Next Article in Journal
Therapeutic Efficacy and Underlying Mechanisms of a Mannoglucan from Hirsutella sinensis Mycelium on Dextran Sulfate Sodium-Induced Inflammatory Bowel Disease in Mice: Modulation of the Intestinal Barrier, Oxidative Stress and Gut Microbiota
Next Article in Special Issue
Identification of Submergence Tolerance Loci in Dongxiang Wild Rice (DXWR) by Genetic Linkage and Transcriptome Analyses
Previous Article in Journal
The PpPep2-Triggered PTI-like Response in Peach Trees Is Mediated by miRNAs
Previous Article in Special Issue
Genome-Wide Identification and Expression Analysis of FD Gene Family in Bamboos
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of MAPK Genes in Phaseolus vulgaris and Analysis of Their Expression Patterns in Response to Anthracnose

Modern Vegetable Industry Technology and Germplasm Resource Innovation Team, Northeast Asia Special Germplasm Resource Conservation and Innovation Center Vegetable Breeding Technology Innovation Team, College of Horticulture, Jilin Agricultural University, Changchun 130118, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Current address: College of Agriculture, Jilin Agricultural Science and Technology University, Jilin 132108, China.
Int. J. Mol. Sci. 2024, 25(23), 13101; https://doi.org/10.3390/ijms252313101
Submission received: 18 October 2024 / Revised: 27 November 2024 / Accepted: 3 December 2024 / Published: 5 December 2024

Abstract

The oil bean is a high-quality, economically valuable variety of kidney bean (Phaseolus vulgaris L.) that is widely cultivated in Northeast China. However, the prevalence of anthracnose, caused by a combination of factors, including continuous cropping over many years, has led to significant declines in both yield and quality. The mitogen-activated protein kinase (MAPK) cascade is a highly conserved plant cell signaling pathway that plays a pivotal role in plant growth and development, as well as responses to biotic stress. However, its role in the response of P. vulgaris to anthracnose infection has not previously been reported. We identified and characterized thirteen MAPK genes (PvMAPK01–PvMAPK13) in the P. vulgaris genome. These genes were found on eight of the eleven chromosomes of P. vulgaris, and phylogenetic analyses classified them into four previously established subgroups (A–D). Analysis of the cis-acting elements in their promoter regions revealed the presence of multiple elements associated with light, hormone regulation, stress responses, and growth and development. An analysis of intraspecific collinearity revealed that whole-genome and/or segmental duplication, rather than tandem duplication, has been the primary driver of PvMAPK family expansion in P. vulgaris. Transcriptome data revealed that the PvMAPKs differed in their tissue-specific expression patterns, with PvMAPK05 showing particularly high expression in stems and stem tips and PvMAPK07 and PvMAPK11 showing relatively low expression across all tissues. In general, expression of the PvMAPKs was higher in stems, stem tips, and pods than in other tissues and organs, suggesting that they may be particularly important for regulating stem and pod development. Analysis of the expression of PvMAPKs in field-grown plants infected or uninfected with anthracnose revealed that the relative expression levels of PvMAPK05, PvMAPK07, PvMAPK09, and PvMAPK11 exhibited particularly significant changes in response to anthracnose infection across different varieties, suggesting their potential involvement in the anthracnose response of Phaseolus vulgaris. This study reports the fundamental characteristics of the thirteen MAPK genes in P. vulgaris, documents their expression patterns in diverse tissues, and offers preliminary insights into their responses to anthracnose infection, establishing a foundation for subsequent functional validation.

1. Introduction

The oil bean (Phaseolus vulgaris L.) is a high-quality kidney bean variety that is indigenous to the northeast region of China [1]. It is one of the region’s most distinctive agricultural products, offering a combination of high nutritional value and significant economic benefit. However, owing to the practice of continuous cropping or seed carrying, pathogens have become increasingly prevalent, and disease incidence has worsened from year to year. Among these pathogens, anthracnose is of particular concern; it affects the leaves, stems, and pods of the oil bean, resulting in significant yield and commercial losses, with estimates reaching 30–90% [2]. Research has shown that Colletotrichum lindemuthianum is the primary causal agent of anthracnose in P. vulgaris [3], and pesticide spraying is the primary method for anthracnose control in commercial production. However, excessive reliance on pesticide spraying can lead to diminishing returns and can cause soil contamination in agricultural fields. Exploring ways to harness or manipulate the immune system of P. vulgaris for anthracnose prevention and control will therefore be important for advancing the ‘green defense revolution’ and the ‘agriculture and nature coordinated development’ major strategy [4].
Plants are typically exposed to multiple stresses during their growth and development [5], and they have developed a variety of molecular mechanisms to adapt to these stresses over the course of long-term evolution. Stress-response mechanisms involve the transduction of external environmental signals into molecular and physiological responses, a process that is regulated by signal transduction pathways. Plant signal transduction pathways are numerous and diverse. One such pathway is the mitogen-activated protein kinase (MAPK) cascade, a widespread and highly conserved eukaryotic signaling module that converts the signals generated by cell membrane receptors into cellular responses, thereby regulating plant growth and development. A typical MAPK cascade involves a series of phosphorylations mediated by three types of kinase: (1) mitogen-activated protein kinase (MAPK), (2) MAPK kinase (MAPKK), and (3) MAPKK kinase (MAPKKK) [6].
Upon perception of an external environmental stimulus, a plant cell membrane receptor transduces this signal to the MAPK cascade pathway. The first element of the cascade to be activated by phosphorylation is MAPKKK. As the signal is transduced in a sequential manner, MAPKK and MAPK are in turn activated by phosphorylation. Finally, the activated MAPK regulates its downstream response factors (typically transcription factors or other types of kinases), which amplify the extracellular signal and initiate cellular responses. It has recently been demonstrated that MAPKKKs can be activated not only by membrane receptors but also by MAPKKKKs, whose function remains poorly understood.
The mitogen-activated protein kinases (MAPKs) are located at the end of the MAPK cascade and act as hubs connecting the upstream and downstream substrates of the cascade pathway, resulting in increased complexity and sequence diversity. MAPKs have 11 highly conserved structural subdomains, and the activation loop between domains VII and VIII contains a TEY or TDY phosphorylation site that enables MAPK activation and interaction with upstream MAPKK activators [7,8]. Plant MAPKs can be classified into four groups, A–D. Members of groups A, B, and C have a TEY motif at the phosphorylation site, whereas members of group D have a TDY motif; the latter are found only in plants. The MAPK gene family has been systematically characterized in a number of plant species, including Arabidopsis (Arabidopsis thaliana, 20 genes) [9], Brachypodium distachyon (16 genes) [10], maize (Zea mays, 19 genes) [11], barley (Hordeum vulgare, 20 genes) [12], wheat (Triticum aestivum, 54 genes) [13], and rice (Oryza sativa, 17 genes) [14].
The MAPK cascade plays a key role in plant responses to biotic and abiotic stresses, such as pathogen infections [15]. Through phosphorylation, the MAPK cascade can regulate intracellular protein substrates and initiate cell signaling pathways, thereby regulating the expression of many defense genes and enhancing plant immunity [16]. For example, three OsMAPK genes are involved in rice blast resistance. The VQ motif proteins OsVQ14 and OsVQ32 act as substrates of the OsMPKK6–OsMPK4 cascade, promoting rice resistance to C. oryzae [17].
OsMAPK20-5 has been identified as a positive regulator, and its silencing increased the susceptibility of transgenic plants to rice blast. By contrast, OsMAPK5 and OsMPK15 have been characterized as negative regulators, and suppression of OsMAPK5 expression significantly increased blast resistance. Likewise, Wang et al. [18] demonstrated that the cotton MKK4MPK20WRKY40 cascade plays a pivotal role in resistance to Fusarium acnes. Song Q-M [19] transiently expressed watermelon ClMPK7 in tobacco and demonstrated its ability to induce the accumulation of reactive oxygen species and the expression of defense genes, thereby enhancing resistance to Botrytis cinerea. Similar findings have been found in other plants, such as in Arabidopsis thaliana, where AtMPKK1/AtMPKK2 or AtMPKK6 activate AtMPK4, which in turn phosphorylates AtVQ21 to promote defense responses, suggesting the importance and conserved nature of MAPK signaling pathways in plant immunity [20].
The aforementioned studies demonstrate that MAPK proteins can play a significant role in plant responses to biotic stress. Nevertheless, this phenomenon has been reported for only a few species, including Arabidopsis, rice, and several other crop plants, and little is known about the response of MAPK proteins to anthracnose in P. vulgaris. We therefore used MAPK sequences from Arabidopsis and rice to identify MAPK homologs in P. vulgaris and performed bioinformatics analyses to characterize their physicochemical properties, intra- and interspecific collinearity, and evolutionary relationships. We examined expression of the PvMAPKs in seven tissues of P. vulgaris using transcriptome sequencing and performed qRT-PCR to document changes in their expression in response to anthracnose infection. The results provide a foundation for further functional studies of the PvMAPKs and their use in preventing anthracnose-related damage in Phaseolus.

