.U.; Dyachkova, M.S.; Klimina, K.M.; Kovtun, A.S.; Averina, O.V.; Orlova, V.S.; Danilenko, V.N. GABA production and structure of gadB gad genes in Lactobacillus and Bifidobacterium strains from human microbiota. Anaerobe 2016, 42, 197–204. [Google Scholar] [CrossRef] [PubMed]
  12. Yogeswara, B.A.; Maneerat, S.; Haltrich, D. Glutamate decarboxylase from lactic acid bacteria a key enzyme in GABA synthesis. Microorganisms 2020, 8, 1923. [Google Scholar] [CrossRef] [PubMed]
  13. Bhanwar, S.; Singh, A.; Ganguli, A. Probiotic characterization of potential hydrolases producing Lactococcus lactis subsp. lactis isolated from pickled yani. Dt. J. Food Sci. Nutr. 2013, 63, 53–61. [Google Scholar] [CrossRef]
  14. Edalatian Dovom, M.R.; Habibi Najafi, M.B.; Rahnama Vosough, P.; Norouzi, N.; Ebadi Nezhad, S.J.; Mayo, B. Screening of lactic acid bacteria strains isolated from Iranian traditional dairy products for GABA production and optimization by response surface methodology. Sci. Rep. 2023, 13, 440. [Google Scholar] [CrossRef]
  15. Komatsuzaki, N.; Shima, J.; Kawamoto, S.; Momose, H.; Kimura, T. Production of γ-aminobutyric acid (GABA) by Lactobacillus paracasei isolated from traditional fermented foods. Food Microbiol. 2005, 22, 497–504. [Google Scholar] [CrossRef]
  16. Redruello, B.; Saidi, Y.; Sampedro, L.; Ladero, V.; del Rio, B.; Alvarez, M.A. GABA producing Lactococcus lactis strains isolated from camel’s milk as starters for the production of GABA-enriched cheese. Food 2021, 10, 633. [Google Scholar] [CrossRef] [PubMed]
  17. Lee, X.Y.; Tan, J.S.; Cheng, L.H. Gamma aminobutyric acid (GABA) enrichment in plant-based food- a mini review. Food Rev. Int. 2023, 39, 5864. [Google Scholar] [CrossRef]
  18. Rayavarapu, B.; Tallapragada, P.; MS, U. Optimization and comparison of y aminobutyric acid (GABA) production by LAB in soymilk using RSM and ANN models. Beni-Suef Univ. J. Basic Appl. Sci. 2021, 10, 14. [Google Scholar] [CrossRef]
  19. Xiao, T.; Shah, N.P. Lactic acid produced by Streptococcus thermophilus activated glutamate decarboxylase (GadA) in Lactobacillus brevis NPS-QW 145 to improve γ-amino butyric acid production during soymilk fermentation. LWT 2021, 137, 110474. [Google Scholar] [CrossRef]
  20. Cui, Y.; Miao, K.; Niyaphorn, S.; Qu, X. Production of gamma-aminobutyric acid from lactic acid bacteria: A systematic review. Int. J. Mol. Sci. 2020, 21, 995. [Google Scholar] [CrossRef]
  21. Laroute, V.; Aubry, N.; Audonnet, M.; Mercier Bonin, M.; Daveran Mingot, M.L.; Cocaign Bousquet, M. Natural diversity of lactococci in y-aminobutyric acid GABA production and genetic and phenotypic determinants. Microb. Cell Fact. 2023, 22, 178. [Google Scholar] [CrossRef]
  22. Valenzuela, J.A.; Flórez, A.B.; Vázquez, L.; Vasek, O.M.; Mayo, B. Production of γ-aminobutyric acid (GABA) by lactic acid bacteria strains isolated from traditional, starter-free dairy products made of raw milk. Benef. Microbes 2019, 10, 579–587. [Google Scholar] [CrossRef] [PubMed]
  23. Wu, Q.; Law, Y.S.; Shah, N. Dairy Streptococcus thermophilus improves cell viability of Lactobacillus brevis NPS-QW-145 and and its γ-aminobutyric acid biosynthesis ability in milk. Sci. Rep. 2015, 5, 12885. [Google Scholar] [CrossRef] [PubMed]
  24. Dinan, T.G.; Stanton, C.; Cryan, J.F. Psychobiotics: A Novel Class of Psychotropic. Biol. Psychiatry 2013, 74, 720–726. [Google Scholar] [CrossRef] [PubMed]
