Inflammatory Stimulation Upregulates the Receptor Transporter Protein 4 (RTP4) in SIM-A9 Microglial Cells
Abstract
1. Introduction
2. Results
2.1. Changes in RTP4 mRNA Levels After LPS Treatment in SIM-A9 Microglial Cell Line
2.2. Alterations in RTP4 Expression Following LPS Treatment in SIM-A9 Microglial Cell Line: A Study of Immunofluorescence Analysis
2.3. Alterations in mRNA Levels of Inflammatory Mediators Following LPS Treatment in the SIM-A9 Microglial Cell Line
2.4. Alterations in Interferon mRNA Levels Following LPS Treatment in SIM-A9 Microglial Cell Line
2.5. The Effect of Neutralizing Antibody Targeting TLR4 or IFN Receptor (IFNR) and of Inhibitors of TLR4 or IFNR Signaling Molecules on LPS-Induced Upregulation of RTP4 Levels
2.6. The Effect of Inhibitors of TLR4 Signaling Molecules on LPS-Induced Upregulation of RTP4 Levels
3. Discussion
3.1. Characteristics of SIM-A9 Microglial Cells as an In Vitro Model of Endogenous Microglia
3.2. The TLR4-Mediated RTP4 Induction in SIM-A9 Microglial Cells
3.3. The Interferon Receptor-Mediated Mechanism of RTP4 Induction in SIM-A9 Microglial Cells
3.4. Inverse Regulation of RTP4 Gene Expression via MAPK Signaling Pathway
3.5. The TLR4 Signal Pathways and the Mechanism of RTP4 Induction Under LPS Stimulation
3.6. The Role of RTP4 in the Inflammatory Response
3.7. Future Perspective
4. Materials and Methods
4.1. Chemicals
4.2. SIM-A9 Microglial Cell Culture and Treatment
4.3. RT-qPCR
4.4. ELISA
4.5. Immunocytochemistry
4.6. Imaging and Quantification by ImageJ Software
4.7. Data and Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Decaillot, F.M.; Rozenfeld, R.; Gupta, A.; Devi, L.A. Cell surface targeting of mu-delta opioid receptor heterodimers by RTP4. Proc. Natl. Acad. Sci. USA 2008, 105, 16045–16050. [Google Scholar] [CrossRef] [PubMed]
- Mainland, J.; Matsunami, H. RAMP like proteins: RTP and REEP family of proteins. Adv. Exp. Med. Biol. 2012, 744, 75–86. [Google Scholar] [PubMed]
- Fujita, W. The Possible Role of MOPr-DOPr Heteromers and Its Regulatory Protein RTP4 at Sensory Neurons in Relation to Pain Perception. Front. Cell Neurosci. 2020, 14, 609362. [Google Scholar] [CrossRef] [PubMed]
- Fujita, W.; Uchida, H.; Kawanishi, M.; Kuroiwa, Y.; Abe, M.; Sakimura, K. Receptor Transporter Protein 4 (RTP4) in the Hypothalamus Is Involved in the Development of Antinociceptive Tolerance to Morphine. Biomolecules 2022, 12, 1471. [Google Scholar] [CrossRef]
- Rodriguez-Gomez, J.A.; Kavanagh, E.; Engskog-Vlachos, P.; Engskog, M.K.R.; Herrera, A.J.; Espinosa-Oliva, A.M.; Joseph, B.; Hajji, N.; Venero, J.L.; Burguillos, M.A. Microglia: Agents of the CNS Pro-Inflammatory Response. Cells 2020, 9, 1717. [Google Scholar] [CrossRef] [PubMed]
- Schoggins, J.W.; Wilson, S.J.; Panis, M.; Murphy, M.Y.; Jones, C.T.; Bieniasz, P.; Rice, C.M. A diverse range of gene products are effectors of the type I interferon antiviral response. Nature 2011, 472, 481–485. [Google Scholar] [CrossRef] [PubMed]
- Boys, I.N.; Xu, E.; Mar, K.B.; De La Cruz-Rivera, P.C.; Eitson, J.L.; Moon, B.; Schoggins, J.W. RTP4 Is a Potent IFN-Inducible Anti-flavivirus Effector Engaged in a Host-Virus Arms Race in Bats and Other Mammals. Cell Host Microbe 2020, 28, 712–723.e9. [Google Scholar] [CrossRef]
- Le Pen, J.; Rice, C.M. The antiviral state of the cell: Lessons from SARS-CoV-2. Curr. Opin. Immunol. 2024, 87, 102426. [Google Scholar] [CrossRef] [PubMed]
- Du, Y.; Hu, Z.; Luo, Y.; Wang, H.Y.; Yu, X.; Wang, R.F. Function and regulation of cGAS-STING signaling in infectious diseases. Front. Immunol. 2023, 14, 1130423. [Google Scholar] [CrossRef]