2. Results

2.1. Identification of PvMAPK Genes and Characterization of PvMAPK Proteins in P. vulgaris

We identified 13 members of the MAPK gene family in the P. vulgaris genome (Table 1) and designated them PvMAPK01PvMAPK13. The PvMAPKs were located on eight of the eleven P. vulgaris chromosomes: four on chromosome 2, two each on chromosomes 3 and 6, and one each on chromosomes 4, 5, 8, 10, and 11 (Figure 1).
The PvMAPK proteins ranged from 372 to 614 amino acids in length, with molecular weights of 42.48–69.98 kDa and isoelectric points of 5.65–9.21; all contained TEY or TDY phosphorylation sites (Table 1). Subcellular localization predictions suggested that 11 PvMAPKs were located in the cytoplasm, with only PvMAPK04 and PvMAPK06 located in the nucleus; none of the PvMAPKs were predicted to contain a signal peptide.

2.2. Phylogenetic and Collinearity Analyses of the P. vulgaris MAPK Gene Family

To investigate the evolutionary relationships among the MAPK genes, we constructed a phylogenetic tree using the amino acid sequences of 20 AtMAPKs from Arabidopsis, 13 PvMAPKs from P. vulgaris, and 17 OsMAPKs from rice (Figure 2). The results revealed that the 13 PvMAPKs could be classified into the known MAPK groups: groups A–C with the TEY motif and group D with the TDY motif. Seven of the 13 PvMAPKs belonged to group D, which also contained the largest number of Arabidopsis and rice members. Among the remaining PvMAPKs, two belonged to Group A (PvMAPK02 and PvMAPK05), three to group B (PvMAPK01, PvMAPK11, and PvMAPK12), and one to Group C (PvMAPK10).
Analysis of intragenomic collinearity within the P. vulgaris genome (Figure 3) revealed the presence of five syntenic PvMAPK gene pairs but no apparent tandem duplications. Four of the syntenic pairs were located on different chromosomes (PvMAPK06/PvMAPK08, PvMAPK03/PvMAPK09, PvMAPK01/PvMAPK11, and PvMAPK01/PvMAPK12), whereas PvMAPK11 and PvMAPK12 were both located on chromosome 2. These results suggest that whole-genome and segmental duplication, rather than tandem duplication, has been the primary driver of PvMAPK family expansion in P. vulgaris. Ka/Ks calculations for these five collinear gene pairs (Table 2) revealed Ka/Ks ratios less than 1, indicating that the PvMAPK genes have been subjected to purifying selection during their evolution.
We also examined collinear relationships among the PvMAPKs and MAPK genes from Arabidopsis and soybean (Glycine max). We identified 20 collinear MAPK gene pairs between P. vulgaris and Arabidopsis and 36 collinear gene pairs between P. vulgaris and soybean (Figure 4). The relatively close evolutionary relationships among these collinear gene pairs may provide insight into the functions of the PvMAPKs, although such predicted functions will require experimental verification.

2.3. Conserved Domains, Conserved Motifs, and Gene Structures of the PvMAPKs

Conserved domains were identified in the 13 PvMAPKs using NCBI CD-search, and all were found to contain a pro-mitogen-activated protein kinase structural domain, either STKc_TDY_MAPK (cd07859) or STKc_TEY_MAPK (cd07858) (Figure 5). Conserved motifs were also identified in the PvMAPKs using MEME tools. The number and order of motifs were similar across the PvMAPKs, and all contained Motifs 1, 2, 3, and 10. Motif 4 included the characteristic TDY motif and was therefore present only in group D. Motif 7 included the characteristic TEY motif and was therefore found in groups A–C. The group A–C proteins also contained a distinctive N-terminal motif, Motif 9, whereas group D members contained a different N-terminal motif, Motif 6. At the C terminus, group A and B members contained motif 11, whereas group D members contained motif 15; all group D members also had long 3′ untranslated regions. Sequence logos of all the conserved motifs are shown in Figure 6.
The exon–intron structures of the 13 PvMAPK genes are shown in Figure 5. Exon numbers were similar among PvMAPKs from the same group: 9–11 for group D, 6 for groups A and B, and 2 for group C. The structures, and likely the functions, of PvMAPKs from different groups have clearly undergone differentiation over the course of evolution.

2.4. Identification of Cis-Acting Elements in the PvMAPK Promoters

To gain insight into the potential functions of the PvMAPKs, we identified cis-acting elements in their 2000-bp upstream promoter regions (Figure 7). In addition to the conserved CAAT and TATA boxes, the PvMAPK promoters also contained 14 cis-acting elements, which we classified into five broad categories: light, stress, hormone regulation, growth/development, and circadian rhythm (Figure 8). Light-responsive elements were present in all PvMAPK genes, and they were the most abundant elements in all PvMAPK promoters. The second category, hormone regulation, included elements involved in responses to abscisic acid (present in 11 PvMAPK promoters), jasmonic acid methyl ester (9 promoters), auxin (3 promoters), gibberellin (5 promoters), and salicylic acid (8 promoters), as well as elements related to the metabolism of zein and similar prolamin proteins (2 promoters). In the stress category were elements related to hypoxia (11 promoters), low temperature (6 promoters) and defense and stress (4 promoters). Among the elements involved in plant growth and development were elements related to meristem expression (three promoters), endosperm expression (two promoters), and cell differentiation (PvMAPK09 only). Finally, cis-acting elements associated with the control of circadian rhythm were present in three of the gene promoters (PvMAPK02, PvMAPK09, and PvMAPK12).

2.5. Expression of the PvMAPKs in Different P. vulgaris Tissues

To further investigate the potential functions of the PvMAPK genes in growth and development, we downloaded transcriptome data for leaves, flowers, pods, seeds, roots, stems, and stem tips of P. vulgaris from the Legume Information System (https://www.legumeinfo.org/ accessed on 26 November 2024 [21]) database and used these data to analyze PvMAPK gene expression (Figure 9). The PvMAPK genes were expressed in all tissues examined, although the expression of individual PvMAPKs differed among plant parts. PvMAPK05 showed particularly high expression in stems, stem tips, and (to a lesser extent) pods. By contrast, expression of PvMAPK07 and PvMAPK11 was relatively low across all tissues. In general, PvMAPK expression was lower in leaves and seeds and higher in stems, stem tips, and pods, suggesting that PvMAPKs may have a particularly important role in the regulation of stem and pod development.