  25. Dhyani, P.; Goyal, C.; Dhull, S.B.; Chauhan, A.K.; Singh Saharan, B.; Harshita; Duhan, J.S.; Goksen, G. Psychobiotics for Mitigation of Neuro-Degenerative Diseases: Recent Advancements. Mol. Nutr. Food Res. 2024, 68, 2300461. [Google Scholar] [CrossRef] [PubMed]
  26. Matsumoto, M.; Kibe, R.; Ooga, T.; Aiba, Y.; Sawaki, E.; Koga, Y.; Benno, Y. Cerebral low-molecular metabolites influenced by intestinal microbiota: A pilot study. Front. Syst. Neurosci. 2013, 7, 9. [Google Scholar] [CrossRef]
  27. Langa, S.; Peirotén, A.; Rodríguez, S.; Calzada, J.; Prieto-Paredes, R.; Curiel, J.A.; Landete, J.M. Riboflavin bio-enrichment of soy beverage by selected roseoflavin-resistant and engineered lactic acid bacteria. Int. J. Food Microbiol. 2024, 411, 110547. [Google Scholar] [CrossRef]
  28. Nomura, M.; Kobayashi, M.; Ohmomo, S.; Okamoto, T. Inactivation of the glutamate decarboxylase gene in Lactococcus lactis subsp. cremoris. Appl. Environ. Microbiol. 2000, 66, 2235–2237. [Google Scholar] [CrossRef] [PubMed]
  29. Sezgin, E.; Tekin, B. Molecular evolution and population genetics of glutamate decarboxylase acid resistance pathway in lactic acid bacteria. Front. Genet. 2023, 14, 1027156. [Google Scholar] [CrossRef] [PubMed]
  30. Sanders, J.W.; Leenhouts, K.; Burghoorn, J.; Brands, J.R.; Venema, G.; Kok, J. A chloride-inducible acid resistance mechanism in Lactococcus lactis and its regulation. Mol. Microbiol. 1998, 27, 299–310. [Google Scholar] [CrossRef] [PubMed]
  31. Gong, L.; Ren, C.; Xu, Y. GlnR negatively regulates glutamate-dependent acid resistance in Lactobacillus brevis. Appl. Environ. Microbiol. 2020, 86, e02615-19. [Google Scholar] [CrossRef] [PubMed]
  32. Wu, Q.; Tun, H.M.; Law, Y.S.; Khafipour, E.; Shah, N.P. Common distribution of gad operon in Lactobacillus brevis and its GadA contributes to efficient GABA synthesis toward cytosolic near-neutral pH. Front. Microbiol. 2017, 8, 206. [Google Scholar] [CrossRef] [PubMed]
  33. Wessels, S.; Axelsson, L.; Hansen, E.B.; De Vuyst, L.; Laulund, S.; Lähteenmäki, L.; Lindgren, S.; Mollet, B.; Salminen, S.; von Wright, A. The lactic acid bacteria, the food chain, and their regulation. Trends Food Sci. Technol. 2004, 15, 498–505. [Google Scholar] [CrossRef]
  34. Lacroix, N.; St-Gelais, D.; Champagne, C.; Vuillemard, J. Gamma-aminobutyric acid-producing abilities of lactococcal strains isolated from old-style cheese starters. Dairy Sci. Technol. 2013, 93, 315–327. [Google Scholar] [CrossRef]
  35. Tsukatani, T.; Higuchi, T.; Matsumoto, K. Enzyme-based microtiter plate assay for γ-aminobutyric acid: Application to the screening of γ-aminobutyric acid-producing lactic acid bacteria. Anal. Chim. Acta 2005, 540, 293–297. [Google Scholar] [CrossRef]
Figure 1. Representative gel electrophoresis of PCR products using primer pairs F.gadB/R.gadB for gadB detection in all strains tested; F.gadC2/R.gadC2 for gadC detection in L. lactis and L. cremoris (A); and F.gadC1/R.gadC1 for gadC detection in L. plantarum and L. brevis (B). The solid arrow indicates the predicted size of the amplicon. L. cremoris MG1363 and L. brevis ATCC367 were included as positive controls and L. rhamnosus DSM 20021 as negative control. (+) There is an amplification band and the gene is detected. (−) There is not amplification band and the gene is not detected.
Figure 1. Representative gel electrophoresis of PCR products using primer pairs F.gadB/R.gadB for gadB detection in all strains tested; F.gadC2/R.gadC2 for gadC detection in L. lactis and L. cremoris (A); and F.gadC1/R.gadC1 for gadC detection in L. plantarum and L. brevis (B). The solid arrow indicates the predicted size of the amplicon. L. cremoris MG1363 and L. brevis ATCC367 were included as positive controls and L. rhamnosus DSM 20021 as negative control. (+) There is an amplification band and the gene is detected. (−) There is not amplification band and the gene is not detected.
Ijms 25 13696 g001
Table 1. Multispecies primers designed for the amplification of gadB and gadC genes involved in the production of GABA.
Table 1. Multispecies primers designed for the amplification of gadB and gadC genes involved in the production of GABA.
PrimersSequence (5′ -> 3′)Primers
F.gadBTGGGARAAGTTCTGTRYCTACTGGgadB from L. brevis ATCC367, L. lactis IL1403, L. fermentum F6 and L. plantarum KACC92189
R.gadBACGTTCKYCARCCGGAAGTCCC
F.gadC1GCATTGTTCTACCAATGGATTCAgadC from L. brevis ATCC367 and L. plantarum KACC92189
R.gadC1TGTGGTGCCGACCCTTCGGCACC
F.gadC2GTTTCKTTYATTCTAGCTTATATGGGgadC from L. cremoris MG1363 and L. reuteri AM LB1
R.gadC2GCACTTAATGATARYTCTTTTTG
Table 2. Results of PCR optimization for the detection of gadB and gadC genes with multispecies primers.
Table 2. Results of PCR optimization for the detection of gadB and gadC genes with multispecies primers.
Primer PairF.gadB/R.gadBF.gadC1/R.gadC1F.gadC2/R.gadC2
Gen detectedgadBgadCgadC
Amplicon size (bps)304397184
Annealing temperature and time 48 °C/30 s48 °C/30 s40 °C/30 s
Primers concentration (μM)0.250.500.50
L. cremoris MG1363++
L. brevis ATCC 367++
L. lactis IL1403++
L. plantarum WCFS1+
L. rhamnosus DSM 20021
(negative control)
(+) Detected or (−) non detected amplification band with those primers and conditions.
Table 3. Summary of GABA-producing LAB strains by detection of glutamate decarboxylase activity by GAD assay (GAD activity); detection of gadB and/or gadC genes by PCR with multispecies primers; and determination by GABase enzymatic method in supernatants from 48 h cultures grown in MRS-MSG.
Table 3. Summary of GABA-producing LAB strains by detection of glutamate decarboxylase activity by GAD assay (GAD activity); detection of gadB and/or gadC genes by PCR with multispecies primers; and determination by GABase enzymatic method in supernatants from 48 h cultures grown in MRS-MSG.
SpeciesStrains
Tested 1
Positive to gadB 1Positive to gadC 1Positive by GAD Assay 1Positive by GABAse 1
L. cremoris85510
L. lactis4227222520
L. brevis50000
L. fermentum43032
L. reuteri41020
L. plantarum292722822
Total9263295944
1. Number of strains.
Table 4. Detection of gadB and/or gadC genes by PCR with multispecies primers; detection of glutamate decarboxylase activity by GAD assay (GAD activity); and determination of GABA production (mM) by GABase enzymatic method.
Table 4. Detection of gadB and/or gadC genes by PCR with multispecies primers; detection of glutamate decarboxylase activity by GAD assay (GAD activity); and determination of GABA production (mM) by GABase enzymatic method.
StrainF.gadB/
R.gadB
F.gadC1/
R.gadC1
F.gadC2/
R.gadC2
GAD
Activity
GABase
Lactiplantibacillus plantarum DTA 211+ +1.14 ± 0.19 a,b
Lactiplantibacillus plantarum DTA 330+ +0.75 ± 0.40 a
Lactiplantibacillus plantarum DTA 332+ +ND
Lactiplantibacillus plantarum DTA 336+ +ND
Lactiplantibacillus plantarum DTA 348+ +2.26 ± 0.73 a–d
Lactiplantibacillus plantarum DTA 350+ +3.95 ± 0.09 a–f
Lactiplantibacillus plantarum DTA 351+ +ND
Lactiplantibacillus plantarum DTA 352+ +ND
Lactiplantibacillus plantarum DTA 358+ +0.96 ± 0.25 a,b
Lactiplantibacillus plantarum DTA 363+ +2.80 ± 0.47 a–d
Lactiplantibacillus plantarum DTA 365+ +1.96 ± 0.40 a–c
Lactiplantibacillus plantarum DTA 369+ +24.68 ± 1.39 m
Lactiplantibacillus plantarum ESI 100++ +1.85 ± 0.46 a–c
Lactiplantibacillus plantarum ESI 104+ +2.59 ± 0.36 a–d
Lactiplantibacillus plantarum ESI 144+ +3.23 ± 0.17 a–f
Lactiplantibacillus plantarum ESI 25+ +6.55 ± 0.75 f,g
Lactiplantibacillus plantarum ESI 26+ +2.92 ± 0.21 a–d
Lactiplantibacillus plantarum ESI 27+ +4.04 ± 1.35 a–f
Lactiplantibacillus plantarum ESI 28+ +2.60 ± 0.29 a–d
Lactiplantibacillus plantarum ESI 298 +ND
Lactiplantibacillus plantarum ESI 30+ +2.13 ± 0.50 a–d
Lactiplantibacillus plantarum ESI 305 +ND
Lactiplantibacillus plantarum ESI 357+ +6.36 ± 0.72 e–f
Lactiplantibacillus plantarum ESI 38+ ND
Lactiplantibacillus plantarum ESI 42+ +2.26 ± 0.56 a–d
Lactiplantibacillus plantarum EST 128 ++ +2.06 ± 1.46 a–d
Lactiplantibacillus plantarum EST 214+ +1.74 ± 0.22 a–c
Lactiplantibacillus plantarum EST 37+ +1.33 ± 0.32 a–c
Lactiplantibacillus plantarum EST 85+ +4.56 ± 1.07 c–f
Lactococcus cremoris ESI 277 ND
Lactococcus cremoris INIA 450 ND
Lactococcus cremoris INIA Z105+ +ND
Lactococcus cremoris INIA Z113+ +ND
Lactococcus cremoris INIA Z127+ +ND
Lactococcus cremoris INIA Z151+ ++ND
Lactococcus cremoris INIA Z72+ +ND
Lactococcus cremoris TAB 24 ND
Lactococcus lactis ESI 153 ND
Lactococcus lactis ESI 240+ ++4.29 ± 0.23 b–f
Lactococcus lactis ESI 515 ND
Lactococcus lactis ESI 561 ND
Lactococcus lactis ESI 718+ +2.19 ± 0.10 a–d
Lactococcus lactis EST 187 ND
Lactococcus lactis EST 221 ND
Lactococcus lactis EST 30 ND
Lactococcus lactis EST 32 ND
Lactococcus lactis EST 45+ ++ND
Lactococcus lactis EST 5 ND
Lactococcus lactis EST 70 +ND
Lactococcus lactis EST 72 ND
Lactococcus lactis EST 86+ ++ND
Lactococcus lactis EST 89+ ++ND
Lactococcus lactis EST 91+ ++ND
Lactococcus lactis INIA 12 ND
Lactococcus lactis INIA 13 ND
Lactococcus lactis INIA 14 ND
Lactococcus lactis INIA 415+ +3.03 ± 0.35 a–e
Lactococcus lactis INIA 437+ +1.42 ± 0.14 a–c
Lactococcus lactis INIA SJ-14+ ++12.38 ± 0.19 i,j
Lactococcus lactis INIA SJ-43+ +10.75 ± 0.27 h,i
Lactococcus lactis INIA Z101+ ++8.06 ± 0.79 g,h
Lactococcus lactis INIA Z102+ ++6.44 ± 0.31 e–f
Lactococcus lactis INIA Z103+ ++5.37 ± 0.18 d–f
Lactococcus lactis INIA Z108+ ++21.11 ± 0.90 l
Lactococcus lactis INIA Z109+ ++20.47 ± 2.04 l
Lactococcus lactis INIA Z11+ ++1.01 ± 0.17 a,b
Lactococcus lactis INIA Z110+ ++18.22 ± 3.82 k,l
Lactococcus lactis INIA Z111+ ++18.23 ± 2.15 k,l
Lactococcus lactis INIA Z112+ ++11.24 ± 0.37 h,i
Lactococcus lactis INIA Z114+ ++14.85 ± 0.91 j,k
Lactococcus lactis INIA Z174+ ++18.41 ± 2.67 l
Lactococcus lactis INIA Z29+ +ND
Lactococcus lactis INIA Z34+ +ND
Lactococcus lactis INIA Z39+ +ND
Lactococcus lactis INIA Z53+ ++2.06 ± 0.20 a–d
Lactococcus lactis INIA15+ ++1.22 ± 1.12 a–c
Lactococcus lactis TAB 26+ +0.73 ± 0.50 a
Lactococcus lactis TAB 50 ND
Lactococcus lactis TAB 75 ND
Levilactobacillus brevis ESI 113 ND
Levilactobacillus brevis ESI 316 ND
Levilactobacillus brevis ESI 317 ND
Levilactobacillus brevis ESI 320 ND
Levilactobacillus brevis EST 113 ND
Limosilactobacillus fermentum 584L+ +2.26 ± 0.19 a–d
Limosilactobacillus fermentum 832L+ +ND
Limosilactobacillus fermentum INIA P143+ +3.71 ± 0.11 a–f
Limosilactobacillus fermentum S900 ND
Limosilactobacillus reuteri INIA P570 ND
Limosilactobacillus reuteri INIA P572 ND
Limosilactobacillus reuteri INIA P576 +ND
Limosilactobacillus reuteri INIA P580+ +ND
(+) Considered positive for gadB or gadC detection by PCR using those primers or positive for GAD activity. (−) Negative for gad genes or GAD activity. Values obtained by GABAse method are mean ± SD (n = 6). Superscripts (a–m) indicate significant differences according to Tukey’s test (p < 0.01). ND: Non detected.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Langa, S.; Santos, S.; Flores, J.A.; Peirotén, Á.; Rodríguez, S.; Curiel, J.A.; Landete, J.M. Selection of GABA-Producing Lactic Acid Bacteria Strains by Polymerase Chain Reaction Using Novel gadB and gadC Multispecies Primers for the Development of New Functional Foods. Int. J. Mol. Sci. 2024, 25, 13696. https://doi.org/10.3390/ijms252413696

AMA Style

Langa S, Santos S, Flores JA, Peirotén Á, Rodríguez S, Curiel JA, Landete JM. Selection of GABA-Producing Lactic Acid Bacteria Strains by Polymerase Chain Reaction Using Novel gadB and gadC Multispecies Primers for the Development of New Functional Foods. International Journal of Molecular Sciences. 2024; 25(24):13696. https://doi.org/10.3390/ijms252413696

Chicago/Turabian Style

Langa, Susana, Silvia Santos, José Antonio Flores, Ángela Peirotén, Susana Rodríguez, José Antonio Curiel, and José María Landete. 2024. "Selection of GABA-Producing Lactic Acid Bacteria Strains by Polymerase Chain Reaction Using Novel gadB and gadC Multispecies Primers for the Development of New Functional Foods" International Journal of Molecular Sciences 25, no. 24: 13696. https://doi.org/10.3390/ijms252413696

APA Style

Langa, S., Santos, S., Flores, J. A., Peirotén, Á., Rodríguez, S., Curiel, J. A., & Landete, J. M. (2024). Selection of GABA-Producing Lactic Acid Bacteria Strains by Polymerase Chain Reaction Using Novel gadB and gadC Multispecies Primers for the Development of New Functional Foods. International Journal of Molecular Sciences, 25(24), 13696. https://doi.org/10.3390/ijms252413696

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop