Foliar Application of Silicon Influences the Physiological and Epigenetic Responses of Wheat Grown Under Salt Stress
Abstract
1. Introduction
2. Results
2.1. The Influence of Salt Stress and Foliar Si Supply on Chlorophyll Content Index
2.2. The Influence of Salt Stress and Foliar Si Supply on Gas Exchange
2.3. The Influence of Salt Stress and Foliar Si Supply on Chlorophyll Fluorescence
2.4. The Influence of Salt Stress and Foliar Si Supply on the DNA Methylation Level
3. Discussion
4. Materials and Methods
4.1. Plant Growth Conditions
4.2. Chlorophyll Content Measurement
4.3. Measurement of Gas Exchange Parameters
4.4. Measurement of Chlorophyll Fluorescence Parameters
4.5. Determination of Methylation-Sensitive Amplification Polymorphism (MSAP)
4.6. Methylation Data Analysis
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Parihar, P.; Singh, S.; Singh, R.; Singh, V.P.; Prasad, S.M. Effect of salinity stress on plants and its tolerance strategies: A review. Environ. Sci. Pollut. Res. 2015, 22, 4056–4075. [Google Scholar] [CrossRef] [PubMed]
- Munns, R. Genes and salt tolerance: Bringing them together. New Phytol. 2005, 167, 645–663. [Google Scholar] [CrossRef] [PubMed]
- Jadidi, O.; Etminan, A.; Azizi-Nezhad, R.; Ebrahimi, A.; Pour-Aboughadareh, A. Physiological and molecular responses of barley genotypes to salinity stress. Genes 2022, 13, 2040. [Google Scholar] [CrossRef] [PubMed]
- Arzani, A.; Ashraf, M. Smart engineering of genetic resources for enhanced salinity tolerance in crop plants. Crit. Rev. Plant Sci. 2016, 35, 146–189. [Google Scholar] [CrossRef]
- Food and Agriculture Organization. Available online: https://www.fao.org/global-soil-partnership/areas-of-work/soil-salinity/en/ (accessed on 4 November 2024).
- Arzani, A. Improving salinity tolerance in crop plants: A biotechnological view. In Vitro Cell. Dev. Biol. Plant. 2008, 44, 373–383. [Google Scholar] [CrossRef]
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef]
- Safaeighomi, J.; Batooli, H. Determination of bioactive molecules from flowers, leaves, stems and roots of Perovskia abrotanoides karel growing in central Iran by nano scale injection. Dig. J. Nanomater. Biostruct. 2010, 5, 551–556. [Google Scholar]
- Negrão, S.; Schmöckel, S.; Tester, M. Evaluating physiological responses of plants to salinity stress. Ann. Bot. 2017, 119, 1–11. [Google Scholar] [CrossRef]
- Ibrahimova, U.; Kumari, P.; Yadav, S.; Rastogi, A.; Antala, M.; Suleymanova, Z.; Ziveak, M.; Tahjib-Ul-Arif, M.; Hussain, S.; Abdelhamid, M.; et al. Progress in understanding salt stress response in plants using biotechnological tools. J. Biotechnol. 2021, 329, 180–191. [Google Scholar] [CrossRef]
- Souri, Z.; Khanna, K.; Karimi, N.; Ahmad, P. Silicon and plants: Current knowledge and future prospects. J. Plant Growth Regul. 2021, 40, 906–925. [Google Scholar] [CrossRef]
- Hameed, A.; Ahmed, M.Z.; Hussain, T.; Aziz, I.; Ahmad, N.; Gul, B.; Nielsen, B.L. Effects of salinity stress on chloroplast structure and function. Cells 2021, 10, 2023. [Google Scholar] [CrossRef] [PubMed]