2.6. Expression of PvMAPKs in Seven Oil Bean Varieties Under Anthracnose Stress

We next examined expression of the PvMAPKs in leaf and stem tissue from seven varieties of field-grown oil bean plants, with and without natural anthracnose infection (Figure 10, Figure 11, Figure 12, Figure 13, Figure 14, Figure 15 and Figure 16).
In the variety ‘HuangJinGou’, seven PvMAPK genes (PvMAPK01/02/03/06/07/08/12) were upregulated 1.05- to 2.11-fold in infected leaves compared with uninfected leaves, with PvMAPK01 showing the greatest upregulation. The remainder of the PvMAPKs were downregulated to various extents in infected leaves, with PvMAPK09 exhibiting the greatest downregulation. In the stems, only PvMAPK07 was upregulated (1.60-fold) upon infection, and the remaining PvMAPKs were downregulated.
In infected leaves of ‘Baiyunfeng’, PvMAPK05 and PvMAPK11 were upregulated by 1.10- and 5.61-fold, respectively, and the remaining PvMAPKs were downregulated (Figure 11). In infected stems, expression of PvMAPK01, PvMAPK04, PvMAPK05, PvMAPK10, and PvMAPK13 was upregulated 1.35- to 3.86-fold, with PvMAPK05 showing the greatest upregulation; expression of the remaining genes was downregulated.
In infected leaves of ‘Jifeng’, most PvMAPK genes showed relatively little change in expression. Their expression levels ranged from 0.41 to 1.39 times those of uninfected leaves, with PvMAPK05 showing the greatest downregulation and PvMAPK01 showing the greatest upregulation. By contrast, PvMAPK05 was upregulated 3.91 fold in infected ‘Jifeng’ stems, and PvMAPK01/04/10/13 were also upregulated. PvMAPK06 showed the greatest downregulation in infected stems (0.35-fold relative to uninfected stems).
Multiple PvMAPK genes were upregulated in infected leaves and stems of ‘Giant Oil Bean’ (Figure 13). The most substantial upregulation was observed for PvMAPK09 in leaves (11.44-fold) and PvMAPK10 in stems (6.11-fold). Other genes showed various degrees of up- and downregulation.
Seven genes (PvMAPK01/05/09/10/11/12/13) were upregulated in infected leaves of ‘YiKeSong’, with PvMAPK09 showing the greatest upregulation (7.02-fold relative to uninfected leaves) (Figure 14). PvMAPK11 was also strongly upregulated (5.48-fold). In the stems, six PvMAPKs were upregulated, with PvMAPK05 expression showing the greatest increase (5.97 fold).
In infected leaves of ‘Wuchang Big Oil Bean’, all PvMAPKs except PvMAPK01, PvMAPK04, and PvMAPK11 were upregulated (Figure 15). PvMAPK05 exhibited the greatest upregulation (3.41-fold). In infected stems, all PvMAPKs except PvMAPK03/07/08/12 were upregulated, with PvMAPK10 showing the greatest upregulation (6.11-fold) and PvMAPK07 the greatest downregulation (0.35-fold).
Seven PvMAPKs were upregulated in infected leaves of the variety ‘P9’ (PvMAPK01/02/03/06/07/08/12), most by approximately two-fold compared with uninfected leaves. By contrast, only PvMAPK07 was upregulated (1.60-fold) in infected stems. The remaining twelve genes were downregulated to various degrees, with PvMAPK12 showing the most pronounced decrease (0.02-fold).
In summary, the modulation of expression levels of MAPK gene family members within the leaf and stem tissues of seven P. vulgaris varieties is associated with the stress imposed by anthracnose. Notably, the expression patterns of PvMAPK05, PvMAPK07, PvMAPK09, and PvMAPK11 across different varieties exhibit notable similarities, suggesting their potential role in the P. vulgaris’s response to anthracnose stress. However, the precise mechanisms underlying their response remain to be clarified. It is essential to conduct further research to evaluate their potential in disease resistance.