- He, X.; Ashbrook, A.W.; Du, Y.; Wu, J.; Hoffmann, H.H.; Zhang, C.; Xia, L.; Peng, Y.C.; Tumas, K.C.; Singh, B.K.; et al. RTP4 inhibits IFN-I response and enhances experimental cerebral malaria and neuropathology. Proc. Natl. Acad. Sci. USA 2020, 117, 19465–19474. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Liang, R.; Yi, Y.; Zhu, J.; Zhang, J. P38alpha deficiency in macrophages ameliorates murine experimental colitis by regulating inflammation and immune process. Pathol. Res. Pract. 2022, 233, 153881. [Google Scholar] [CrossRef]
- Peng, W.; Song, Y.; Zhu, G.; Zeng, Y.; Cai, H.; Lu, C.; Abuduxukuer, Z.; Song, X.; Gao, X.; Ye, L.; et al. FGF10 attenuates allergic airway inflammation in asthma by inhibiting PI3K/AKT/NF-kappaB pathway. Cell Signal 2024, 113, 110964. [Google Scholar] [CrossRef]
- Dang, W.; Xu, L.; Yin, Y.; Chen, S.; Wang, W.; Hakim, M.S.; Chang, K.O.; Peppelenbosch, M.P.; Pan, Q. IRF-1, RIG-I and MDA5 display potent antiviral activities against norovirus coordinately induced by different types of interferons. Antivir. Res. 2018, 155, 48–59. [Google Scholar] [CrossRef] [PubMed]
- BioJPS. Available online: http://biogps.org (accessed on 19 August 2024).
- de Weerd, N.A.; Nguyen, T. The interferons and their receptors--distribution and regulation. Immunol. Cell Biol. 2012, 90, 483–491. [Google Scholar] [CrossRef]
- Loegering, D.J.; Lennartz, M.R. Protein kinase C and toll-like receptor signaling. Enzym. Res. 2011, 2011, 537821. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, H.; Kosturakis, A.K.; Cassidy, R.M.; Zhang, H.; Kennamer-Chapman, R.M.; Jawad, A.B.; Colomand, C.M.; Harrison, D.S.; Dougherty, P.M. MAPK signaling downstream to TLR4 contributes to paclitaxel-induced peripheral neuropathy. Brain Behav. Immun. 2015, 49, 255–266. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.C.; Yeh, W.C.; Ohashi, P.S. LPS/TLR4 signal transduction pathway. Cytokine 2008, 42, 145–151. [Google Scholar] [CrossRef]
- Gupta, A.; Gomes, I.; Osman, A.; Fujita, W.; Devi, L.A. Regulation of Cannabinoid and Opioid Receptor Levels by Endogenous and Pharmacological Chaperones. J. Pharmacol. Exp. Ther. 2024, 391, 279–288. [Google Scholar] [CrossRef]
- Nagamoto-Combs, K.; Kulas, J.; Combs, C.K. A novel cell line from spontaneously immortalized murine microglia. J. Neurosci. Methods 2014, 233, 187–198. [Google Scholar] [CrossRef]
- Dave, K.M.; Ali, L.; Manickam, D.S. Characterization of the SIM-A9 cell line as a model of activated microglia in the context of neuropathic pain. PLoS ONE 2020, 15, e0231597. [Google Scholar] [CrossRef] [PubMed]
- Stansley, B.; Post, J.; Hensley, K. A comparative review of cell culture systems for the study of microglial biology in Alzheimer’s disease. J. Neuroinflammation 2012, 9, 115. [Google Scholar] [CrossRef] [PubMed]
- Duan, L.; Chen, B.Y.; Sun, X.L.; Luo, Z.J.; Rao, Z.R.; Wang, J.J.; Chen, L.W. LPS-induced proNGF synthesis and release in the N9 and BV2 microglial cells: A new pathway underling microglial toxicity in neuroinflammation. PLoS ONE 2013, 8, e73768. [Google Scholar] [CrossRef] [PubMed]
- McCarthy, G.M.; Bridges, C.R.; Blednov, Y.A.; Harris, R.A. CNS cell-type localization and LPS response of TLR signaling pathways. F1000Res 2017, 6, 1144. [Google Scholar] [CrossRef]
- Xiao, L.; Yan, J.; Feng, D.; Ye, S.; Yang, T.; Wei, H.; Li, T.; Sun, W.; Chen, J. Critical Role of TLR4 on the Microglia Activation Induced by Maternal LPS Exposure Leading to ASD-Like Behavior of Offspring. Front. Cell Dev. Biol. 2021, 9, 634837. [Google Scholar] [CrossRef] [PubMed]
- Gay, N.J.; Gangloff, M. Structure and function of Toll receptors and their ligands. Annu. Rev. Biochem. 2007, 76, 141–165. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Akira, S. Signaling to NF-kappaB by Toll-like receptors. Trends Mol. Med. 2007, 13, 460–469. [Google Scholar] [CrossRef]
- Kawai, T.; Akira, S. The role of pattern-recognition receptors in innate immunity: Update on Toll-like receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef]
- Schoggins, J.W.; Rice, C.M. Interferon-stimulated genes and their antiviral effector functions. Curr. Opin. Virol. 2011, 1, 519–525. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Dong, H.; Zhang, S.; Lu, S.; Sun, J.; Qian, Y. Enhancement of LPS-induced microglial inflammation response via TLR4 under high glucose conditions. Cell Physiol. Biochem. 2015, 35, 1571–1581. [Google Scholar] [CrossRef] [PubMed]
- Escoubas, C.C.; Dorman, L.C.; Nguyen, P.T.; Lagares-Linares, C.; Nakajo, H.; Anderson, S.R.; Barron, J.J.; Wade, S.D.; Cuevas, B.; Vainchtein, I.D.; et al. Type-I-interferon-responsive microglia shape cortical development and behavior. Cell 2024, 187, 1936–1954.e24. [Google Scholar] [CrossRef]
- Kwon, J.; Arsenis, C.; Suessmilch, M.; McColl, A.; Cavanagh, J.; Morris, B.J. Differential Effects of Toll-Like Receptor Activation and Differential Mediation by MAP Kinases of Immune Responses in Microglial Cells. Cell Mol. Neurobiol. 2022, 42, 2655–2671. [Google Scholar] [CrossRef] [PubMed]
- Doni Jayavelu, N.; Jajodia, A.; Mishra, A.; Hawkins, R.D. Candidate silencer elements for the human and mouse genomes. Nat. Commun. 2020, 11, 1061. [Google Scholar] [CrossRef] [PubMed]
- El-Sappah, A.H.; Yan, K.; Huang, Q.; Islam, M.M.; Li, Q.; Wang, Y.; Khan, M.S.; Zhao, X.; Mir, R.R.; Li, J.; et al. Comprehensive Mechanism of Gene Silencing and Its Role in Plant Growth and Development. Front. Plant Sci. 2021, 12, 705249. [Google Scholar] [CrossRef] [PubMed]
- Kontny, E.; Kurowska, M.; Szczepanska, K.; Maslinski, W. Rottlerin, a PKC isozyme-selective inhibitor, affects signaling events and cytokine production in human monocytes. J. Leukoc. Biol. 2000, 67, 249–258. [Google Scholar] [CrossRef]
- Asehnoune, K.; Strassheim, D.; Mitra, S.; Yeol Kim, J.; Abraham, E. Involvement of PKCalpha/beta in TLR4 and TLR2 dependent activation of NF-kappaB. Cell Signal 2005, 17, 385–394. [Google Scholar] [CrossRef] [PubMed]
- Fronhofer, V.; Lennartz, M.R.; Loegering, D.J. Role of PKC isoforms in the Fc(gamma)R-mediated inhibition of LPS-stimulated IL-12 secretion by macrophages. J. Leukoc. Biol. 2006, 79, 408–415. [Google Scholar] [CrossRef]
- McGettrick, A.F.; Brint, E.K.; Palsson-McDermott, E.M.; Rowe, D.C.; Golenbock, D.T.; Gay, N.J.; Fitzgerald, K.A.; O’Neill, L.A. Trif-related adapter molecule is phosphorylated by PKCepsilon during Toll-like receptor 4 signaling. Proc. Natl. Acad. Sci. USA 2006, 103, 9196–9201. [Google Scholar] [CrossRef] [PubMed]
- Mlcochova, P.; Winstone, H.; Zuliani-Alvarez, L.; Gupta, R.K. TLR4-Mediated Pathway Triggers Interferon-Independent G0 Arrest and Antiviral SAMHD1 Activity in Macrophages. Cell Rep. 2020, 30, 3972–3980.e5. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Lin, L.; Zhang, Z.; Zhang, H.; Hu, H. Targeting NF-kappaB pathway for the therapy of diseases: Mechanism and clinical study. Signal Transduct. Target. Ther. 2020, 5, 209. [Google Scholar] [CrossRef]