- Gulzar, S.; Hussain, T.; Gul, B.; Hameed, A. Photosynthetic Adaptations and Oxidative Stress Tolerance in Halophytes from Warm Subtropical Region; Springer: Cham, Switzerland, 2020; pp. 1–31. [Google Scholar] [CrossRef]
- Laane, H.-M. The effects of foliar sprays with different silicon compounds. Plants 2018, 7, 45. [Google Scholar] [CrossRef]
- Niu, J.; Liu, C.; Huang, M.; Liu, K.; Yan, D. Effects of foliar fertilization: A review of current status and future perspectives. J. Soil Sci. Plant Nutr. 2021, 21, 104–118. [Google Scholar] [CrossRef]
- Indu, S.; Tyagi, B.; Singh, G. Enhancing wheat production-A global perspective. Indian J. Agric. Sci. 2015, 85, 3–13. [Google Scholar]
- Igrejas, G.; Branlard, G. The importance of wheat. In Wheat Quality for Improving Processing and Human Health; Springer: Berlin/Heidelberg, Germany, 2020; pp. 1–7. [Google Scholar] [CrossRef]
- Szczepanek, M.; Siwik-Ziomek, A.; Lemańczyk, G.; Lamparski, R.; Graczyk, R. Effect of reduced tillage on soil enzyme activity, pests pressure and productivity of organically grown spring wheat species. Agronomy 2023, 13, 287. [Google Scholar] [CrossRef]
- Shivaraj, S.M.; Mandlik, R.; Bhat, J.A.; Raturi, G.; Elbaum, R.; Alexander, L.; Sonah, H. Outstanding questions on the beneficial role of silicon in crop plants. Plant Cell Physiol. 2022, 63, 4–18. [Google Scholar] [CrossRef]
- Kovács, S.; Kutasy, E.; Csajbók, J. The multiple role of silicon nutrition in alleviating environmental stresses in sustainable crop production. Plants 2022, 11, 1223. [Google Scholar] [CrossRef]
- Artyszak, A. Effect of silicon fertilization on crop yield quantity and quality-A literature review in Europe. Plants 2018, 7, 54. [Google Scholar] [CrossRef]
- Ahmad, Z.; Khaliq, A.; Waraich, E.A.; Artyszak, A.; Zaman, Q.U.; Abbasi, A.; Iqbal, M.A.; Alharby, H.F.; Almaghamsi, A.A.; Qamar, M.J.; et al. Exogenously applied silicon and zinc mitigates salt stress by improving leaf pigments and antioxidant activities in canola cultivars. Silicon 2023, 15, 5435–5444. [Google Scholar] [CrossRef]
- Hellal, F.A.; Abdelhameid, M.; Abo-Basha, D.M.; Zewainy, R.M. Alleviation of the adverse effects of soil salinity stress by foliar application of silicon on faba bean (Vica faba L.). J. Appl. Sci. Res. 2012, 8, 4428–4433. [Google Scholar]
- Ashraf, M.; Harris, P.J.C. Photosynthesis under stressful environments: An overview. Photosynthetica 2013, 51, 163–190. [Google Scholar] [CrossRef]
- Al-Aghabary, K.; Zhu, Z.; Shi, Q. Influence of silicon supply on chlorophyll content, chlorophyll fluorescence, and antioxidative enzyme activities in tomato plants under salt stress. J. Plant Nutr. 2005, 27, 2101–2115. [Google Scholar] [CrossRef]
- Tobiasz-Salach, R.; Mazurek, M.; Jacek, B. Physiological, Biochemical, and Epigenetic Reaction of Maize (Zea mays L.) to Cultivation in Conditions of Varying Soil Salinity and Foliar Application of Silicon. Int. J. Mol. Sci. 2023, 24, 1141. [Google Scholar] [CrossRef] [PubMed]
- Yeşildirek, Y.V.; Arıkan, B.; Çelik, H.; Premkumar, A.; Özden, S.; Kara, N.T. Role of Silicon in Mediating Salt Stress Responses in Arabidopsis Methylation Mutants. J. Soil Sci. Plant Nutr. 2024, 24, 4471–4482. [Google Scholar] [CrossRef]
- Kooistra, L.; Clevers, J.G. Estimating potato leaf chlorophyll content using ratio vegetation indices. Remote Sens. Lett. 2016, 7, 611–620. [Google Scholar] [CrossRef]
- Ali, M.M.; Al-Ani, A.; Eamus, D.; Tan, D.K.Y. Leaf nitrogen determination using non-destructive techniques—A review. J. Plant Nutr. 2017, 40, 928–953. [Google Scholar] [CrossRef]
- Croft, H.; Chen, J.M.; Luo, X.; Bartlett, P.; Chen, B.; Staebler, R.M. Leaf chlorophyll content as a proxy for leaf photosynthetic capacity. Glob. Chang. Boil. 2017, 23, 3513–3524. [Google Scholar] [CrossRef]
- Latifinia, E.; Eisvand, H.R. Soybean physiological properties and grain quality responses to nutrients, and predicting nutrient deficiency using chlorophyll fluorescence. J. Soil Sci. Plant Nutr. 2022, 22, 1942–1954. [Google Scholar] [CrossRef]
- Wang, G.; Zeng, F.; Song, P.; Sun, B.; Wang, Q.; Wang, J. Effects of reduced chlorophyll content on photosystem functions and photosynthetic electron transport rate in rice leaves. J. Plant Physiol. 2022, 272, 153669. [Google Scholar] [CrossRef]
- Gholamin, R.; Khayatnezhad, M. Assessment of the correlation between chlorophyll content and drought resistance in corn cultivars (Zea Mays). Helix 2020, 10, 93–97. [Google Scholar] [CrossRef]
- Kalaji, H.M.; Dąbrowski, P.; Cetner, M.D.; Samborska, I.A.; Łukasik, I.; Brestic, M.; Panchal, B.M. A comparison between different chlorophyll content meters under nutrient deficiency conditions. J. Plant Nutr. 2017, 40, 1024–1034. [Google Scholar] [CrossRef]
- Avni, D.; Ashwani, K.; Arvind, K.; Satish, S.; Mann, A.; Kulshreshtha, N. Current status and future perspectives of epigenetic gene regulation for salt tolerance in wheat. In Salinity and Drought Tolerance in Plants; Springer: Berlin/Heidelberg, Germany, 2023; pp. 333–345. [Google Scholar] [CrossRef]
- Jing, J.; Chaoqun, X.; Lingyu, S.; Guo, Z.J.; Zhang, L.; Tang, H.C.; Wang, J.C.; Song, S.W.; Liu, J.W.; Zhong, Y.H.; et al. Integrative analysis of transcriptome and metabolome reveal the differential tolerance mechanisms to low and high salinity in the roots of facultative halophyte Avicennia marina. Tree Physiol. 2024, 3, 44. [Google Scholar] [CrossRef]
- Liu, L.; Sheng, L.; Longfei, M.; Yanli, Z.; Tiantian, W.; Jicheng, W.; Xiushuo, L.; Shaowu, X. Analysis of ion transport properties of Glycine max HKT transporters and identifying a regulation of GmHKT1;1 by the non-functional GmHKT1, 4. Plant Cell Physiol. 2024, 65, 1399–1413. [Google Scholar] [CrossRef] [PubMed]
- Habu, Y.; Kakutani, T.; Paszkowski, J. Epigenetic developmental mechanisms in plants: Molecules and targets of plant epigenetic regulation. Curr. Opin. Genet. Dev. 2001, 11, 215–220. [Google Scholar] [CrossRef]
- Zhong, L.; Xu, Y.H.; Wang, J.B. DNA-methylation changes induced by salt stress in wheat Triticum aestivum. Afr. J. Biotechnol. 2009, 8, 6201–6207. [Google Scholar]
- Grativol, C.; Hemerly, A.S.; Ferreira, P.C. Genetic and epigenetic regulation of stress responses in natural plant populations. Biochim. Biophys. Acta 2012, 1819, 176–185. [Google Scholar] [CrossRef]
- Seem, K.; Kaur, S.; Kumar, S.; Mohapatra, T. Epigenome editing for targeted DNA (de)methylation: A new perspective in modulating gene expression. Crit. Rev. Biochem. Mol. Biol. 2024, 9, 69–98. [Google Scholar] [CrossRef]
- Steward, N.; Ito, M.; Yamakuchi, Y.; Koizumi, N.; Sano, H. Periodic DNA methylation in maize nucleosomes and demethylation by environmental stress. J. Biol. Chem. 2002, 277, 37741–37746. [Google Scholar] [CrossRef]
- Sharif, J.; Koseki, H. Hemimethylation: DNA’s lasting odd couple. Science 2018, 359, 1102–1103. [Google Scholar] [CrossRef]
- Talarico, E.; Zambelli, A.; Araniti, F.; Greco, E.; Chiappetta, A.; Bruno, L. Unravelling the epigenetic code: DNA methylation in plants and its role in stress response. Epigenomes 2024, 8, 30. [Google Scholar] [CrossRef]
- Borges, F.; Martienssen, R.A. Establishing epigenetic variation during genome reprogramming. RNA Biol. 2013, 10, 490–494. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Schmitz, R.J.; Schultz, M.D.; Lewsey, M.G.; O’Malley, R.C.; Urich, M.A.; Libiger, O.; Schork, N.J.; Ecker, J.R. Transgenerational epigenetic instability is a source of novel methylation variants. Science 2011, 334, 369–373. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.Q.; Lu, Y.T.; Bai, M.X.; Xu, M.X.; Peng, Y.L.; Ding, Y.F.; Zhang, D.Z. Response of maize genotypes with different plant architecture to drought stress. Acta Pratacult. Sin. 2020, 29, 149–162. [Google Scholar] [CrossRef]
- Giordano, M.; Petropoulos, S.A.; Rouphael, Y. Response and defence mechanisms of vegetable crops against drought, heat and salinity stress. Agriculture 2021, 11, 463. [Google Scholar] [CrossRef]
- Saddiq, M.S.; Iqbal, S.; Hafeez, M.B.; Ibrahim, A.M.H.; Raza, A.; Fatima, E.M.; Baloch, H.; Jahanzaib; Woodrow, P.; Ciarmiello, L.F. Effect of salinity stress on physiological changes in winter and spring wheat. Agronomy 2021, 11, 1193. [Google Scholar] [CrossRef]
- Farooq, M.; Rafique, S.; Zahra, N.; Rehman, A.; Siddique, K.H. Root system architecture and salt stress responses in cereal crops. J. Agron. Crop Sci. 2024, 210, e12776. [Google Scholar] [CrossRef]
- El Sabagh, A.; Islam, M.S.; Skalicky, M.; Ali Raza, M.; Singh, K.; Anwar Hossain, M.; Arshad, A. Salinity stress in wheat (Triticum aestivum L.) in the changing climate: Adaptation and management strategies. Front. Agron. 2021, 3, 661932. [Google Scholar] [CrossRef]
- Chutipaijit, S.; Cha-um, S.; Sompornpailin, K. High contents of proline and anthocyaninincrease protective response to salinity in Oryza sativa L. spp. indica. Aust. J. Crop Sci. 2011, 5, 1191–1198. [Google Scholar]
- Taïbi, K.; Taïbi, F.; Abderrahim, L.A.; Ennajah, A.; Belkhodja, M.; Mulet, J.M. Effect of salt stress on growth, chlorophyll content, lipid peroxidation and antioxidant defence systems in Phaseolus vulgaris L. S. Afr. J. Bot. 2016, 105, 306–312. [Google Scholar] [CrossRef]
- Ahmad, Z.; Waraich, E.A.; Akhtar, S.; Anjum, S.; Ahmad, T.; Mahboob, W.; Hafeez, O.B.; Tapera, T.; Labuschagne, M.; Rizwan, M. Physiological responses of wheat to drought stress and its mitigation approaches. Acta Physiol. Plant. 2018, 40, 1–13. [Google Scholar] [CrossRef]
- Liu, C.; Liu, Y.; Lu, Y.; Liao, Y.; Nie, J.; Yuan, X.; Chen, F. Use of a leaf chlorophyll content index to improve the prediction of above-ground biomass and productivity. PeerJ 2019, 6, e6240. [Google Scholar] [CrossRef] [PubMed]
- Akhtar, S.S.; Andersen, M.N.; Liu, F. Residual effects of biochar on improving growth, physiology and yield of wheat under salt stress. Agric. Water Manag. 2015, 158, 61–68. [Google Scholar] [CrossRef]
- Loudari, A.; Mayane, A.; Zeroual, Y.; Colinet, G.; Oukarroum, A. Photosynthetic performance and nutrient uptake under salt stress: Differential responses of wheat plants to contrasting phosphorus forms and rates. Front. Plant Sci. 2022, 13, 1038672. [Google Scholar] [CrossRef] [PubMed]
- Zahra, N.; Al Hinai, M.S.; Hafeez, M.B.; Rehman, A.; Wahid, A.; Siddique, K.H.; Farooq, M. Regulation of photosynthesis under salt stress and associated tolerance mechanisms. Plant Physiol. Biochem. 2022, 178, 55–69. [Google Scholar] [CrossRef] [PubMed]
- Shah, S.H.; Houborg, R.; McCabe, M.F. Response of chlorophyll, carotenoid and SPAD-502 measurement to salinity and nutrient stress in wheat (Triticum aestivum L.). Agronomy 2017, 7, 61. [Google Scholar] [CrossRef]
- Zhu, D.; Luo, F.; Zou, R.; Liu, J.; Yan, Y. Integrated physiological and chloroplast proteome analysis of wheat seedling leaves under salt and osmotic stresses. J. Proteom. 2021, 234, 104097. [Google Scholar] [CrossRef]
- Hosseini, S.J.; Tahmasebi-Sarvestani, Z.; Pirdashti, H.; Modarres-Sanavy, S.A.M.; Mokhtassi-Bidgoli, A.; Hazrati, S.; Nicola, S. Investigation of yield, phytochemical composition, and photosynthetic pigments in different mint ecotypes under salinity stress. Food Sci. Nutr. 2021, 9, 2620–2643. [Google Scholar] [CrossRef]
- Abbas, T.; Sattar, A.; Ijaz, M.; Aatif, M.; Khalid, S.; Sher, A. Exogenous silicon application alleviates salt stress in okra. Hortic. Environ. Biotechnol. 2017, 58, 342–349. [Google Scholar] [CrossRef]
- Dhiman, P.; Rajora, N.; Bhardwaj, S.; Sudhakaran, S.S.; Kumar, A.; Raturi, G.; Chakraborty, K.; Gupta, O.P.; Devanna, B.N.; Tripathi, D.K.; et al. Fascinating role of silicon to combat salinity stress in plants: An updated overview. Plant Physiol. Biochem. 2021, 162, 110–123. [Google Scholar] [CrossRef]
- Zhu, Y.X.; Gong, H.J.; Yin, J.L. Role of silicon in mediating salt tolerance in plants: A review. Plants 2019, 8, 147. [Google Scholar] [CrossRef]
- Thorne, S.J.; Hartley, S.E.; Maathuis, F.J. Is silicon a panacea for alleviating drought and salt stress in crops? Front. Plant Sci. 2020, 11, 1221. [Google Scholar] [CrossRef] [PubMed]
- Nisar, S.; Iqbal, M.; Ashraf, J.; Naeem, M.; Ahmad, Z.; Afzal, M.; Raza, A. Enhancing salt tolerance in cotton by improving its morpho-physiological and antioxidant potential through foliar applied silicon. Silicon 2022, 14, 11243–11252. [Google Scholar] [CrossRef]
- Rizwan, M.; Ali, S.; Ibrahim, M.; Farid, M.; Adrees, M.; Bharwana, S.A.; Abbas, F. Mechanisms of silicon-mediated alleviation of drought and salt stress in plants: A review. Environ. Sci. Pollut. Res. 2015, 22, 15416–15431. [Google Scholar] [CrossRef]
- Ibrahim, M.A.; Merwad, A.M.; Elnaka, E.A.; Burras, C.L.; Follett, L. Application of silicon ameliorated salinity stress and improved wheat yield. J. Soil Sci. Environ. Manag. 2016, 7, 81–91. [Google Scholar]
- Singh, P.; Kumar, V.; Sharma, J.; Saini, S.; Sharma, P.; Kumar, S.; Sinhmar, Y.; Kumar, D.; Sharma, A. Silicon supplementation alleviates the salinity stress in wheat plants by enhancing the plant water status, photosynthetic pigments, proline content and antioxidant enzyme activities. Plants 2022, 11, 2525. [Google Scholar] [CrossRef] [PubMed]
- Tuna, A.L.; Kaya, C.; Higgs, D.; Murillo-Amador, B.; Aydemir, S.; Girgin, A.R. Silicon improves salinity tolerance in wheat plants. Environ. Exp. Bot. 2008, 62, 10–16. [Google Scholar] [CrossRef]
- Nawaz, K.; Hussain, K.; Majeed, A.; Khan, F.; Afghan, S.; Ali, K. Fatality of salt stress to plants: Morphological, physiological and biochemical aspects. Afr. J. Biotechnol. 2010, 9, 5475–5480. [Google Scholar]
- Zuo, Z.; Ye, F.; Wang, Z.; Li, S.; Li, H.; Guo, J.; Mao, H.; Zhu, X.; Li, X. Salt acclimation induced salt tolerance in wild-type and chlrophyll b-deficient mutant wheat. Plant Soil Environ. 2021, 67, 26–32. [Google Scholar] [CrossRef]
- Khoshbakht, D.; Ramin, A.A.; Baninasab, B. Effects of sodium chloride stress on gas exchange, chlorophyll content and nutrient concentrations of nine citrus rootstocks. Photosynthetica 2015, 53, 241–249. [Google Scholar] [CrossRef]
- Hichem, H.; El Naceur, A.; Mounir, D. Effects of salt stress on photosynthesis, PSII photochemistry and thermal energy dissipation in leaves of two corn (Zea mays L.) varieties. Photosynthetica 2009, 47, 517–526. [Google Scholar] [CrossRef]
- Allakhverdiev, S.I.; Sakamoto, A.; Nishiyama, Y.; Inaba, M.; Murata, N. Ionic and osmotic effects of NaCl-induced inactivation of photosystems I and II in Synechococcus sp. Plant Physiol. 2000, 123, 1047–1056. [Google Scholar] [CrossRef] [PubMed]
- Stepien, P.; Klobus, G. Antioxidant defense in the leaves of C3 and C4 plants under salinity stress. Physiol. Plant. 2005, 125, 31–40. [Google Scholar] [CrossRef]
- Bose, J.; Rodrigo-Moreno, A.; Shabala, S. ROS homeostasis in halophytes in the context of salinity stress tolerance. J. Exp. Bot. 2013, 65, 1241–1257. [Google Scholar] [CrossRef]
- Yin, L.N.; Wang, S.W.; Li, J.Y.; Tanaka, K.; Oka, M. Application of silicon improves salt tolerance through ameliorating osmotic and ionic stresses in the seedling of Sorghum bicolour. Acta Physiol. Plant. 2013, 35, 3099–3107. [Google Scholar] [CrossRef]
- Coskun, D.; Britto, D.T.; Huynh, W.Q.; Kronzucker, H.J. The role of silicon in higher plants under salinity and drought stress. Front. Plant Sci. 2016, 7, 1072. [Google Scholar] [CrossRef]
- Kim, Y.H.; Khan, A.L.; Waqas, M.; Lee, I.J. Silicon regulates antioxidant activities of crop plants under abiotic-induced oxidative stress: A review. Front. Plant Sci. 2017, 8, 510. [Google Scholar] [CrossRef]
- Dabravolski, S.A.; Isayenkov, S.V. The physiological and molecular mechanisms of silicon action in salt stress amelioration. Plants 2024, 13, 525. [Google Scholar] [CrossRef]
- Baker, N.R.; Rosenqvist, E. Applications of chlorophyll fluorescence can improve crop production strategies: An examination of future possibilities. J. Exp. Bot. 2004, 55, 1607–1621. [Google Scholar] [CrossRef]
- Sayed, O.H. Chlorophyll fluorescence as a tool in cereal crop research. Photosynthetica 2003, 41, 321–330. [Google Scholar] [CrossRef]
- Yadav, D.S.; Mishra, A.K.; Rai, R.; Chaudhary, N.; Mukherjee, A.; Agrawal, S.B.; Agrawal, M. Responses of an old and a modern Indian wheat cultivar to future O3 level: Physiological, yield and grain quality parameters. Environ. Pollut. 2020, 259, 113939. [Google Scholar] [CrossRef]
- Rastogi, A.; Yadav, S.; Hussain, S.; Kataria, S.; Hajihashemi, S.; Kumari, P.; Brestic, M. Does silicon really matter for the photosynthetic machinery in plants…? Plant Physiol. Biochem. 2021, 169, 40–48. [Google Scholar] [CrossRef]
- Sun, M.; Yang, Z.; Liu, L.; Duan, L. DNA Methylation in plant responses and adaption to abiotic stresses. Int. J. Mol. Sci. 2022, 23, 6910. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Beena, A.S.; Awana, M.; Singh, A. Salt-induced tissue-specific cytosine methylation downregulates expression of HKT genes in contrasting wheat (Triticum aestivum L.) genotypes. DNA Cell Biol. 2017, 36, 283–294. [Google Scholar] [CrossRef]
- Karan, R.; DeLeon, T.; Biradar, H.; Subudhi, K.P. Salt stress induced variation in DNA methylation pattern and its influence on gene expression in contrasting rice genotypes. PLoS ONE 2012, 7, e40203. [Google Scholar] [CrossRef] [PubMed]
- Anjali; Kumar, S.; Korra, T.; Thakur, R.; Arutselvan, R.; Kashyap, S.A.; Nehela, N.; Chaplygin, V.; Minkina, M.; Keswani, C. Role of plant secondary metabolites in defence and transcriptional regulation in response to biotic stress. Plant Stress 2023, 8, 100154. [Google Scholar] [CrossRef]
- Chang, Y.N.; Zhu, C.; Jiang, J.; Zhang, H.; Zhu, J.K.; Duan, C.G. Epigenetic regulation in plant abiotic stress responses. J. Integr. Plant Biol. 2020, 62, 563–580. [Google Scholar] [CrossRef] [PubMed]
- Xue-Lin, L.; Zhong-Xu, L.; Yi-Chun, N.; Xiao-Ping, G.; Xian-Long, Z. MSAP analysis of epigentic changes in cotton (Gossypium hirsutum L.) under salt stress. Acta Agron. Sin. 2009, 35, 588–596. [Google Scholar] [CrossRef]
- Mastan, S.G.; Rathore, M.S.; Bhatt, V.D.; Yadav, P.; Chikara, J. Assessment of changes in DNA methylation by methylation-sensitive amplification polymorphism in Jatropha curcas L. subjected to salinity stress. Gene 2012, 508, 125–129. [Google Scholar] [CrossRef]
- Stadnik, B.; Tobiasz-Salach, R.; Mazurek, M. Physiological and epigenetic reaction of barley (Hordeum vulgare L.) to the foliar application of silicon under soil salinity conditions. Int. J. Mol. Sci. 2022, 23, 1149. [Google Scholar] [CrossRef]
- Guarino, F.; Cicatelli, A.; Brundu, G.; Heinze, B.; Castiglione, S. Epigenetic diversity of clonal white poplar (Populus alba L.) populations: Could methylation support the success of vegetative reproduction strategy? PLoS ONE 2015, 10, e0131480. [Google Scholar] [CrossRef]
- Lancashire, P.D.; Bleiholder, H.; Van Den Boom, T.; Langelüddeke, P.; Stauss, R.; Weber, E.; Witzenberger, A. A uniform decimal code for growth stages of crops and weeds. Ann. Appl. Biol. 1991, 119, 561–601. [Google Scholar] [CrossRef]
- Xiong, L.Z.; Xu, C.G.; Saghai Maroof, M.A.; Zhang, Q. Patterns of cytosine methylation in an elite rice hybrid and its parental lines, detected by a methylation-sensitive amplification polymorphism technique. Mol. Gen. Genet. 1999, 261, 439–446. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Li, X.; Korban, S.S. AFLP based detection of DNA methylation. Plant Mol. Biol. Rep. 2000, 18, 361–368. [Google Scholar] [CrossRef]
- Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Bassam, B.J.; Gresshoff, P.M. Silver staining DNA in polyacrylamide gels. Nat. Protoc. 2007, 2, 2649–2654. [Google Scholar] [CrossRef]
- Li, X.; Xu, M.; Korban, S.S. DNA methylation profiles differ between field-and in vitro-grown leaves of apple. J. Plant Physiol. 2002, 159, 1229–1234. [Google Scholar] [CrossRef]
- Gomez, K.A.; Gomez, A.A. Statistical Procedures for Agricultural Research, 2nd ed.; Wiley Inter Science: New York, NY, USA, 1984; pp. 1–690. [Google Scholar]
Analysed Parameters: | Control | NaCl | NaCl + 0.05% Si | NaCl + 0.1% Si | NaCl + 0.2% Si |
---|---|---|---|---|---|
Number of symmetric methylation bands | 29 | 28 | 25 | 28 | 28 |
Symmetric methylation (%) | 13.1 | 12.9 | 10.8 | 12.5 | 12.5 |
Number of hemi-methylation bands | 42 | 45 | 50 | 44 | 40 |
Hemi-methylation (%) | 19.0 | 20.7 | 21.6 | 19.8 | 17.9 |
Total bands number | 221 | 217 | 231 | 224 | 224 |
% Total methylation | 32.1 | 33.6 | 32.5 | 32.1 | 30.4 |
MSAP Stage | Primer/Adapter | Sequence |
---|---|---|
Ligation | EcoRI-Adapter | 5′CTCGTAGACTGCGTACC3′ 3′CATCTGACGCATGGTTAA5′ |
MspI-HpaII-Adapter | 5′CGACTCAGGACTCAT3′ 3′TGAGTCCTGAGTAGCAG5′ | |
Preamplification | Pre-EcoRI | 5′GACTGCGTACCAATTC3′ |
Pre-MspI-HpaII | 5′GATGAGTCCTGAGTCGG3′ | |
Selective amplification | EcoRI-ACT × MspI/HpaII-CT | 5′GACTGCGTACCAATTCACT3′ 5′GATGAGTCCTGAGTCGGCT3′ |
EcoRI-AG × MspI/HpaII-CTC | 5′GACTGCGTACCAATTCAG3′ 5′GATGAGTCCTGAGTCGGCTC3′ | |
EcoRI-AC × MspI/HpaII-ATG | 5′GACTGCGTACCAATTCAC3′ 5′GATGAGTCCTGAGTCGGATG3′ | |
EcoRI-AT × MspI/HpaII-CTC | 5′GACTGCGTACCAATTCAT3′ 5′GATGAGTCCTGAGTCGGCTC3′ | |
EcoRI-AT × MspI/HpaII-CAT | 5′GACTGCGTACCAATTCAT3′ 5′GATGAGTCCTGAGTCGGCAT3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tobiasz-Salach, R.; Stadnik, B.; Mazurek, M.; Buczek, J.; Leszczyńska, D. Foliar Application of Silicon Influences the Physiological and Epigenetic Responses of Wheat Grown Under Salt Stress. Int. J. Mol. Sci. 2024, 25, 13297. https://doi.org/10.3390/ijms252413297
Tobiasz-Salach R, Stadnik B, Mazurek M, Buczek J, Leszczyńska D. Foliar Application of Silicon Influences the Physiological and Epigenetic Responses of Wheat Grown Under Salt Stress. International Journal of Molecular Sciences. 2024; 25(24):13297. https://doi.org/10.3390/ijms252413297
Chicago/Turabian StyleTobiasz-Salach, Renata, Barbara Stadnik, Marzena Mazurek, Jan Buczek, and Danuta Leszczyńska. 2024. "Foliar Application of Silicon Influences the Physiological and Epigenetic Responses of Wheat Grown Under Salt Stress" International Journal of Molecular Sciences 25, no. 24: 13297. https://doi.org/10.3390/ijms252413297
APA StyleTobiasz-Salach, R., Stadnik, B., Mazurek, M., Buczek, J., & Leszczyńska, D. (2024). Foliar Application of Silicon Influences the Physiological and Epigenetic Responses of Wheat Grown Under Salt Stress. International Journal of Molecular Sciences, 25(24), 13297. https://doi.org/10.3390/ijms252413297