3. Discussion

The MAPK cascade plays pivotal roles in the regulation of plant growth and development, as well as biotic and abiotic stress responses. Environmental signals are transmitted from receptor proteins to MAPKKKs, MAPKKs, and MAPKs through sequential phosphorylation, and MAPKs regulate growth, development, and stress by phosphorylating downstream substrates or promoting the expression of related genes [22,23]. In the existing literature, known downstream signal sensors include NPR1 regulator, the 14-3-3 proteins GRF6 and GRF8, and CcSte12 [22,23].
In recent years, NPR1, as a regulatory protein, has been found to be required in the development of inducible resistance induced by pathogen infection. NPR1 enters the nucleus and activates PR1 gene expression via the TGA transcription factor. Riboflavin treatment induced PR1 expression in WT plants after challenge. However, riboflavin preconditioning did not promote increased PR1 transcription in npr1 mutants. The relationship between MAPKs and NPR1 after Pst DC3000 inoculation was further studied. Inoculation with Pst DC3000 promoted the expression of NPR1 protein in WT plants, while NPR1 expression was almost suppressed in mpk3 and mpk6 mutants. These data suggest that riboflavin induces defense activation through NPR1-dependent signaling pathways in response to Pst DC3000, and that riboflavin-induced MAPKs signaling modules may work upstream of NPR1 regulators [24].
It was found that the Arabidopsis 14-3-3 proteins GRF6 and GRF8 play a key role in the regulation of PTI. These two isomers interact with RLCKs and induce defense gene expression, callose deposition, and resistance to two bacteria (Pseudomonas syringae pv). Further characterization showed that these two isomers were required for pattern-triggered MAP kinase activation, but not for other early signaling events such as reactive oxygen species bursts (Figure 3) and phosphorylation of BIK1 and RGS1 (Figure 6). We found that GRF6 directly interacts with the C-terminus of MAPKKK5 to promote access to it by immune-activated PBL19 (Figure 6, revealing a unique mechanism by which patterns trigger MAP kinase activation and immunity. Through phosphorylated proteomic analysis and yeast two-hybrid experiments, the researchers demonstrated that CcPmk1 can phosphorylate and interact with the downstream homeobox transcription factor CcSte12. Phosphorylated proteomic analysis of the CcPmk1 deletion mutant and the wild type strain showed that the phosphorylation level of CcSte12 was significantly reduced in the CcPmk1 deletion mutant compared to the wild type strain. In addition, the abundance of peptides containing phosphorylated residues CcSte12Ser405, CcSte12Ser487, and CcSte12Ser545 in CcPmk1 deletion mutants was significantly reduced compared to the wild type strain. In addition, the phosphorylated residue CcSte12Ser405 contains the MAPK S/T-P phosphorylation motif. Deletion of CcPmk1 significantly reduces but does not eliminate phosphorylation of CcSte12 (Yu et al. 2022), suggesting that CcSte12 is also phosphorylated by kinase proteins other than CcPmk1, and that CcPmk1 has some additional downstream transcription factors [25].
Here, we identified 13 members of the MAPK gene family in P. vulgaris through homology searches and confirmed their identity on the basis of conserved domains in their predicted proteins. This work complements previous studies that have identified MAPK genes in Arabidopsis (20 genes) [9], B. distachyon (16) [10], Z. mays (19) [11], H. vulgare (20) [12], T. aestivum (54) [14], and O. sativa (17).
All PvMAPK proteins contained the conserved T(D/E)YXXTRWYRAPEL motif, and phylogenetic analysis placed the PvMAPKs into four previously described subgroups [6]: six PvMAPK proteins with the TEY motif in groups A–C and seven PvMAPK proteins with the TDY motif in group D. The larger number of proteins in group D is consistent with other findings in dicots. The TDY motif is located in Motif 4, and the TEY motif is situated in Motif 7. This is consistent with the analysis results of other plants such as Arabidopsis, barley, sorghum, Brachypodium, and chickpea [10,12,26,27,28].
The number and distribution of exons and introns in the gene structure of PvMAPKs demonstrate a notable degree of regularity across subfamilies. Groups A and B consist of six exons, while group C has just two exons. Group d stands out with a larger number of exons, specifically between 9 and 11. This pattern of gene structure is mirrored in other plants, characterized by a high degree of conservation within each group and significant divergence between groups [29].
The duplication of individual genes, chromosome segments, or whole genomes is the main driving force for genome formation and evolution [30]. There are five syntenic MAPK gene pairs on the P. vulgaris chromosomes. PvMAPK11 and PvMAPK12 are both located on chromosome 2 but appear to represent segmental rather than tandem duplicates. The remainder of the pairs are found on different chromosomes. This pattern suggests that whole-genome duplications and chromosome segment translocations may have played important roles in the expansion of the MAPK gene family of P. vulgaris [31]. Collinearity analyses of P. vulgaris with soybean and Arabidopsis revealed that 77% of the PvMAPK genes were collinear with their homologs in the Arabidopsis genome. This is also consistent with the research findings in Nelumbo nucifera by Gaerth [32], but differs from the collinearity studies between Setaria italica MAPK genes and Arabidopsis MAPK genes [32]. This may be due to divergence of the MAPK gene family during the evolutionary process between monocots and dicots. All were collinear with their homologs in the soybean genome. This finding suggests a close evolutionary relationship between the MAPK genes of P. vulgaris and those of Arabidopsis and soybean.
Similar studies on MAPK genes in other legumes showed that the Glyma.18G268800 gene in soybean may participate in resistance to Phytophthora root rot through the MAPK signaling pathway [32]. In peas, the expression of PsMAPK3 gene is associated with resistance to A. pisense [33]. These studies further demonstrated the extensive role of MAPK signaling pathway in plant disease resistance and also provided better background and an important basis for this study. In summary, MAPK cascades are an interesting target for breeding disease-resistant varieties because they play a key regulatory role in the plant immune response. Through in-depth research and utilization of MAPK signaling pathways, new strategies and methods can be provided for improving plant disease resistance.
Analysis of the 2 kb upstream sequences of the promoter regions of the Phaseolus vulgaris Mitogen-Activated Protein Kinase (MAPK) gene family members can provide valuable insights into their potential gene functions. This study identified 14 distinct types of regulatory elements within the promoter regions of the PvMAPKs encoding proteins. Among these elements, there are biotic stress regulatory cis-elements, including jasmonic acid response cis-regulatory elements, salicylic acid response defense cis-acting elements, and defense and stress response cis-acting elements, which are crucial for plant stress tolerance regulation. Jasmonic acid response cis-regulatory elements and salicylic acid response defense cis-acting elements are predominantly found in stress-related genes, highlighting their role in modulating plant responses to various stresses [34]. Additionally, the abscisic acid pathway is instrumental in activating defense genes during plant responses to both abiotic and biotic stresses [35]. SlMAPK3 in tomato is involved in the antiviral response to yellow leaf curl virus (TYLCV). VIGS silencing of SlMAPK3 can increase viral infection, decrease the expression of defense-related genes and the plant’s tolerance to TYLCV. Overexpression of SlMAPK3 enhances the expression of defense-related genes and increases tolerance to TYLCV [36]. In rice, the OSMKK4-OSMPK3/OsMPK6 cascade is activated by MAMP signaling, inducing immune responses such as defense-related gene expression, antimicrobial compound synthesis, and cell death, but does not produce ROS. OsMPK6 plays a major role in the regulation of diterpenoid plant protection hormone synthesis and plant cell death induced by chitin, but has no effect on the synthesis of phenylpropyl compounds [5]. In barley, HvMPK4 is a negative regulator of basal resistance, acting upstream of HvWRKY1. Hvmkk1-hvmpk4 kinase phosphorylates HvWRKY1 and regulates the immunity of barley against barley powdery fungi (Bgh) [37]. In Arabidopsis, MYB44 collaborates with the MPK3/6 cascade and EIN2 to regulate PTI development. PAMPs induce the expression of MYB44, MPK3, and MPK6; MYB44 activates the expression of MPK3 and MPK6; and phosphorylated MPK3 and MPK6 in turn enable MYB44 to activate MPK3, MPK6, EIN2, and downstream defense responses [38].
Within the common bean MAPK gene family, 11 members have been found to contain both jasmonic acid response cis-regulatory elements and salicylic acid response defense cis-acting elements. This suggests a significant role for the common bean MAPK gene family in the regulation of plant stress responses. Furthermore, the presence of a substantial number of light response elements in PvMAPKs indicates their potential importance in the modulation of light signals in common beans, a finding that aligns with research conducted in lotus [39] and wheat [40]. In cotton studies, it was found that the up-regulated expression of GHMAPK-related cis-regulatory elements significantly enhanced tolerance to drought and salt stress [41]. The researchers identified the StMAPK1 gene in potato, which maintains a high expression level under high temperature stress and reduces the ion permeability of cell membrane by increasing the content of proline and reducing the content of malondialdehyde, so as to ensure the stability of the cell membrane, thereby improving the heat resistance of the potato [34]. Arabidopsis thaliana overexpressing zmmkk1 promotes stomatal closure or effective removal of excess reactive oxygen species in an ABA-dependent manner, enhancing tolerance to salt and drought stress [42]. Overexpression of the maize MAPKK gene ZmMPK7 in transgenic tobacco can enhance the protection of the acne defense system against ROS-mediated injury under osmotic stress [43]. The researchers identified an osmapkkk43 mutant in rice which imparts broad-spectrum resistance to Mixanthomonas pv [44].
Anthracnose is an important fungal disease of the oil bean, with a considerable impact on both yield and quality. A substantial body of research has demonstrated that MAPK genes play pivotal roles in the regulation of pathogen and virus resistance across a diverse range of plant species. In citrus, CsMAPK1 is induced by P. ulcerans and plays a role in regulating bacterial resistance [45]. In tobacco, MAPK expression can be activated by a variety of biotic stresses and defense hormones [46,47]. In Arabidopsis, MAPK3 and MAPK6 are involved in riboflavin-induced resistance to the tomato pathogenic variant of Pseudomonas syringae (Pst DC3000), and MPK15 regulates resistance to powdery mildew [48]. HvMPK4 in barley is a negative regulator of basal resistance in barley and inhibits immunity to barley powdery mildew fungi [49]. The MKP1–MAPK cascade positively regulates vascular defenses by activating lignin biosynthesis and has a positive effect on nonhost resistance (NHR) in monocotyledonous rice and dicotyledonous Arabidopsis thaliana and on host resistance to vascular pathogens [50]. In the soybean, the Glyma.18G268800 gene was found to be involved in resistance to Phytophthora root rot through the MAPK signaling pathway [51]. In peas, expression of the PsMAPK3 gene is associated with resistance to A. pisense [52].
Expression of PVMAPK05 is high in the stem and pod, which may be the first sites invaded or vulnerable to the pathogen under biological stress (anthrax infection). The high expression of PvMAPK05 in these tissues may enable the plant to rapidly sense the invasion signals of pathogenic bacteria. Since the MAPK cascade plays a key role in plant signal transduction, PvMAPK05 may act as an early signal sensing and conduction molecule, transmitting signals of pathogen invasion to downstream defense-related genes or signaling pathways [6]. For example, when anthrax infects the stem, PvMAPK05 may be activated through its conserved domain (such as containing TEY or TDY phosphorylation sites) and then phosphorylate downstream substrates (such as transcription factors or other kinases), thus initiating the expression of defense-related genes, such as genes involved in plant cell wall strengthening, synthesis of antimicrobial substances, and so on.
The tissue structures and physiological functions of the stem, tip, and pod are different, and their defense responses to biological stress may also be specific. The high expression of PvMAPK05 in these tissues may help regulate tissue-specific defense responses. In stems, it may be involved in regulating lignin synthesis to enhance the mechanical strength of stems and present a physical barrier to pathogens. In the pod, it may be related to regulating the closure mechanism of the pod or the accumulation of antibacterial substances in the pod to protect the seeds from pathogens. In addition, the high expression of PvMAPK05 may work synergistically with other defense-related genes in these tissues to form a multilayered defense system. For example, it may interact with PR genes (disease course-related genes) that are involved in the plant’s immune response to regulate the plant’s resistance to anthrax.
In this study, the relative expression levels of PvMAPK genes in anthracnose-infected and uninfected tissues varied among different oil bean varieties. The relative expression levels of PvMAPK05, PvMAPK07, PvMAPK09, and PvMAPK11 exhibited particularly marked changes in response to anthracnose infection across multiple varieties, suggesting that they may play a role in the anthracnose response of P. vulgaris. However, the precise response mechanism remains to be clarified, and further research is necessary to assess their potential roles in disease resistance.

4. Materials and Methods

4.1. MAPK Gene Identification and Protein Characterization

Ation Resource (TAIR) 10 database (https://www.arabidopsis.org/, accessed on 26 November 2024) and rice MAPK protein sequences from the Phytozome database (https://phytozome-next.jgi.doe.gov/, accessed on 26 November 2024). These sequences were used as BLASTP queries to identify candidate MAPK genes in P. vulgaris by searching against the P. vulgaris genome protein sequences (taxid:3885) at NCBI. These candidate sequences were identified by searching the NCBI (https://www.ncbi.nlm.nih.gov/Structure, accessed on 26 November 2024) “CD-search” Accession: cd07858 and cd07859, SMART (https://smart.embl.de/, accessed on 26 November 2024), and PFAM databases (http://pfam.xfam.org/, accessed on 26 November 2024) (PFAM ID:PF00069, PF07714) for structural domain validation again to ensure that they have conserved structural domains specific to MAPK. Candidates with missing or incomplete MAPK structural domains were removed, and the remaining genes were identified as P. vulgaris MAPK genes. We examined the physiochemical properties of their encoded proteins using ExPASy-PROSITE (https://prosite.ExPASy.org/, accessed on 26 November 2024), predicted the protein subcellular localizations with WOLF PSORT (https://wolfpsort.hgc.jp), and searched for signal peptides using SignalP-6.0 (https://services.healthtech.dtu.dk/services/SignalP-6.0/, accessed on 26 November 2024). To visualize the positions of the PvMAPKs on chromosomes, we downloaded the P. vulgaris genome sequences and gene annotations from Phytozome (https://phytozome-next.jgi.doe.gov/, accessed on 26 November 2024) and used them as input for the ‘Visualize Gene Structure (from GTF/GFF3 File)’ module of TBtools (Version 1.108).