- Kawai, T.; Takeuchi, O.; Fujita, T.; Inoue, J.; Muhlradt, P.F.; Sato, S.; Hoshino, K.; Akira, S. Lipopolysaccharide stimulates the MyD88-independent pathway and results in activation of IFN-regulatory factor 3 and the expression of a subset of lipopolysaccharide-inducible genes. J. Immunol. 2001, 167, 5887–5894. [Google Scholar] [CrossRef] [PubMed]
- Akira, S.; Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004, 4, 499–511. [Google Scholar] [CrossRef]
- Kaur, R.; Tada, T.; Landau, N.R. Restriction of SARS-CoV-2 replication by receptor transporter protein 4 (RTP4). mBio 2023, 14, e0109023. [Google Scholar] [CrossRef] [PubMed]
- Sui, B.; Zheng, J.; Zhao, J.; Fu, Z.; Zhou, M.; Zhao, L. RTP4 restricts lyssavirus rabies infection by binding to viral genomic RNA. Vet. Microbiol. 2024, 295, 110159. [Google Scholar] [CrossRef] [PubMed]
- Reyimu, A.; Chen, Y.; Song, X.; Zhou, W.; Dai, J.; Jiang, F. Identification of latent biomarkers in connection with progression and prognosis in oral cancer by comprehensive bioinformatics analysis. World J. Surg. Oncol. 2021, 19, 240. [Google Scholar] [CrossRef] [PubMed]
- Hubner, A.M.; Canisso, I.F.; Peixoto, P.M.; Coelho, W.M., Jr.; Cunha, L.L.; Ribeiro, L.; Crump, S.; Lima, F.S. Effect of nerve growth factor-beta administered at insemination for lactating Holstein dairy cows bred after timed-artificial insemination protocol. J. Dairy. Sci. 2022, 105, 6353–6363. [Google Scholar] [CrossRef]
- Fujita, W.; Yokote, M.; Gomes, I.; Gupta, A.; Ueda, H.; Devi, L.A. Regulation of an Opioid Receptor Chaperone Protein, RTP4, by Morphine. Mol. Pharmacol. 2019, 95, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Margolis, E.B.; Hjelmstad, G.O.; Fujita, W.; Fields, H.L. Direct bidirectional mu-opioid control of midbrain dopamine neurons. J. Neurosci. 2014, 34, 14707–14716. [Google Scholar] [CrossRef]







| GAPDH-F | TGAAGGTCGGTGTGAACG |
| GAPDH-R | CAATCTCCACTTTGCCACTG |
| RTP1-F | TGGAAGCCCAGTGAGAAGC |
| RTP1-R | AGCAGAAGTTGCAGCCTGAG |
| RTP2-F | AGCTTTCTGTTCTTCCTTGGG |
| RTP2-R | GCCACCTCCATCTTCTCGTAG |
| RTP3-F | TGCAAGAGGTGAAACCCTGG |
| RTP3-R | AGGACAGTGGAACCTAGCAAAG |
| RTP4-F | GGAGCCTGCATTTGGATAAG |
| RTP4-R | GCAGCATCTGGAACACTGG |
| IL-1β-F | TGTAATGAAAGACGGCACACC |
| IL-1β-R | TCTTCTTTGGGTATTGCTTGG |
| TNFα-F | TTGCTCTGTGAAGGGAATGG |
| TNFα-R | GGCTCTGAGGAGTAGACAATAAAG |
| iNOS-F | GACGAGACGGATAGGCAGAG |
| iNOS-R | GTGGGGTTGTTGCTGAACTT |
| IFN-α-F | AGGACAGGAAGGATTTTGGA |
| IFN-α-R | GCTGCTGATGGAGGTCATT |
| IFN-β-F | CATCAACTATAAGCAGCTCCA |
| IFN-β-R | TTCAAGTGGAGAGCAGTTGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fujita, W.; Kuroiwa, Y. Inflammatory Stimulation Upregulates the Receptor Transporter Protein 4 (RTP4) in SIM-A9 Microglial Cells. Int. J. Mol. Sci. 2024, 25, 13676. https://doi.org/10.3390/ijms252413676
Fujita W, Kuroiwa Y. Inflammatory Stimulation Upregulates the Receptor Transporter Protein 4 (RTP4) in SIM-A9 Microglial Cells. International Journal of Molecular Sciences. 2024; 25(24):13676. https://doi.org/10.3390/ijms252413676
Chicago/Turabian StyleFujita, Wakako, and Yusuke Kuroiwa. 2024. "Inflammatory Stimulation Upregulates the Receptor Transporter Protein 4 (RTP4) in SIM-A9 Microglial Cells" International Journal of Molecular Sciences 25, no. 24: 13676. https://doi.org/10.3390/ijms252413676
APA StyleFujita, W., & Kuroiwa, Y. (2024). Inflammatory Stimulation Upregulates the Receptor Transporter Protein 4 (RTP4) in SIM-A9 Microglial Cells. International Journal of Molecular Sciences, 25(24), 13676. https://doi.org/10.3390/ijms252413676

