Application of an Anchor Mapping of Alien Chromosome (AMAC) Fragment Localization Method in the Identification of Radish Chromosome Segments in the Progeny of Rape–Radish Interspecific Hybrids
Abstract
1. Introduction
2. Results
2.1. Method of Anchor Mapping of Alien Chromosome (AMAC)
2.2. Whole-Genome IP and SSR Marker Development and Map Construction
2.2.1. Development and Mapping of Complete Genome IP and SSR Markers for Radish
2.2.2. Analysis of Radish Genome Specific-Single-Locus IP and Single-Locus SSR Markers (Compared with Brassica Crops)
2.3. Validation of Radish Genome Specific-Single-Locus IP and SSR Marker and Map Construction
2.3.1. Screening of Radish Genome Specific-Single-Locus Markers
2.3.2. Population Amplification Validation of Radish Genome Specific-Single-Locus IP and SSR Markers
2.3.3. Radish Genome Specific-Single-Locus IP and SSR Marker Map Construction
2.4. Detecting Exogenous Chromosomal Segments in the Ogura-CMS Restoration Line 16C of B. napus Based on the Method of AMAC
2.4.1. Analysis of Radish Genome-Specific Markers in Ogura-CMS Restoration Line 16C
2.4.2. Specific Marker Map of Exogenous Radish Chromosomal Segment in Ogura-CMS Restoration Line 16
3. Discussion
3.1. Batch Development of IP Markers at the Genome Level in Plants
3.2. The AMAC Method for the Rapid and Accurate Identification of Exogenous Chromosome Fragments in Distant Hybrid Offspring Lines
3.3. The Importance of Radish Genomic-Specific Molecular Markers in Assisting the Breeding of Ogura CMS Restorer Lines
4. Materials and Methods
4.1. Plant Materials and DNA Extraction
4.2. Genome Sequence
4.3. Development and Identification of Radish Genome-Specific IP and SSR Markers Based on Anchor Mapping of Alien Chromosomal Fragment (AMAC)
4.3.1. Development of Whole-Genome IP and SSR Markers Based on Radish Genome and Electronic PCR Analysis
4.3.2. Prediction of Single-Locus Markers and Genome Specific-Single-Locus Markers in Radish
4.3.3. Validation of Radish Genome Specific-Single-Locus IP and SSR Marker
4.4. Application of AMAC Method in Detecting Exogenous Chromosomal Segments in Ogura-CMS Restoration Line 16C of B. napus
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Nagaharu, U. Genome analysis in Brassica with special reference to the experimental formation of B. napus and peculiar mode of fertilization. Jpn. J. Bot. 1935, 7, 389–452. [Google Scholar]
- Chalhoub, B.; Denoeud, F.; Liu, S.; Parkin, I.; Tang, H.; Wang, X.; Chiquet, J.; Belcram, H.; Tong, C.; Samans, B.; et al. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science 2014, 345, 950–953. [Google Scholar] [CrossRef]
- Hu, D.; Jing, J.; Snowdon, R.; Mason, A.; Shen, J.; Meng, J.; Zou, J. Exploring the gene pool of Brassica napus by genomics-based approaches. Plant Biotechnol. J. 2021, 19, 1693–1712. [Google Scholar] [CrossRef]
- Li, H.; Li, J.; Song, J.; Zhao, B.; Guo, C.; Wang, B.; Zhang, Q.; Wang, J.; King, G.; Liu, K. An auxin signaling gene BnaA3.IAA7 contributes to improved plant architecture and yield heterosis in rapeseed. New Phytol. 2019, 222, 837–851. [Google Scholar] [CrossRef] [PubMed]
- Zandberg, J.; Fernandez, C.; Danilevicz, M.; Thomas, W.; Edwards, D.; Batley, J. The global assessment of oilseed brassica crop species yield, yield stability and the underlying genetics. Plants 2022, 11, 2740. [Google Scholar] [CrossRef]
- Zhou, Y.; Yang, M.; Zhao, S.; Shi, H.; Li, Y.; Gong, W.; Yang, J.; Wang, J.; Zou, Q.; Tao, L. Rapid creation of interspecific hybrid progeny to broaden genetic distance through double haploid (DH) inducer in Brassica napus. Plants 2022, 11, 695. [Google Scholar] [CrossRef]
- Qian, W.; Meng, J.; Li, M.; Frauen, M.; Sass, O.; Noack, J.; Jung, C. Introgression of genomic components from Chinese Brassica rapa contributes to widening the genetic diversity in rapeseed (B. napus L.), with emphasis on the evolution of Chinese rapeseed. Theor. Appl. Genet. 2006, 113, 49–54. [Google Scholar] [CrossRef]
- Jesske, T.; Olberg, B.; Schierholt, A.; Becker, H. Resynthesized lines from domesticated and wild Brassica taxa and their hybrids with B. napus L.: Genetic diversity and hybrid yield. Theor. Appl. Genet. 2013, 126, 1053–1065. [Google Scholar] [CrossRef] [PubMed]
- Gaebelein, R.; Alnajar, D.; Koopmann, B.; Mason, A. Hybrids between Brassica napus and B. nigra show frequent pairing between the B and A/C genomes and resistance to blackleg. Chromosome Res. 2019, 27, 221–236. [Google Scholar] [CrossRef] [PubMed]
- Brown, G.G.; Formanová, N.; Jin, H.; Wargachuk, R.; Dendy, C.; Patil, P.; Laforest, M.; Zhang, J.; Cheung, W.; Landry, B. The radish Rfo restorer gene of Ogura cytoplasmic male sterility encodes a protein with multiple pentatricopeptide repeats. Plant J. 2003, 35, 262–272. [Google Scholar] [CrossRef]
- Peterka, H.; Budahn, H.; Schrader, O.; Ahne, R.; Schütze, W. Transfer of resistance against the beet cyst nematode from radish (Raphanus sativus) to rape (Brassica napus) by monosomic chromosome addition. Theor. Appl. Genet. 2004, 109, 30–41. [Google Scholar] [CrossRef]
- Budahn, H.; Peterka, H.; Mousa, M.; Ding, Y.; Zhang, S.; Li, J. Molecular mapping in oil radish (Raphanus sativus L.) and QTL analysis of resistance against beet cyst nematode (Heterodera schachtii). Theor. Appl. Genet. 2009, 118, 775–782. [Google Scholar] [CrossRef] [PubMed]
- Hagimori, M.; Nagaoka, M.; Kato, N.; Yoshikawa, H. Production and characterization of somatic hybrids between the Japanese radish and cauliflower. Theor. Appl. Genet. 1992, 84, 819–824. [Google Scholar] [CrossRef]
- Karpechenko, G. Hybrids of Raphanus sativus L. x♂ Brassica oleracea L. Genetics 1924, 14, 375–396. [Google Scholar] [CrossRef]
- Delourme, R.; Foisset, N.; Horvais, R.; Barret, P.; Champagne, G.; Cheung, W.; Landry, B.; Renard, M. Characterisation of the radish introgression carrying the Rfo restorer gene for the Ogu-INRA cytoplasmic male sterility in rapeseed (Brassica napus L.). Theor. Appl. Genet. 1998, 97, 129–134. [Google Scholar] [CrossRef]
- Wang, T.; Guo, Y.; Wu, Z.; Xia, S.; Hua, S.; Tu, J.; Li, M.; Chen, W. Genetic characterization of a new radish introgression line carrying the restorer gene for Ogura CMS in Brassica napus. PLoS ONE 2020, 15, e0236273. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Li, M.; Wang, T.; Hui, R.; Tu, J. Development of new restorer materials with Ogu CMS in Brassica napus. Sci. Agric. Sin. 2012, 45, 1465–1474. [Google Scholar]
- Ogura, H. Studies on the new male-sterility in Japanese radish, with special reference to the utilization of this sterility towards the practical raising of hybrid seeds. Mem. Fac. Agric. Kagoshima Univ. 1968, 6, 39–78. [Google Scholar]
- Paulmann, W.; Röbbelen, G. Effective transfer of cytoplasmic male sterility from radish (Raphanus sativus L.) to rape (Brassiest napus L.). Plant Breed. 1988, 100, 299–309. [Google Scholar] [CrossRef]
- Xu, L.; Yang, J.; Xuan, P.; Luo, P.; Lan, Z. Study on distant hybridization between Brassica napus and Raphanus sativus L. Southwest Univ. (Nat. Sci. Ed.) 1995, 17, 102–106. [Google Scholar]
- Lelivelt, C.; Krens, F. Transfer of resistance to the beet cyst nematode (Heterodera schachtii Schm.) into the Brassica napus L. gene pool through intergeneric somatic hybridization with Raphanus sativus L. Theor. Appl. Gene. 1992, 83, 887–894. [Google Scholar] [CrossRef] [PubMed]
- Zhan, Z.; Jiang, Y.; Shah, N.; Hou, Z.; Zhou, Y.; Dun, B.; Li, S.; Zhu, L.; Li, Z.; Piao, Z.; et al. Association of clubroot resistance locus PbBa8.1 with a linkage drag of high erucic acid content in the seed of the European turnip. Front Plant Sci. 2020, 11, 810. [Google Scholar] [CrossRef] [PubMed]
- Sernyk, J.; Stefansson, B. White flower color in rape (Brassica napus) associated with a radish (Raphanus sativus) chromosome. Can. J. Genet. Cytol. 1982, 24, 729–734. [Google Scholar] [CrossRef]
- Cheng, X.; Xu, J.; Xia, S.; Gu, J.; Yang, Y.; Fu, J.; Zhang, S.; Wu, J.; Liu, K. Development and genetic mapping of microsatellite markers from genome survey sequences in Brassica napus. Theor. Appl. Genet. 2009, 118, 1121–1131. [Google Scholar] [CrossRef]
- Wang, G.; Niu, Y.; Wang, W.; Yue, S.; Lin, J. Transferability of tomato SSR markers to eggplants and other Solanaceous vegetables. South China Agric. Univ. 2014, 35, 56–60. [Google Scholar]
- Zu, F.; He, C.; Yang, S.; He, X.; Chen, W.; Li, J.; Zhang, G.; Zhang, G.; Wang, J. Constructing and comparing of SSR map on introgressed segment linkaged with Rfo gene for Ogu CMs restorer line 16C. Chin. J. Oil Crop Sci. 2021, 43, 771–777. [Google Scholar]
- Ding, Y.; Holger, B.; Zhao, H.; Zhao, X. Identification of F1 hybrid derived from crossing rape-radish chromosome C addition line and pakchoi by SSR molecular markers. China Veg. 2021, 46–50. [Google Scholar] [CrossRef]
- Nakatsuji, R.; Hashida, T.; Matsumoto, N.; Tsuro, M.; Kubo, N.; Hirai, M. Development of genomic and EST-SSR markers in radish (Raphanus sativus L.). Breed. Sci. 2011, 61, 413–419. [Google Scholar] [CrossRef] [PubMed]
- Hashida, T.; Nakatsuji, R.; Budahn, H.; Schrader, O.; Peterka, H.; Fujimura, T.; Kubo, N.; Hirai, M. Construction of a chromosome-assigned, sequence-tagged linkage map for the radish, Raphanus sativus L. and QTL analysis of morphological traits. Breed. Sci. 2013, 63, 218–226. [Google Scholar] [CrossRef][Green Version]
- Wang, X.; Zhao, X.; Zhu, J.; Wu, W. Genome-wide investigation of intron length polymorphisms and their potential as molecular markers in rice (Oryza sativa L.). DNA Res. 2005, 12, 417–427. [Google Scholar] [CrossRef]
- Huang, M.; Xie, F.-M.; Chen, L.-Y.; Zhao, X.-Q.; Jojee, L.; Madonna, D. Comparative analysis of genetic diversity and structure in rice using ILP and SSR markers. Rice Sci. 2010, 17, 257–268. [Google Scholar] [CrossRef]
- Muthamilarasan, M.; Suresh, B.V.; Pandey, G.; Kumari, K.; Parida, S.K.; Prasad, M. Development of 5123 intron-length polymor phic markers for large-scale genotyping applications in Foxtail millet. DNA Res. 2013, 21, 41–52. [Google Scholar] [CrossRef] [PubMed]
- Jayaswall, K.; Sharma, H.; Bhandawat, A.; Sagar, R.; Yadav, V.-K.; Sharma, V.; Mahajan, V.; Roy, J.; Singh, M. Development of intron length polymorphic (ILP) markers in onion (Allium cepa L.), and their cross-species transferability in garlic (A. sativum L.) and wild relatives. Genet. Resour. Crop Evol. 2019, 66, 1379–1388. [Google Scholar] [CrossRef]
- Stelmach, K.; Macko-Podgórni, M.; Machaj, G.; Grzebelus, D. Miniature inverted repeat transposable element insertions provide a source of intron length polymorphism markers in the Carrot (Daucus carota L.). Front. Plant Sci. 2017, 8, 261823. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; He, X.; Zu, F.; Huang, X.; Yin, S.; Wang, L.; Geng, F.; Cheng, X. Development of Genome-Wide Intron Length Polymorphism (ILP) Markers in tea plant (Camellia sinensis) and related applications for genetics research. Int. J. Mol. Sci. 2024, 25, 3241. [Google Scholar] [CrossRef]
- Zhang, L.; Cai, X.; Wu, J.; Liu, M.; Grob, S.; Cheng, F.; Liang, J.; Cai, C.; Liu, Z.; Liu, B.; et al. Improved Brassica rapa reference genome by single-molecule sequencing and chromosome conformation capture technologies. Hortic. Res. 2018, 5, 50. [Google Scholar] [CrossRef]
- Cai, C.; Wang, X.; Liu, B.; Wu, J.; Liang, J.; Cui, Y.; Cheng, F.; Wang, X. Brassica rapa genome 2.0: A reference upgrade through sequence re assembly and gene re-annotation. Mol. Plant 2017, 10, 649–651. [Google Scholar] [CrossRef]
- Bayer, P.; Golicz, A.; Tirnaz, S.; Chan, C.; Edwards, D.; Batle, J. Variation in abundance of predicted resistance genes in the Brassica oleracea pangenome. Plant Biotechnol. J. 2019, 17, 789–800. [Google Scholar] [CrossRef] [PubMed]
- Cai, X.; Wu, J.; Liang, J.; Lin, R.; Zhang, K.; Cheng, F.; Wang, X. Improved Brassica oleracea JZS assembly reveals significant changing of LTR RT dynamics in different morphotypes. Theor. Appl. Genet. 2020, 133, 3187–3199. [Google Scholar] [CrossRef] [PubMed]
- Perumal, S.; Koh, C.; Jin, L.; Buchwaldt, M.; Higgins, E.; Zheng, C.; Sankoff, D.; Robinson, S.; Kagale, S.; Navabi, Z.; et al. A high-contiguity Brassica nigra genome localizes active centromeres and defines the ancestral Brassica genome. Nat. Plants 2020, 6, 929–941. [Google Scholar] [CrossRef]
- Rousseau-Gueutin, M.; Belser, C.; Da Silva, C.; Richard, G.; Istace, B.; Cruaud, C.; Falentin, C.; Boideau, F.; Boutte, J.; Delourme, R.; et al. Long-read assembly of the Brassica napus reference genome Darmor-bzh. GigaScience 2020, 9, 1–16. [Google Scholar] [CrossRef]
- Song, J.; Guan, Z.; Hu, J.; Guo, C.; Yang, Z.; Wang, S.; Liu, D.; Wang, B.; Lu, S.; Zhou, R.; et al. Eight high-quality genomes reveal pan-genome architecture and ecotype differentiation of Brassica napus. Nat. Plants 2020, 6, 34–45. [Google Scholar] [CrossRef]
- Sun, F.; Fan, G.; Hu, Q.; Zhou, Y.; Wang, H. The high-quality genome of Brassica napus cultivar ‘ZS11’ reveals the introgression history in semi-winter morphotype. Plant J. 2017, 92, 452–468. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Liu, D.; Wang, X.; Ji, C.; Cheng, F.; Liu, B.; Hu, Z.; Chen, S.; Pental, D.; Ju, Y.; et al. The genome sequence of allopolyploid Brassica juncea and analysis of differential homoeolog gene expression influencing selection. Nat. Genet. 2016, 48, 1225–1232. [Google Scholar] [CrossRef] [PubMed]
- Paritosh, K.; Yadava, S.; Singh, P.; Bhayana, L.; Mukhopadhyay, A.; Gupta, V.; Bisht, N.; Zhang, J.; Kudrna, D.; Copetti, D.; et al. A chromosome-scale assembly of allotetraploid Brassica juncea (AABB) elucidates comparative architecture of the A and B genomes. BioRxiv 2019, 19, 602–614. [Google Scholar] [CrossRef] [PubMed]
- Jeong, Y.; Kim, N.; Ahn, B.; Oh, M.; Chung, W.; Chung, H.; Jeong, S.; Lim, K.; Hwang, Y.; Kim, G.; et al. Elucidating the triplicated ancestral genome structure of radish based on chromosome-level comparison with the Brassica genomes. Theor. Appl. Genet. 2016, 129, 1357–1372. [Google Scholar] [CrossRef] [PubMed]
- Cheng, F.; Liang, J.; Cai, C.; Cai, X.; Wu, J.; Wang, X. Genome sequencing supports a multi-vertex model for Brassiceae species. Curr. Opin. Plant Biol. 2017, 36, 79–87. [Google Scholar] [CrossRef]
- Lee, H.T.; Chawla, H.; Obermeier, C.; Dreyer, F.; Snowdon, R. Chromosome-scale assembly of winter oilseed rape Brassica napus. Front. Plant Sci. 2020, 11, 514081. [Google Scholar] [CrossRef]
- Shirasawa, K.; Hirakawa, H.; Fukino, N.; Kitashiba, H.; Isobe, S. Genome sequence and analysis of a Japanese radish (Raphanus sativus) cultivar named ‘Sakurajima Daikon’possessing giant root. DNA Res. 2020, 27, dsaa010. [Google Scholar] [CrossRef]
- Boscari, E.; Palle, S.; Vitulo, N.; Scapolatiello, A.; Schiavon, L.; Cariani, A.; Zane, L.; Marino, I.; Congiu, L. MIPs: Multi-locus intron polymorphisms in species identification and population genomics. Sci. Rep. 2024, 14, 17870. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.-W.; Wang, Z.-D.; Liu, Y.-H.; Mou, J.-M. Intronic polymorphism markers and their use in molecular breeding of tobacco species. Anhui Agric. Sci. 2008, 36, 3147–3148, 3159. [Google Scholar]
- Li, J.-W.; Li, H.; Liu, Z.-W.; Wang, Y.-X.; Chen, Y.; Yang, N.; Hu, Z.-H.; Li, T.; Zhuang, J. Molecular markers in tea plant (Camellia sinensis): Applications to evolution, genetic identification, and molecular breeding. Plant Physiol. Biochem. 2023, 198, 107704. [Google Scholar] [CrossRef]
- Yang, L.; Jin, G.; Zhao, X.; Zheng, Y.; Xu, Z.; Wu, W. PIP: A database of potential intron polymorphism markers. Bioinformatics 2007, 23, 2174–2177. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.Q.; Huang, S.; Zhan, J.; Yu, J.; Wang, X.; Hua, W.; Liu, S.; Liu, G.; Wang, H. Genome-wide microsatellite characterization and marker development in the sequenced Brassica crop species. DNA Res. 2014, 21, 53–68. [Google Scholar] [CrossRef]
- Shi, M.; Tanaka, K.; Rivera, M.; Ngure, G.; Watanabe, K. Developing novel microsatellite markers for Kaempferia parviflora by microsatellite capture sequencing (MiCAPs). Agronomy 2024, 14, 1984. [Google Scholar] [CrossRef]
- Caro, R.; Cagayan, J.; Gardoce, R.; Canama-Salinas, A.; Lantican, D.; Galvez, H.; Reao, D. Mining and validation of novel simple sequence repeat (SSR) markers derived from coconut (Cocos nucifera L.) genome assembly. J. Genet. Eng. Biotechnol. 2022, 20, 71. [Google Scholar]
- Xing, M.; Guan, C.; Guan, M. Comparative cytological and transcriptome analyses of anther development in NSA cytoplasmic male sterile (1258A) and maintainer lines in Brassica napus produced by distant hybridization. Int. J. Mol. Sci. 2022, 23, 2004. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhu, Y.; Shi, B.; Zhang, S.; Zhang, S.; Zhang, H.; Sun, R.; Zhou, J.; Li, Z.; Li, G.; et al. A MYB transcription factor from Brassica juncea regulates purple Leaves in pak choi (Brassica campestris L. ssp. chinensis). Horticulturae 2024, 10, 276. [Google Scholar] [CrossRef]
- Song, Z.; Zuo, Y.; Li, W.; Dai, S.; Liu, G.; Pu, Z.; Yan, Z. Chromosome stability of synthetic Triticum turgidum–Aegilops umbellulata hybrids. BMC Plant Biol. 2024, 24, 391. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Zhang, Y.; Yu, J.; Xiang, C.; Mei, S.; Zhou, Y.; Chen, G.; Wang, T. A new fertility restorer locus linked closely to the Rfo locus for cytoplasmic male sterility in radish. Theor. Appl. Genet. 2008, 117, 313–320. [Google Scholar] [CrossRef]
- Hu, Q.; Li, Y.; Cheng, X.; Zhang, Y.; Wu, X.; Zhou, R. Fine mapping of the recessive genic male sterility gene (Bnms3) in Brassica napus L. Theor. Appl. Genet. 2012, 124, 1321–1332. [Google Scholar]
- Li, X.; Liu, S.; Yuan, L.; Qi, B.; Li, J. Genetic analysis and fine mapping of Rfp—The restorer gene of Polima cytoplasmic male sterility in Brassica napus. Theor. Appl. Genet. 2013, 126, 179–186. [Google Scholar]
- Liu, H.; Zhang, G.; Wang, X.; Li, W.; Zhang, H.; Zou, J. Molecular mapping of the pol CMS (Brassica napus) fertility restorer gene Rfp. Theor. Appl. Genet. 2013, 126, 1869–1877. [Google Scholar]
- Hu, Q.; Li, Y.; Wang, H.; Zhang, Y.; Wang, Y.; Zhou, R. Mapping of a novel restorer-of-fertility gene in Brassica napus and development of Ogura CMS-specific markers. Mol. Breed. 2016, 36, 1–9. [Google Scholar]
- Liu, S.; Liu, Y.; Yang, X.; Tong, C.; Edwards, D.; Parkin, I.; Zhao, M.; Ma, J.; Yu, J.; Huang, S.; et al. The Brassica oleracea genome reveals the asymmetrical evolution of polyploid genomes. Nat. Commun. 2014, 5, 3930. [Google Scholar] [CrossRef]
- Zhang, X.; Liu, T.; Wang, J.; Wang, P.; Pang, Y.; Li, X.; Wang, H.; Song, J.; Zhang, W.; Yang, W.; et al. Pan-genome of Raphanus highlights genetic variation and introgression among domesticated, wild, and weedy radishes. Mol. Plant 2021, 14, 1–24. [Google Scholar] [CrossRef] [PubMed]
- Schuler, G.D. Sequence mapping by electronic PCR. Genome Res. 1997, 7, 541–550. [Google Scholar] [CrossRef]
- Habibi, N.; Al Salameen, F.; Rahman, M.; Kumar, V.; Al Amad, S.; Shajan, A.; Zakir, F.; Abdul Razzack, N.; Tinwala, W.H. Draft Genome Sequence and SSR Mining Data of Acacia Pachyceras Schwartz. Data Brief 2022, 42, 108031. [Google Scholar] [CrossRef] [PubMed]
- Chao, J.; Li, Z.; Sun, Y.; Aluko, O.; Wu, X.; Wang, Q.; Liu, G. MG2C, a user-friendly online tool for drawing genetic maps. Mol. Hortic. 2021, 1, 16. [Google Scholar] [CrossRef]
Ref. Genome | ePCR 1 Locus No.IP (No.SSR) | ePCR 2 Loci No.IP (No.SSR) | ePCR 3 Loci No.IP (No.SSR) | More than 3 Loci No.IP (No.SSR) | Total No.IP (No.SSR) |
---|---|---|---|---|---|
Rs1.0 | 97,797 (56,291) | 20,038 (8413) | 5075 (2669) | 3951 (9391) | 126,861 (76,764) |
Qing | 89,390 (44,842) | 16,935 (6068) | 4149 (1879) | 3634 (7158) | 114,108 (59,947) |
Xinlimei | 90,598 (47,180) | 16,752 (3890) | 3665 (1426) | 3407 (6011) | 114,422 (58,507) |
RS01 | 77,713 (39,353) | 22,353 (7106) | 6037 (1688) | 4884 (6427) | 110,987 (54,574) |
Ref. Genome | ePCR 1 Locus No.IP (No.SSR) | ePCR 2 Loci No.IP (No.SSR) | ePCR3 Loci No.IP (No.SSR) | More than 3 Loci No.IP (No.SSR) | Total No.IP (No.SSR) |
---|---|---|---|---|---|
B.rapa | 22,728 (2690) | 2424 (146) | 226 (16) | 79 (8) | 25,457 (2860) |
B.oleracea | 18,334 (2179) | 2015 (116) | 216 (16) | 61 (5) | 20,626 (2316) |
B.juncea | 14,113 (2644) | 13,599 (1390) | 4364 (382) | 2366 (146) | 34,442 (4562) |
B.napus | 6538 (1356) | 10,602 (1426) | 6650 (661) | 7477 (498) | 31,267 (3941) |
Chromosome | Total Length (Mb) | Count of Single-Locus IP (SSR) | Density of Single-Locus IP (SSR) | Count of Genome Specific-Single-Locus IP (SSR) | Density of Genome Specific-Single-Locus IP (SSR) |
---|---|---|---|---|---|
R01 | 51.80 | 9394 (4143) | 181.35 (79.98) | 3614 (3275) | 69.77 (63.22) |
R02 | 40.50 | 7954 (3393) | 196.40 (83.78) | 3051 (2688) | 75.33 (66.37) |
R03 | 27.90 | 5113 (2176)) | 183.26 (77.99) | 1972 (1718) | 70.68 (61.58) |
R04 | 49.80 | 9416 (4192) | 189.08 (84.18) | 3740 (3330) | 75.10 (66.87) |
R05 | 40.60 | 9684 (3665) | 238.52 (90.27) | 3749 (2893) | 92.34 (71.26) |
R06 | 26.20 | 4604 (1845) | 175.73 (70.42) | 1739 (1451) | 66.37 (55.38) |
R07 | 26.00 | 4948 (2014) | 190.31 (77.46) | 1791 (1557) | 68.88 (59.88) |
R08 | 27.60 | 3829 (1603) | 138.73 (58.08) | 1553 (1300) | 56.27 (47.10) |
R09 | 35.20 | 6226 (2748) | 176.88 (78.07) | 2309 (2148) | 65.60 (61.02) |
Average | 36.18 | 6796 (2864) | 187.84 (79.16) | 2613 (2262) | 72.22(62.52) |
Total | 325.60 | 61,168(25,780) | 187.86 (79.18) | 23,518 (20,360) | 72.23 (62.53) |
Chromosome | Total Length (Mb) | Counts of Specific Single-Locus Markers | Density of Specific Single-Locus Markers |
---|---|---|---|
R01 | 51.80 | 50 | 0.97 |
R02 | 40.50 | 42 | 1.04 |
R03 | 27.90 | 23 | 0.82 |
R04 | 49.80 | 46 | 0.92 |
R05 | 40.60 | 37 | 0.91 |
R06 | 26.20 | 29 | 1.10 |
R07 | 26.00 | 29 | 1.12 |
R08 | 27.60 | 31 | 1.12 |
R09 | 35.20 | 46 | 1.31 |
Average | 36.18 | 37 | 1.02 |
Total | 325.60 | 333 | 1.02 |
Marker ID | Forward Primer 5′-3′ | Reverse Primer 5′-3′ | Chromosome | Start | End |
---|---|---|---|---|---|
Rs1.0033353_intron_4 | AACACATGCGAATCACTGGA | AAGGGACGGTCAAGGAACTT | R09 | 9,206,762 | 9,206,971 |
Rs1.0033329_intron_17 | GCTCTCGGAAGCTGTTGTGT | CTCCCAAAACCTCGCTGTAG | R09 | 9,444,064 | 9,444,238 |
Rs1.0025941_intron_5 | CCCAGGAAGCAAAGTATGGA | CAGAGGCACAGCTGAAATTG | R09 | 10,024,454 | 10,024,660 |
Rs1.0025823_intron_3 | CCAAGGAGGGCTCTTCAACT | CGTGCTAATGGGTTTTGGAT | R09 | 10,912,208 | 10,912,415 |
Rs1.0025804_intron_1 | CAAAACCAGGGAGAAGGACA | GCAACGAGAAGCCTTTCATC | R09 | 11,031,906 | 11,032,298 |
Brassica Crops | Serial Number | Varieties | Soure |
---|---|---|---|
B. napus hybrid variety | B1 | Chuanyou45 | Sichuan |
B2 | Chuanyou81 | Sichuan | |
B3 | Chuanyou83 | Sichuan | |
B4 | Liangyou100 | Sichuan | |
B5 | Dexinyou198 | Sichuan | |
B6 | Dechaoyou797 | Sichuan | |
B7 | Demingyou700 | Sichuan | |
B8 | Xingaoyou478 | Sichuan | |
B9 | Huaza62 | Hubei | |
B10 | Fuyou2 | Fujian | |
B11 | Baoyouza2 | Yunnan | |
B12 | Baoyouza3 | Yunnan | |
B. napus conventional variety | B13 | Yunyouhuazaoshu1 | Yunnan |
B14 | Yunyoushuang2 | Yunnan | |
B15 | Huayou6 | Yunnan | |
B16 | Huayou8 | Yunnan | |
B17 | Huauyou9 | Yunnan | |
B18 | Yuhongyou4 | Yunnan | |
B. juncea variety | B19 | Baoshanhuangyoucai | Yunnan |
B20 | Fengyiliyuancaizi | Yunnan | |
B. oleracea variety | B21 | Korea Chunxiao | Korea |
B22 | Weifengniuxin | Yunnan | |
B. rapa variety | B23 | Chinese cabbage | Yunnan |
B24 | Wutacai | Jiangsu |
No. Sample | Varieties | Leaf Shape | Root Shape | Root Color | Fleshy Color |
---|---|---|---|---|---|
R1 | Tianjinshawo | Flower leaf | Spindle | Blue and white | Green |
R2 | French Breakfast | Flower leaf | Long ellipse | Water red and white | White |
R3 | Purple Plum | Flower leaf | Cone | Purple | White |
R4 | Easter Egg | Flower leaf | Rotundity | Red, white, purple, or rose | White |
R5 | Spanish Black | Flower leaf | Flat rotundity | Black or black-purple | White |
R6 | White Hail Cherry | Flat leaf | Flat rotundity | White | White |
R7 | Pioneer Cherry | Flower leaf | Rotundity | Water red | White |
R8 | Medium Red Cherry | Flower leaf | Rotundity | Water red | White |
R9 | Italian Black Long | Flower leaf | Spindle | Black or black-purple | White |
R10 | Dutch Roulade Cherry | Flower leaf | Rotundity | Red | White |
R11 | South Korean Summer White Jade | Flat leaf | Long cylinder | White | White |
R12 | Busan Spring Snow | Flower leaf | Spindle | White | White |
R13 | Dutch Yellow Cherry | Flat leaf | Long ellipse | Yellow | White |
R14 | White Cherry | Flower leaf | Flat rotundity | White | White |
R15 | Jiujindawang | Flower leaf | Long cylinder | White | White |
R16 | Xinlimei (Beijing) | Flower leaf | ellipse | Blue and white | Rose red |
R17 | Sanchibai | Flower leaf | Long cylinder | White | White |
R18 | Xinlinmei | Flower leaf | ellipse | Blue | Purplish red |
R19 | Ice Cream | Flower leaf | ellipse | Blue | White powder alternating |
R20 | Ziyutang Fruit | Flower leaf | Spindle | Purple | White and purple alternating |
R21 | ZIdan | Flower leaf | Cylinder | Purple | White and purple alternating |
R22 | Pineapple Fruit | Flower leaf | Spindle | Blue | Light green |
R23 | Flower Cherry | Flower leaf | Long cone | Light pink and white | White |
R24 | Weixian | Flower leaf | Spindle | Blue | Green |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zu, F.; Li, X.; Chen, W.; Wang, J.; Luo, Y.; Mehmood, S.; Fan, C.; Li, J.; Dong, Y.; Zhou, Y.; et al. Application of an Anchor Mapping of Alien Chromosome (AMAC) Fragment Localization Method in the Identification of Radish Chromosome Segments in the Progeny of Rape–Radish Interspecific Hybrids. Int. J. Mol. Sci. 2024, 25, 13687. https://doi.org/10.3390/ijms252413687
Zu F, Li X, Chen W, Wang J, Luo Y, Mehmood S, Fan C, Li J, Dong Y, Zhou Y, et al. Application of an Anchor Mapping of Alien Chromosome (AMAC) Fragment Localization Method in the Identification of Radish Chromosome Segments in the Progeny of Rape–Radish Interspecific Hybrids. International Journal of Molecular Sciences. 2024; 25(24):13687. https://doi.org/10.3390/ijms252413687
Chicago/Turabian StyleZu, Feng, Xia Li, Wei Chen, Jingqiao Wang, Yanqing Luo, Sultan Mehmood, Chuchuan Fan, Jinfeng Li, Yunsong Dong, Yongming Zhou, and et al. 2024. "Application of an Anchor Mapping of Alien Chromosome (AMAC) Fragment Localization Method in the Identification of Radish Chromosome Segments in the Progeny of Rape–Radish Interspecific Hybrids" International Journal of Molecular Sciences 25, no. 24: 13687. https://doi.org/10.3390/ijms252413687
APA StyleZu, F., Li, X., Chen, W., Wang, J., Luo, Y., Mehmood, S., Fan, C., Li, J., Dong, Y., Zhou, Y., & Li, G. (2024). Application of an Anchor Mapping of Alien Chromosome (AMAC) Fragment Localization Method in the Identification of Radish Chromosome Segments in the Progeny of Rape–Radish Interspecific Hybrids. International Journal of Molecular Sciences, 25(24), 13687. https://doi.org/10.3390/ijms252413687