4.2. Analyses of Protein Phylogeny and Gene Collinearity

Firstly, we conducted a multiple sequence alignment of the MAPK gene family sequences from the cauliflower bean using MEGA11.0 software. The alignment was performed with the following parameters: Gap Open set to −2.90, Gap Extend to 0.00, and Hydrophobicity Multiplier to 1.20. We limited the number of iterations to 16. For the initial iterations (1.2), we employed the UPGMA clustering method, which was also used for subsequent iterations. Additionally, we set the minimum diagonal length (Lambda) to 24 to ensure the alignment’s precision and consistency. Then we constructed a neighbor-joining phylogenetic tree of MAPK protein sequences from P. vulgaris (13 sequences), Arabidopsis (20), and O. sativa (17) using MEGA 11.0 software with the Jones–Taylor–Thornton (Tl) model substitution model, 1000 bootstrap replicates, and pairwise deletions. A phylogenetic tree for the 13 P. vulgaris proteins alone was constructed using the same method.
Genome sequence files and gene annotation files for P. vulgaris, Arabidopsis, rice, and soybean were downloaded from the Phytozome database (https://phytozome-next.jgi.doe.gov/, accessed on 26 November 2024). Intraspecific and interspecific collinearity of MAPK genes was analyzed using the ‘One Step McscanX’ and ‘Dual Synteny Plot’ functions in TBtools. Intragenomic Ka/Ks values for collinear gene pairs were calculated using the ‘Simple Ka/Ks Calculator (NG)’ in TBtools.

4.3. Protein Motifs and Gene Structures of the PvMAPKs

Motifs were predicted in the PvMAPK proteins using MEME tools (https://meme-suite.org/meme/tools/meme, accessed on 26 November 2024) with the number of motifs set to 15 and the remaining parameters set to default values. The ‘Gene Structure View (Advanced)’ function of TBtools was used to visualize intron–exon structures, protein motifs, and conserved domains, together with the PvMAPK phylogenetic tree.

4.4. Identification of Cis-Acting Promoter Elements

Promoter sequences of the P. vulgaris MAPK genes (2000 bp upstream of the start codon) were extracted using TBtools and submitted to the Plant CARE website (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 26 November 2024) for prediction of cis-acting promoter elements. The results were visualized using the ‘Basic Biosequence View’ function of TBtools.

4.5. Expression of PvMAPKs in Different Tissues and in Response to Anthracnose Infection

Transcriptome data (in transcripts per million, TPM) for seven P. vulgaris tissues were downloaded from the Legume Information System database (https://www.legumeinfo.org, accessed on 26 November 2024). The corresponding log2(TPM + 1) values were calculated and visualized using the ‘Heatmap’ function in TBtools.

4.6. Expression of PvMAPKs in Seven Oil Bean Varieties Under Anthracnose Stress

To investigate the effect of anthracnose infection on PvMAPK expression, leaf and stem tissues were sampled from seven field-grown P. vulgaris varieties (‘HuangJinGou’, ‘BaiYunFeng’, ‘Jifeng Oil Bean’, ‘Giant Oil Bean’, ‘YiKeSong’, ‘Wuchang Big Oil Bean’, and ‘P9 oil bean’), with and without naturally occurring anthracnose infection. The plant materials were grown at the Vegetable Teaching and Research Station of Jilin Agricultural University in Changchun, Jilin, China (geocoordinates: longitude 125.406455, latitude 43.816967). Samples were collected at the peak pod-setting stage, with five replicates obtained for each treatment. Following collection, the samples were consolidated, portioned into individual packages, and swiftly frozen in liquid nitrogen for storage, ready for the subsequent extraction of total RNA.
Total RNA was extracted from leaf and stem tissues using the TransZol Up plus RNA kit (TRAN, ER501) and reverse transcribed using a TRAN reverse transcription kit (AU301). qRT-PCR was performed using TB Green Premix Ex Taq II (Tli RNaseH Plus) (TakaRa, RR820A, Tokyo, Japan) on a qTower3 (230 V) (Jena Analytical Instruments (Beijing) Co., Beijing, China) instrument. The 20 μL reaction mixture consisted of 10 μL TB Green Premix Ex Taq II, 0.8 μL each forward and reverse primers, 1 μL cDNA template, and 7.4 μL sterilized double-distilled water. The reaction protocol consisted of an initial denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s and annealing and extension at 60 °C for 30 s, with fluorescence signals collected at each cycle. Each reaction was performed in triplicate, and the relative expression levels of the MAPK genes were calculated using the 2−ΔΔCt method. Fluorescent quantitative primers were designed using Premier 5.0 software (Additional file 12, Table 3) and synthesized by Shenggong Bioengineering (Shanghai, China). The P. vulgaris actin gene was used as an endogenous control.

5. Conclusions

This study conducted a thorough investigation of the MAPK family in Phaseolus vulgaris, identifying a total of 13 PvMAPKs, which were classified into four subfamilies. In-depth analyses of their physicochemical properties, chromosomal locations, phylogenetic relationships, gene structures, conserved motifs, cis-acting elements, and collinearity shed light on their potential roles in evolution and function. Subsequently, plant materials from seven P. vulgaris varieties were employed to assess the relative expression levels of PvMAPKs under conditions of anthracnose stress. The findings revealed a correlation between upregulation and downregulation of the 13 PvMAPKs’ expression levels and anthracnose stress. Among the identified genes, PvMAPK05, PvMAPK07, PvMAPK09, and PvMAPK11 exhibited notably variable expression levels across several distinct cultivars, leading to the hypothesis that these PvMAPKs may play a significant role in the response to anthracnose stress. This variation in expression patterns suggests a potential regulatory function of these genes in the stress response mechanism of Phaseolus vulgaris. Furthermore, the insights gained from this study lay the groundwork for future studies aimed at the functional validation of these genes.

Author Contributions

Data curation: H.L. and D.W.; formal analysis: H.L. and D.W.; investigation: Z.W. and T.Z.; methodology: J.Z. and Y.W.; resources: Z.W. and J.Z.; supervision: H.Q. and Y.H.; writing—original draft: H.L. and D.W.; writing—review and editing: H.L. and D.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by The Collection, Evaluation, and Breeding of New Varieties (Strains) of Oil Bean Germplasm Resources in Northeast China, with the grant number: 20220202099NC.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are included in this published article or its additional files. The datasets used and/or analyzed during the current study are available from the authors on reasonable request (Huiling Liu, liuhuiling@mails.jlau.edu.cn).

Conflicts of Interest

The authors declare that they have no competing interests.

References

  1. Xin, Y.; Xu, L.; Tian, S.; Yang, W. Oil bean curd, an endemic vegetable species in Northeast China. Spec. Econ. Plants Anim. 2020, 23, 30–32. [Google Scholar]
  2. Wu, H. Occurrence and control of anthracnose on kidney beans in the open field. Northwest Hortic. 2022, 44–45. [Google Scholar]
  3. Melotto, M.; Balardin, R.S.; Kelly, J.D. Host–Interaction and variability of Colletotrichum lindemuthianum. In Colletotrichum Host Specificity, Pathology, Host–Pathogen Interaction; APS Press: St. Paul, MN, USA, 2000; pp. 346–361. [Google Scholar]
  4. Kang, F. Occurrence and control of major diseases of kidney bean. Mod. Rural Sci. Technol. 2014, 31. [Google Scholar]
  5. Liu, J.; Zou, X.Y.; Ma, J.F.; Wang, Y.F.; Dong, Z.P.; Li, Z.Y.; Bai, H. Identification of MAPK family members in cereal grains and analysis of their response to biotic stresses. Crop J. 2023, 49, 1480–1495. [Google Scholar]
  6. Ichimura, K.; Shinozaki, K.; Tena, G.; Sheen, J.; Henry, Y.; Champion, A.; Kreis, M.; Zhang, S.; Hirt, H.; Wilson, C.; et al. Mitogen-activated protein kinase cascades in plants: A new nomenclature. Trends Plant Sci. 2002, 7, 301–308. [Google Scholar]
  7. Chuang, H.C.; Wang, X.; Tan, T.H. MAP4K family kinases in immunity and inflammation. Adv. Immunol. 2016, 129, 277–314. [Google Scholar]
  8. Majeed, Y.; Zhu, X.; Zhang, N.; Ul-Ain, N.; Raza, A.; Haider, F.U.; Si, H. Harnessing the role of mitogen-activated protein kinases against abiotic stresses in plants. Front. Plant Sci. 2023, 14, 932923. [Google Scholar] [CrossRef]
  9. Colcombet, J.; Hirt, H. Arabidopsis MAPKs: A complex signalling network involved in multiple biological processes. Biochem. J. 2008, 413, 217–226. [Google Scholar] [CrossRef]
  10. Chen, L.; Hu, W.; Tan, S.; Wang, M.; Ma, Z.; Zhou, S.; Deng, X.; Zhang, Y.; Huang, C.; Yang, G.; et al. Genome-wide identification and analysis of MAPK and MAPK gene families in Brachypodium distachyon. PLoS ONE 2012, 7, e46744. [Google Scholar] [CrossRef]
  11. Liu, Y.K.; Zhang, D.; Wang, L.; Li, D.Q. Genome-wide analysis of mitogen-activated protein kinase gene family in maize. Plant Mol. Biol. Rep. 2013, 316, 1446–1460. [Google Scholar] [CrossRef]
  12. Cui, L.; Yang, G.; Yan, J.; Pan, Y.; Nie, X. Genome-wide identification, expression profiles and regulatory network of MAPK cascade gene family in barley. BMC Genom. 2019, 20, 750. [Google Scholar] [CrossRef] [PubMed]
  13. Zhan, H.; Yue, H.; Zhao, X.; Wang, M.; Song, W.; Nie, X. Genome-Wide Identification and Analysis of MAPK and MAPKK Gene Families in Bread Wheat (Triticum aestivum L.). Genes 2017, 8, 284. [Google Scholar] [CrossRef] [PubMed]
  14. Reyna, N.S.; Yang, Y. Molecular analysis of the rice MAP kinase gene family in relation to Magnaporthe grisea infection. Mol. Plant–Microbe Interact. 2006, 19, 530–540. [Google Scholar] [CrossRef]
  15. Lu, W.; Chu, X.; Li, Y.; Wang, C.; Guo, X. Cotton GhMKK1 induces the tolerance of salt and drought stress, and mediates defence responses to pathogen infection in transgenic Nicotiana benthamiana. PLoS ONE 2013, 8, e68503. [Google Scholar] [CrossRef]
  16. Zhang, X.M.; Wu, G.Q.; Wei, M. Role of MAPK in plant response to adversity stress. J. Grass Ind. 2024, 33, 182–197. [Google Scholar]
  17. Li, N.; Yang, Z.; Li, J.; Xie, W.; Qin, X.; Kang, Y.; Zhang, Q.; Li, X.; Xiao, J.; Ma, H.; et al. Two VQ Proteins are Substrates of the OsMPKK6-OsMPK4 Cascade in Rice Defense Against Bacterial Blight. Rice 2021, 14, 39. [Google Scholar] [CrossRef]
  18. Wang, C.; He, X.; Li, Y.; Wang, L.; Guo, X.; Guo, X. The cotton MAPK kinase GhMPK20 negatively regulates resistance to Fusarium oxysporum by mediating the MKK4-MPK20-WRKY40 cascade. Mol. Plant Pathol. 2018, 19, 1624–1638. [Google Scholar] [CrossRef]
  19. Song, Q.M. Identification, Expression Pattern and Functional Analysis of MAPK and MAPKK Family Genes in Watermelon; Zhejiang University: Hangzhou, China, 2015; p. 298. [Google Scholar]
  20. Lian, K.; Gao, F.; Sun, T.; van Wersch, R.; Ao, K.; Kong, Q.; Nitta, Y.; Wu, D.; Krysan, P.; Zhang, Y. MKK6 Functions in Two Parallel MAP Kinase Cascades in Immune Signaling. Plant Physiol. 2018, 178, 1284–1295. [Google Scholar] [CrossRef]
  21. O’Rourke, J.A.; Iniguez, L.P.; Fu, F.; Bucciarelli, B.; Miller, S.S.; Jackson, S.A.; McClean, P.E.; Li, J.; Dai, X.; Zhao, P.X.; et al. An RNA-Seq based gene expression atlas of the common bean. BMC Genom. 2014, 15, 866. [Google Scholar] [CrossRef]
  22. XIHX Cloning and Functional Analysis of Wheat TaNCED3 Gene; Liaoning Normal University: Dalian, China, 2015.
  23. Li, H.Y. Research on Transcriptional Regulation of Tobacco Under External Application of Abscisic Acid and Salt Stress; Shandong Agricultural University: Taian, China, 2019. [Google Scholar]
  24. Zhang, L.; Li, Y.; Lu, W.; Meng, F.; Wu, C.A.; Guo, X. Cotton GhMKK5 affects disease resistance, induces HR-like cell death, and reduces the tolerance to salt and drought stress in transgenic Nicotiana benthamiana. J. Exp. Bot. 2012, 63, 3935–3951. [Google Scholar] [CrossRef]
  25. Wang, S.; Xie, X.; Che, X.; Lai, W.; Ren, Y.; Fan, X.; Hu, W.; Tang, M.; Chen, H. Host- and virus-induced gene silencing of HOG1-MAPK cascade genes in Rhizophagus irregularis inhibit arbuscule development and reduce resistance of plants to drought stress. Plant Biotechnol. J. 2023, 21, 866–883. [Google Scholar] [CrossRef] [PubMed]
  26. Pedley, K.F.; Martin, G.B. Role of mitogen-activated protein kinases in plant immunity. Curr. Opin. Plant Biol. 2005, 8, 541–547. [Google Scholar] [CrossRef] [PubMed]
  27. Singh, A.; Nath, O.; Singh, S.; Kumar, S.; Singh, I.K. Genome-wide identification of the MAPK gene family in chickpea and expression analysis during development and stress response. Plant Gene 2017, 13, 25–35. [Google Scholar] [CrossRef]
  28. Zhou, M.; Zhao, B.; Li, H.; Ren, W.; Zhang, Q.; Liu, Y.; Zhao, J. Comprehensive analysis of MAPK cascade genes in sorghum (Sorghum bicolor L.) reveals SbMPK14 as a potential target for drought sensitivity regulation. Genomics 2022, 114, 110311. [Google Scholar] [CrossRef]
  29. Wang, Z.; Wan, Y.; Meng, X.; Zhang, X.; Yao, M.; Miu, W.; Zhu, D.; Yuan, D.; Lu, K.; Li, J.; et al. Genome-Wide Identification and Analysis of MKK and MAPK Gene Families in Brassica Species and Response to Stress in Brassica napus. Int. J. Mol. Sci. 2021, 22, 544. [Google Scholar] [CrossRef]
  30. Mohanta, T.K.; Arora, P.K.; Mohanta, N.; Parida, P.; Bae, H. Identification of new members of the MAPK gene family in plants shows diverse conserved domains and novel activation loop variants. BMC Genom. 2015, 16, 58. [Google Scholar] [CrossRef]
  31. Berriri, S.; Garcia, A.V.; dit Frey, N.F.; Rozhon, W.; Pateyron, S.; Leonhardt, N.; Montillet, J.L.; Leung, J.; Hirt, H.; Colcombet, J. Constitutively active mitogen-activated protein kinase versions reveal functions of Arabidopsis MPK4 in pathogen defense signalling. Plant Cell 2012, 24, 4281–4293. [Google Scholar] [CrossRef]
  32. Ali, A.; Chu, N.; Ma, P.; Javed, T.; Zaheer, U.; Huang, M.T.; Fu, H.Y.; Gao, S.J. Genome-wide analysis of mitogen-activated protein (MAP) kinase gene family expression in response to biotic and abiotic stresses in sugarcane. Physiol. Plant. 2021, 171, 86–107. [Google Scholar] [CrossRef]
  33. Zhang, X.; Xu, X.; Yu, Y.; Chen, C.; Wang, J.; Cai, C.; Guo, W. Integration analysis of MKK and MAPK family members highlights potential MAPK signalling modules in cotton. Sci. Rep. 2016, 6, 29781. [Google Scholar]
  34. Chen, L.; Song, H.; Xin, J.; Dong, G.; Xu, F.; Su, Y.; Yang, M.; Sun, H. Comprehensive genome-wide identification and functional characterization of MAPK cascade gene families in Nelumbo. Int. J. Biol. Macromol. 2023, 233, 123543. [Google Scholar] [CrossRef]
  35. Chen, X.; Sun, Y.; Yang, Y.; Zhao, Y.; Zhang, C.; Fang, X.; Gao, H.; Zhao, M.; He, S.; Song, B.; et al. The EIN3 transcription factor GmEIL1 improves soybean resistance to Phytophthora sojae. Mol. Plant Pathol. 2024, 25, e13452. [Google Scholar] [CrossRef] [PubMed]
  36. Kozyulina, P.Y.; Pavlova, O.A.; Kantsurova, E.S.; Bovin, A.D.; Shirobokova, S.A.; Dolgikh, A.V.; Dymo, A.M.; Dolgikh, E.A. Transcriptomic analysis of pea plant responses to chitooligosaccharides’ treatment revealed stimulation of mitogen-activated protein kinase cascade. Front. Plant Sci. 2023, 14, 1092013. [Google Scholar] [CrossRef] [PubMed]
  37. Ali, S.; Mir, Z.A.; Tyagi, A.; Bhat, J.A.; Chandrashekar, N.; Papolu, P.K.; Rawat, S.; Grover, A. Identification and comparative analysis of Brassica juncea pathogenesis-related genes in response to hormonal, biotic and abiotic stresses. Acta Physiol. Plant 2017, 39, 268. [Google Scholar] [CrossRef]
  38. Li, Y.; Qin, L.; Zhao, J.; Muhammad, T.; Cao, H.; Li, H.; Zhang, Y.; Liang, Y. SlMAPK3 enhances tolerance to tomato yellow leaf curl virus (TYLCV) by regulating salicylic acid and jasmonic acid signaling in tomato (Solanum lycopersicum). PLoS ONE 2017, 12, e0172466. [Google Scholar] [CrossRef]
  39. Jalmi, S.K.; Sinha, A.K. Functional Involvement of a Mitogen Activated Protein Kinase Module, OsMKK3-OsMPK7-OsWRK30 in Mediating Resistance against Xanthomonas oryzae in Rice. Sci. Rep. 2016, 6, 37974. [Google Scholar] [CrossRef]
  40. Xue, P.; Zhang, L.; Fan, R.; Li, Y.; Han, X.; Qi, T.; Zhao, L.; Yu, D.; Shen, Q.H. HvMPK4 phosphorylates HvWRKY1 to enhance its suppression of barley immunity to powdery mildew fungus. J. Genet. Genom. 2024, 51, 313–325. [Google Scholar] [CrossRef]
  41. Wang, Z.; Li, X.; Yao, X.; Ma, J.; Lu, K.; An, Y.; Sun, Z.; Wang, Q.; Zhou, M.; Qin, L.; et al. MYB44 regulates PTI by promoting the expression of EIN2 and MPK3/6 in Arabidopsis. Plant Commun. 2023, 4, 100628. [Google Scholar] [CrossRef]
  42. Goyal, R.K.; Tulpan, D.; Chomistek, N.; González-Peña Fundora, D.; West, C.; Ellis, B.E.; Frick, M.; Laroche, A.; Foroud, N.A. Analysis of MAPK and MAPKK gene families in wheat and related Triticeae species. BMC Genom. 2018, 19, 178. [Google Scholar] [CrossRef]
  43. Zhu, X.; Duan, H.; Zhang, G.; Jin, H.; Xu, C.; Chen, S.; Zhou, C.; Chen, Z.; Tang, J.; Zhang, Y. StMAPK1 functions as a thermos-tolerant gene in regulating heat stress tolerance in potato (Solanum tuberosum). Front. Plant Sci. 2023, 14, 1218962. [Google Scholar] [CrossRef]
  44. Jiang, C.; Zu, C.; Lu, D.; Zheng, Q.; Shen, J.; Wang, H.; Li, D. Effect of exogenous selenium supply on photosynthesis, Na+ accumulation and antioxidative capacity of maize (Zea mays L.) under salinity stress. Sci. Rep. 2017, 7, 42039. [Google Scholar] [CrossRef]
  45. Jagodzik, P.; Tajdel-Zielinska, M.; Ciesla, A.; Marczak, M.; Ludwikow, A. Mitogen-Activated Protein Kinase Cascades in Plant Hormone Signaling. Front. Plant Sci. 2018, 9, 1387. [Google Scholar] [CrossRef]
  46. Gao, Z.; Zhang, D.; Wang, X.; Zhang, X.; Wen, Z.; Zhang, Q.; Li, D.; Dinesh-Kumar, S.P.; Zhang, Y. Coat proteins of necroviruses target 14-3-3a to subvert MAPKKKα-mediated antiviral immunity in plants. Nat. Commun. 2022, 13, 716. [Google Scholar] [CrossRef] [PubMed]
  47. de Oliveira, M.L.; de Lima Silva, C.C.; Abe, V.Y.; Costa, M.G.; Cernadas, R.A.; Benedetti, C.E. Increased resistance against citrus canker mediated by a citrus mitogen-activated protein kinase. Mol. Plant-Microbe Interact. 2013, 26, 1190–1199. [Google Scholar] [CrossRef] [PubMed]
  48. Wilson, C.; Eller, N.; Gartner, A.; Vicente, O.; Heberle-Bors, E. Isolation and characterization of a tobacco cDNA clone encoding a putative MAP kinase. Plant Mol. Biol. 1993, 23, 543–551. [Google Scholar] [CrossRef] [PubMed]
  49. Zhang, S.; Klessig, D.F. Salicylic acid activates a 48-kD MAP kinase in tobacco. Plant Cell 1997, 9, 809–824. [Google Scholar] [PubMed]
  50. Hoyos, M.E.; Zhang, S. Calcium-independent activation of salicylic acid-induced protein kinase and a 40-kilodalton protein kinase by hyperosmotic stress. Plant Physiol. 2000, 122, 1355–1364. [Google Scholar] [CrossRef]
  51. Nie, S.; Xu, H. Riboflavin-Induced Disease Resistance Requires the Mitogen-Activated Protein Kinases 3 and 6 in Arabidopsis thaliana. PLoS ONE 2016, 11, e0153175. [Google Scholar] [CrossRef]
  52. Lin, H.; Wang, M.; Chen, Y.; Nomura, K.; Hui, S.; Gui, J.; Zhang, X.; Wu, Y.; Liu, J.; Li, Q.; et al. An MKP-MAPK protein phosphorylation cascade controls vascular immunity in plants. Sci. Adv. 2022, 8, eabg8723. [Google Scholar] [CrossRef]
Figure 1. Locations of PvMAPK genes on eight of the eleven P. vulgaris chromosomes.
Figure 1. Locations of PvMAPK genes on eight of the eleven P. vulgaris chromosomes.
Ijms 25 13101 g001
Figure 2. Phylogenetic evolution tree of the MAPK gene family in Arabidopsis thaliana, Oryza sativa, and Phaseolus vulgaris. Pv: Phaseolus vulgaris, At: Arabidopsis thaliana, Os: Oryza sativa.
Figure 2. Phylogenetic evolution tree of the MAPK gene family in Arabidopsis thaliana, Oryza sativa, and Phaseolus vulgaris. Pv: Phaseolus vulgaris, At: Arabidopsis thaliana, Os: Oryza sativa.
Ijms 25 13101 g002
Figure 3. Identification of collinear PvMAPK gene pairs on P. vulgaris chromosomes. The outermost circle shows gene density, and the red lines connect syntenic PvMAPK gene pairs.
Figure 3. Identification of collinear PvMAPK gene pairs on P. vulgaris chromosomes. The outermost circle shows gene density, and the red lines connect syntenic PvMAPK gene pairs.
Ijms 25 13101 g003
Figure 4. Intergenomic collinearity analysis of P. vulgaris with A. thaliana (top) and G. max (bottom). Blue lines connect syntenic pairs of MAPK genes between species.
Figure 4. Intergenomic collinearity analysis of P. vulgaris with A. thaliana (top) and G. max (bottom). Blue lines connect syntenic pairs of MAPK genes between species.
Ijms 25 13101 g004
Figure 5. Conserved protein motifs, conserved protein domains, and gene structures of PvMAPK family members in P. vulgaris. (A) Neighbor-joining phylogenetic tree of the PvMAPKs. (B) Conserved motifs identified in the PvMAPK proteins using MEME tools. Sequence information for each motif is presented in Figure 6. (C) Conserved domains of the PvMAPK proteins STKc_TDY_MAPK (cd07859) and STKc_TEY_MAPK (cd07858). (D) Exon–intron structures of the PvMAPK genes. Green, untranslated region; yellow, coding sequence; gray line, intron.
Figure 5. Conserved protein motifs, conserved protein domains, and gene structures of PvMAPK family members in P. vulgaris. (A) Neighbor-joining phylogenetic tree of the PvMAPKs. (B) Conserved motifs identified in the PvMAPK proteins using MEME tools. Sequence information for each motif is presented in Figure 6. (C) Conserved domains of the PvMAPK proteins STKc_TDY_MAPK (cd07859) and STKc_TEY_MAPK (cd07858). (D) Exon–intron structures of the PvMAPK genes. Green, untranslated region; yellow, coding sequence; gray line, intron.
Ijms 25 13101 g005
Figure 6. Sequence logos of 15 conserved motifs identified in the P. vulgaris PvMAPK proteins using MEME tools.
Figure 6. Sequence logos of 15 conserved motifs identified in the P. vulgaris PvMAPK proteins using MEME tools.
Ijms 25 13101 g006
Figure 7. cis-elements identified in the PvMAPK promoters (2000 bp upstream of the start codon).
Figure 7. cis-elements identified in the PvMAPK promoters (2000 bp upstream of the start codon).
Ijms 25 13101 g007
Figure 8. Numbers of promoter cis-elements from different classes in the 2000-bp upstream regions of the PvMAPK genes.
Figure 8. Numbers of promoter cis-elements from different classes in the 2000-bp upstream regions of the PvMAPK genes.
Ijms 25 13101 g008
Figure 9. Expression of PvMAPK genes in seven tissues of P. vulgaris.
Figure 9. Expression of PvMAPK genes in seven tissues of P. vulgaris.
Ijms 25 13101 g009
Figure 10. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘HuangJinGou’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Figure 10. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘HuangJinGou’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Ijms 25 13101 g010
Figure 11. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘BaiYunFeng’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Figure 11. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘BaiYunFeng’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Ijms 25 13101 g011
Figure 12. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘Jifeng Oil Bean’ plants with and without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Figure 12. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘Jifeng Oil Bean’ plants with and without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Ijms 25 13101 g012
Figure 13. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘Giant Oil Bean’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Figure 13. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘Giant Oil Bean’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Ijms 25 13101 g013
Figure 14. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘YiKeSong’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Figure 14. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘YiKeSong’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Ijms 25 13101 g014
Figure 15. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘Wuchang Big Oil Bean’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized of those in uninfected plants, which were set to 1.
Figure 15. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘Wuchang Big Oil Bean’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized of those in uninfected plants, which were set to 1.
Ijms 25 13101 g015
Figure 16. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘P9 oil bean’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Figure 16. qRT-PCR analysis of PvMAPK gene expression in field-grown P. vulgaris ‘P9 oil bean’ plants with or without anthracnose infection. Relative expression in leaves (A) and stems (B) is shown, and values for anthracnose-infected plants are normalized to those of uninfected plants, which were set to 1.
Ijms 25 13101 g016
Table 1. Basic information on PvMAPK family members in P. vulgaris.
Table 1. Basic information on PvMAPK family members in P. vulgaris.
Gene Name Gene IDNumber of Amino Acids (aa) Molecular Weight (kD) Isoelectric Point (pI)Subcellular LocationSignal Peptide
PvMAPK01PAC:2714024337442.866.14cytoNO
PvMAPK02PAC:2714248439545.065.57cytoNO
PvMAPK03PAC:2714456357064.78.94cytoNO
PvMAPK04PAC:2715039960768.979.21nuclNO
PvMAPK05PAC:2715165137242.655.65cytoNO
PvMAPK06PAC:2715561961469.989.15nuclNO
PvMAPK07PAC:2715837150657.756.17cytoNO
PvMAPK08PAC:2716524660368.418.97cytoNO
PvMAPK09PAC:2716665356464.118.82cytoNO
PvMAPK10PAC:2716760136942.488.28cytoNO
PvMAPK11PAC:2717066138243.666.4cytoNO
PvMAPK12PAC:2717096237342.95.83cytoNO
PvMAPK13PAC:2717137758366.117.09cytoNO
Table 2. Ka/Ks values of PvMAPK gene pairs.
Table 2. Ka/Ks values of PvMAPK gene pairs.
Gene 1Gene 2Non-Synonymous (Ka)Synonymous (Ks)Ka/Ks
PvMAPK12PvMAPK110.0836410930.7565033460.110562754
PvMAPK11PvMAPK010.1230210521.6460057770.074739137
PvMAPK12PvMAPK010.1304050851.9529856310.066772168
PvMAPK03PvMAPK090.0527672430.6085544370.086709159
PvMAPK08PvMAPK060.0921426460.66119020.139358759
Table 3. Primer sequences for qRT-PCR of MAPK genes in P. vulgaris.
Table 3. Primer sequences for qRT-PCR of MAPK genes in P. vulgaris.
GeneForward Sequence (5′-3′)Reverse Sequence (5′-3′)
Pv-ActinGAAGTTCTCTTCCAACCATCCTTTCCTTGCTCATTCTGTCCG
PvMAPK01TGGTGGACGCTACATTCAGTTGCATGATCCATGTGCCGAA
PvMAPK02GTTGCGTCTGCTTATGGAGCGTGCCAGGGCATCTTCAACA
PvMAPK03GACGGAGAAGAGCCAACAGGAAAGGAGGCCTGGTCATTGG
PvMAPK04CCAGAACTGTGTGGCTCCTTTGCAGTAGACGAAGTGCCAA
PvMAPK05CTTCTTGGTACCCCAACCGAAGTGCTTCTTCAACTGTAATTCTTT
PvMAPK06ACAGACAATCCTGCCCCAAGTCTGTTGCTGTTGCTGACCT
PvMAPK07ACCACCGGAGAAATCGATGCAGGGAAGCAACCTTCTGTGT
PvMAPK08AAACCGACCAACTGCTGAGGTAAGCTGGGGGAACAGGTTG
PvMAPK09AGACCCCCTAGCTCTTCGTTATCCGGCGTCTCTCAAACTC
PvMAPK10AAGTCCTCGCAGCCACTTTCGTTCGTGCAAGCCCAAAGTC
PvMAPK11TTCCACAGTACCGGAAGCAACTGGGACAGACTGGCTCATC
PvMAPK12GACCTCCCAGAAAGGATGCCCACCGGGTGACCACATACTC
PvMAPK13CGCGCAGTTGTCTTCCATTCGTGAGCATCAACGGCAGAAC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, H.; Wang, D.; Wang, Z.; Zhao, T.; Zhang, J.; Wang, Y.; Qiao, H.; Han, Y. Identification of MAPK Genes in Phaseolus vulgaris and Analysis of Their Expression Patterns in Response to Anthracnose. Int. J. Mol. Sci. 2024, 25, 13101. https://doi.org/10.3390/ijms252313101

AMA Style

Liu H, Wang D, Wang Z, Zhao T, Zhang J, Wang Y, Qiao H, Han Y. Identification of MAPK Genes in Phaseolus vulgaris and Analysis of Their Expression Patterns in Response to Anthracnose. International Journal of Molecular Sciences. 2024; 25(23):13101. https://doi.org/10.3390/ijms252313101

Chicago/Turabian Style

Liu, Huiling, Da Wang, Zhenyu Wang, Tong Zhao, Jingying Zhang, Yan Wang, Hongyu Qiao, and Yuzhu Han. 2024. "Identification of MAPK Genes in Phaseolus vulgaris and Analysis of Their Expression Patterns in Response to Anthracnose" International Journal of Molecular Sciences 25, no. 23: 13101. https://doi.org/10.3390/ijms252313101

APA Style

Liu, H., Wang, D., Wang, Z., Zhao, T., Zhang, J., Wang, Y., Qiao, H., & Han, Y. (2024). Identification of MAPK Genes in Phaseolus vulgaris and Analysis of Their Expression Patterns in Response to Anthracnose. International Journal of Molecular Sciences, 25(23), 13101. https://doi.org/10.3390/ijms252313101

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop