Assessment of Changes in the Expression of Genes Involved in Insulin Signaling and Glucose Transport in Leukocytes of Women with Gestational Diabetes During Pregnancy and in the Postpartum Period
Abstract
1. Introduction
2. Results
2.1. Comparison of Clinical Phenotypes of Diabetic Patients at GDM Diagnosis and 1 Year Postpartum
2.2. Longitudinal Changes in the Transcriptional Levels of the Studied Genes
2.3. Correlations Between Clinical Phenotypes of Patients and the Transcriptional Levels of the Studied Genes
2.4. The Potential of the Studied Transcripts and Clinical Parameters as Predictors for pAGT
3. Discussion
4. Materials and Methods
4.1. Study Design and Participants
4.2. Diagnosis of GDM and Postpartum OGTT Diagnostic Categories
4.3. Anthropometric Measurements and Biochemical Assays
4.4. Calculations
4.5. Blood Collection and Isolation of Blood Leukocytes
4.6. RNA Extraction and cDNA Synthesis
4.7. mRNA Expression by Quantitative RT-PCR
4.8. Statistical Analysis
Sample Size Calculation
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- International Diabetes Federation. IDF Diabetes Atlas, 10th ed.; International Diabetes Federation: Brussels, Belgium, 2021; Available online: www.diabetesatlas.org (accessed on 27 August 2024).
- Paulo, M.S.; Abdo, N.M.; Bettencourt-Silva, R.; Al-Rifai, R.H. Gestational Diabetes Mellitus in Europe: A Systematic Review and Meta-Analysis of Prevalence Studies. Front. Endocrinol. 2021, 12, 691033. [Google Scholar] [CrossRef] [PubMed]
- Murray, S.R.; Reynolds, R.M. Short- and long-term outcomes of gestational diabetes and its treatment on fetal development. Prenat. Diagn. 2020, 40, 1085–1091. [Google Scholar] [CrossRef] [PubMed]
- Nguyen-Ngo, C.; Jayabalan, N.; Salomon, C.; Lappas, M. Molecular pathways disrupted by gestational diabetes mellitus. J. Mol. Endocrinol. 2019, 63, R51–R72. [Google Scholar] [CrossRef] [PubMed]
- Colomiere, M.; Permezel, M.; Riley, C.; Desoye, G.; Lappas, M. Defective insulin signaling in placenta from pregnancies complicated by gestational diabetes mellitus. Eur. J. Endocrinol. 2009, 160, 567–578. [Google Scholar] [CrossRef]
- Colomiere, M.; Permezel, M.; Lappas, M. Diabetes and obesity during pregnancy alter insulin signalling and glucose transporter expression in maternal skeletal muscle and subcutaneous adipose tissue. J. Mol. Endocrinol. 2010, 44, 213–223. [Google Scholar] [CrossRef]
- Jansson, T.; Ekstrand, Y.; Wennergren, M.; Powell, T.L. Placental glucose transport in gestational diabetes mellitus. Am. J. Obstet. Gynecol. 2001, 184, 111–116. [Google Scholar] [CrossRef]
- Zhang, B.; Jin, Z.; Sun, L.; Zheng, Y.; Jiang, J.; Feng, C.; Wang, Y. Expression and correlation of sex hormone-binding globulin and insulin signal transduction and glucose transporter proteins in gestational diabetes mellitus placental tissue. Diabetes Res. Clin. Pract. 2016, 119, 106–117. [Google Scholar] [CrossRef]
- Stanirowski, P.J.; Szukiewicz, D.; Pyzlak, M.; Abdalla, N.; Sawicki, W.; Cendrowski, K. Impact of pre-gestational and gestational diabetes mellitus on the expression of glucose transporters GLUT-1, GLUT-4 and GLUT-9 in human term placenta. Endocrine 2017, 55, 799–808. [Google Scholar] [CrossRef]
- Sibiak, R.; Ozegowska, K.; Wender-Ozegowska, E.; Gutaj, P.; Mozdziak, P.; Kempisty, B. Fetomaternal Expression of Glucose Transporters (GLUTs)-Biochemical, Cellular and Clinical Aspects. Nutrients 2022, 14, 2025. [Google Scholar] [CrossRef]
- Morisset, A.S.; Dubé, M.C.; Côté, J.A.; Robitaille, J.; Weisnagel, S.J.; Tchernof, A. Circulating interleukin-6 concentrations during and after gestational diabetes mellitus. Acta Obstet. Gynecol. Scand. 2011, 90, 524–530. [Google Scholar] [CrossRef]
- Zieleniak, A.; Zurawska-Klis, M.; Cypryk, K.; Wozniak, L.; Wojcik, M. Transcriptomic Dysregulation of Inflammation-Related Genes in Leukocytes of Patients with Gestational Diabetes Mellitus (GDM) during and after Pregnancy: Identifying Potential Biomarkers Relevant to Glycemic Abnormality. Int. J. Mol. Sci. 2022, 23, 14677. [Google Scholar] [CrossRef] [PubMed]
- Liew, C.C.; Ma, J.; Tang, H.C.; Zheng, R.; Dempsey, A.A. The peripheral blood transcriptome dynamically reflects system wide biology: A potential diagnostic tool. J. Lab. Clin. Med. 2006, 147, 126–132. [Google Scholar] [CrossRef] [PubMed]
- Wojcik, M.; Zieleniak, A.; Mac-Marcjanek, K.; Wozniak, L.A.; Cypryk, K. The elevated gene expression level of the A(2B) adenosine receptor is associated with hyperglycemia in women with gestational diabetes mellitus. Diabetes Metab. Res. Rev. 2014, 30, 42–53. [Google Scholar] [CrossRef] [PubMed]
- Mac-Marcjanek, K.; Zieleniak, A.; Zurawska-Klis, M.; Cypryk, K.; Wozniak, L.; Wojcik, M. Expression Profile of Diabetes-Related Genes Associated with Leukocyte Sirtuin 1 Overexpression in Gestational Diabetes. Int. J. Mol. Sci. 2018, 19, 3826. [Google Scholar] [CrossRef]
- Kautzky-Willer, A.; Prager, R.; Waldhausl, W.; Pacini, G.; Thomaseth, K.; Wagner, O.F.; Ulm, M.; Streli, C.; Ludvik, B. Pronounced insulin resistance and inadequate beta-cell secretion characterize lean gestational diabetes during and after pregnancy. Diabetes Care 1997, 20, 1717–1723. [Google Scholar] [CrossRef]
- Morikawa, M.; Yamada, T.; Yamada, T.; Sato, S.; Cho, K.; Minakami, H. Prevalence of hyperglycemia during pregnancy according to maternal age and pre-pregnancy body mass index in Japan, 2007–2009. Int. J. Gynaecol. Obstet. 2012, 118, 198–201. [Google Scholar] [CrossRef]
- Baryla, I.; Pluciennik, E.; Kośla, K.; Wojcik, M.; Zieleniak, A.; Zurawska-Klis, M.; Cypryk, K.; Wozniak, L.A.; Bednarek, A.K. Identification of a novel association for the WWOX/HIF1A axis with gestational diabetes mellitus (GDM). PeerJ 2021, 9, e10604. [Google Scholar] [CrossRef]
- Lin, J.; Jin, H.; Chen, L. Associations between insulin resistance and adverse pregnancy outcomes in women with gestational diabetes mellitus: A retrospective study. BMC Pregnancy Childbirth 2021, 21, 526. [Google Scholar] [CrossRef]
- Catalano, P.M.; Ehrenberg, H.M. The short- and long-term implications of maternal obesity on the mother and her offspring. BJOG 2006, 113, 1126–1133. [Google Scholar] [CrossRef]
- Pepys, M.B.; Baltz, M.L. Acute phase proteins with special reference to C-reactive protein and related proteins (pentaxins) and serum amyloid A protein. Adv. Immunol. 1983, 34, 141–212. [Google Scholar] [CrossRef]
- Florez, H.; Castillo-Florez, S.; Mendez, A.; Casanova-Romero, P.; Larreal-Urdaneta, C.; Lee, D.; Goldberg, R. C-reactive protein is elevated in obese patients with the metabolic syndrome. Diabetes Res. Clin. Pract. 2006, 71, 92–100. [Google Scholar] [CrossRef] [PubMed]
- Ferraz, T.B.; Motta, R.S.; Ferraz, C.L.; Capibaribe, D.M.; Forti, A.C.; Chacra, A.R. C-reactive protein and features of metabolic syndrome in Brazilian women with previous gestational diabetes. Diabetes Res. Clin. Pract. 2007, 78, 23–29. [Google Scholar] [CrossRef] [PubMed]
- Fröjdö, S.; Vidal, H.; Pirola, L. Alterations of insulin signaling in type 2 diabetes: A review of the current evidence from humans. Biochim. Biophys. Acta 2009, 1792, 83–92. [Google Scholar] [CrossRef] [PubMed]
- Cruz-Pineda, W.D.; Parra-Rojas, I.; Rodríguez-Ruíz, H.A.; Illades-Aguiar, B.; Matia-García, I.; Garibay-Cerdenares, O.L. The regulatory role of insulin in energy metabolism and leukocyte functions. J. Leukoc. Biol. 2022, 111, 197–208. [Google Scholar] [CrossRef]
- Payankaulam, S.; Raicu, A.M.; Arnosti, D.N. Transcriptional Regulation of INSR, the Insulin Receptor Gene. Genes 2019, 10, 984. [Google Scholar] [CrossRef]
- Andreelli, F.; Laville, M.; Ducluzeau, P.H.; Vega, N.; Vallier, P.; Khalfallah, Y.; Riou, J.P.; Vidal, H. Defective regulation of phosphatidylinositol-3-kinase gene expression in skeletal muscle and adipose tissue of non-insulin-dependent diabetes mellitus patients. Diabetologia 1999, 42, 358–364. [Google Scholar] [CrossRef]
- Ducluzeau, P.H.; Perretti, N.; Laville, M.; Andreelli, F.; Vega, N.; Riou, J.P.; Vidal, H. Regulation by insulin of gene expression in human skeletal muscle and adipose tissue. Evidence for specific defects in type 2 diabetes. Diabetes 2001, 50, 1134–1142. [Google Scholar] [CrossRef]
- Chakraborty, C.; Doss, C.G.; Bhatia, R.; Agoramoorthy, G. Profiling of phosphatidylinositol 3-kinase (PI3K) proteins in insulin signaling pathway. Appl. Biochem. Biotechnol. 2015, 175, 3431–3446. [Google Scholar] [CrossRef]
- Tamemoto, H.; Kadowaki, T.; Tobe, K.; Yagi, T.; Sakura, H.; Hayakawa, T.; Terauchi, Y.; Ueki, K.; Kaburagi, Y.; Satoh, S.; et al. Insulin resistance and growth retardation in mice lacking insulin receptor substrate-1. Nature 1994, 372, 182–186. [Google Scholar] [CrossRef]
- Yamauchi, T.; Tobe, K.; Tamemoto, H.; Ueki, K.; Kaburagi, Y.; Yamamoto-Honda, R.; Takahashi, Y.; Yoshizawa, F.; Aizawa, S.; Akanuma, Y.; et al. Insulin signalling and insulin actions in the muscles and livers of insulin-resistant, insulin receptor substrate 1-deficient mice. Mol. Cell Biol. 1996, 16, 3074–3084. [Google Scholar] [CrossRef]
- Pappa, K.I.; Gazouli, M.; Economou, K.; Daskalakis, G.; Anastasiou, E.; Anagnou, N.P.; Antsaklis, A. Gestational diabetes mellitus shares polymorphisms of genes associated with insulin resistance and type 2 diabetes in the Greek population. Gynecol. Endocrinol. 2011, 27, 267–272. [Google Scholar] [CrossRef] [PubMed]
- Alharbi, K.K.; Khan, I.A.; Abotalib, Z.; Al-Hakeem, M.M. Insulin receptor substrate-1 (IRS-1) Gly927Arg: Correlation with gestational diabetes mellitus in Saudi women. Biomed. Res. Int. 2014, 2014, 146495. [Google Scholar] [CrossRef] [PubMed]
- Barseem, N.F.; Khattab, E.; Dawood, R.; Mohamed, S. GST T1, M1, and IRS-1 G972R Genetic Variants Association to Gestational Diabetes Mellitus (GDM) in Egyptian Women: Linkage to Maternal Hyperglycemia. Curr. Diabetes Rev. 2022, 18, e021921191604. [Google Scholar] [CrossRef] [PubMed]
- Cruz-Pineda, W.D.; Garibay-Cerdenares, O.L.; Rodríguez-Ruíz, H.A.; Matia-García, I.; Marino-Ortega, L.A.; Espinoza-Rojo, M.; Reyes-Castillo, Z.; Castro-Alarcón, N.; Castañeda-Saucedo, E.; Illades-Aguiar, B.; et al. Changes in the Expression of Insulin Pathway, Neutrophil Elastase and Alpha 1 Antitrypsin Genes from Leukocytes of Young Individuals with Insulin Resistance. Diabetes Metab. Syndr. Obes. 2022, 15, 1865–1876. [Google Scholar] [CrossRef]
- Withers, D.J.; Gutierrez, J.S.; Towery, H.; Burks, D.J.; Ren, J.M.; Previs, S.; Zhang, Y.; Bernal, D.; Pons, S.; Shulman, G.I.; et al. Disruption of IRS-2 causes type 2 diabetes in mice. Nature 1998, 391, 900–904. [Google Scholar] [CrossRef]
- Withers, D.J.; Burks, D.J.; Towery, H.H.; Altamuro, S.L.; Flint, C.L.; White, M.F. Irs-2 coordinates Igf-1 receptor-mediated beta-cell development and peripheral insulin signalling. Nat. Genet. 1999, 23, 32–40. [Google Scholar] [CrossRef]
- Rondinone, C.M.; Wang, L.M.; Lonnroth, P.; Wesslau, C.; Pierce, J.H.; Smith, U. Insulin receptor substrate (IRS) 1 is reduced and IRS-2 is the main docking protein for phosphatidylinositol 3-kinase in adipocytes from subjects with non-insulin-dependent diabetes mellitus. Proc. Natl. Acad. Sci. USA 1997, 94, 4171–4175. [Google Scholar] [CrossRef]
- Krause, C.; Geißler, C.; Tackenberg, H.; El Gammal, A.T.; Wolter, S.; Spranger, J.; Mann, O.; Lehnert, H.; Kirchner, H. Multi-layered epigenetic regulation of IRS2 expression in the liver of obese individuals with type 2 diabetes. Diabetologia 2020, 63, 2182–2193. [Google Scholar] [CrossRef]
- Mauvais-Jarvis, F.; Ueki, K.; Fruman, D.A.; Hirshman, M.F.; Sakamoto, K.; Goodyear, L.J.; Iannacone, M.; Accili, D.; Cantley, L.C.; Kahn, C.R. Reduced expression of the murine p85alpha subunit of phosphoinositide 3-kinase improves insulin signaling and ameliorates diabetes. J. Clin. Investig. 2002, 109, 141–149. [Google Scholar] [CrossRef]
- Barbour, L.A.; Shao, J.; Qiao, L.; Leitner, W.; Anderson, M.; Friedman, J.E.; Draznin, B. Human placental growth hormone increases expression of the p85 regulatory unit of phosphatidylinositol 3-kinase and triggers severe insulin resistance in skeletal muscle. Endocrinology 2004, 145, 1144–1150. [Google Scholar] [CrossRef]
- Bandyopadhyay, G.K.; Yu, J.G.; Ofrecio, J.; Olefsky, J.M. Increased p85/55/50 expression and decreased phosphotidylinositol 3-kinase activity in insulin-resistant human skeletal muscle. Diabetes 2005, 54, 2351–2359. [Google Scholar] [CrossRef] [PubMed]
- Hu, S.; Ma, S.; Li, X.; Tian, Z.; Liang, H.; Yan, J.; Chen, M.; Tan, H. Relationships of SLC2A4, RBP4, PCK1, and PI3K Gene Polymorphisms with Gestational Diabetes Mellitus in a Chinese Population. Biomed. Res. Int. 2019, 2019, 7398063. [Google Scholar] [CrossRef] [PubMed]
- Karadoğan, A.H.; Arikoglu, H.; Göktürk, F.; İşçioğlu, F.; İpekçi, S.H. PIK3R1 gene polymorphisms are associated with type 2 diabetes and related features in the Turkish population. Adv. Clin. Exp. Med. 2018, 27, 921–927. [Google Scholar] [CrossRef] [PubMed]
- Tsuchida, H.; Björnholm, M.; Fernström, M.; Galuska, D.; Johansson, P.; Wallberg-Henriksson, H.; Zierath, J.R.; Lake, S.; Krook, A. Gene expression of the p85alpha regulatory subunit of phosphatidylinositol 3-kinase in skeletal muscle from type 2 diabetic subjects. Pflugers Arch. 2002, 445, 25–31. [Google Scholar] [CrossRef] [PubMed]
- Giorgino, F.; Pedrini, M.T.; Matera, L.; Smith, R.J. Specific increase in p85alpha expression in response to dexamethasone is associated with inhibition of insulin-like growth factor-I stimulated phosphatidylinositol 3-kinase activity in cultured muscle cells. J. Biol. Chem. 1997, 272, 7455–7463. [Google Scholar] [CrossRef]
- Handberg, A.; Vaag, A.; Damsbo, P.; Beck-Nielsen, H.; Vinten, J. Expression of insulin regulatable glucose transporters in skeletal muscle from type 2 (non-insulin-dependent) diabetic patients. Diabetologia 1990, 33, 625–627. [Google Scholar] [CrossRef]
- Huang, S.; Czech, M.P. The GLUT4 glucose transporter. Cell Metab. 2007, 5, 237–252. [Google Scholar] [CrossRef]
- Maratou, E.; Dimitriadis, G.; Kollias, A.; Boutati, E.; Lambadiari, V.; Mitrou, P.; Raptis, S.A. Glucose transporter expression on the plasma membrane of resting and activated white blood cells. Eur. J. Clin. Investig. 2007, 37, 282–290. [Google Scholar] [CrossRef]
- Kipmen-Korgun, D.; Bilmen-Sarikcioglu, S.; Altunbas, H.; Demir, R.; Korgun, E.T. Type-2 diabetes down-regulates glucose transporter proteins and genes of the human blood leukocytes. Scand. J. Clin. Lab. Investig. 2009, 69, 350–358. [Google Scholar] [CrossRef]
- Boileau, P.; Mrejen, C.; Girard, J.; Hauguel-de Mouzon, S. Overexpression of GLUT3 placental glucose transporter in diabetic rats. J. Clin. Investig. 1995, 96, 309–317. [Google Scholar] [CrossRef]
- Simpson, I.A.; Dwyer, D.; Malide, D.; Moley, K.H.; Travis, A.; Vannucci, S.J. The facilitative glucose transporter GLUT3: 20 years of distinction. Am. J. Physiol. Endocrinol. Metab. 2008, 295, E242–E253. [Google Scholar] [CrossRef] [PubMed]
- Metzger, B.E.; Gabbe, S.G.; Persson, B.; Buchanan, T.A.; Catalano, P.A.; Damm, P.; Dyer, A.R.; Leiva, A.; Hod, M.; Kitzmiler, J.L.; et al. International association of diabetes and pregnancy study groups recommendations on the diagnosis and classification of hyperglycemia in pregnancy. Diabetes Care 2010, 33, 676–682. [Google Scholar] [CrossRef] [PubMed]
- Diagnostic criteria and classification of hyperglycaemia first detected in pregnancy: A World Health Organization Guideline. Diabetes Res. Clin. Pract. 2014, 103, 341–363. [CrossRef] [PubMed]
- Araszkiewicz, A.; Bandurska-Stankiewicz, E.; Budzyński, A.; Cypryk, K.; Czech, A.; Czupryniak, L.; Drzewoski, J.; Dzida, G.; Dziedzic, T.; Franek, E.; et al. 2019 Guidelines on the management of diabetic patients. A position of Diabetes Poland. Clin. Diabet. 2019, 8, 1–95. [Google Scholar] [CrossRef]
- Matthews, D.R.; Hosker, J.P.; Rudenski, A.S.; Naylor, B.A.; Treacher, D.F.; Turner, R.C. Homeostasis model assessment: Insulin resistance and β-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 1985, 28, 412–419. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Hochberg, Y.; Benjamini, Y. More powerful procedures for multiple significance testing. Stat. Med. 1990, 9, 811–818. [Google Scholar] [CrossRef]
- Noether, G.E. Sample Size Determination for Some Common Nonparametric Tests. J. Am. Stat. Assoc. 1987, 82, 645–647. [Google Scholar] [CrossRef]
Variable | GDM | NGT | FC | p-Value |
---|---|---|---|---|
Maternal age [years] | 32.0 (29.0–35.0) | 29.0 (26.0–32.0) | 1.10 | 0.014 |
Gestational age at OGTT [week] | 28.0 (27.0–29.0) | 27.0 (26.0–30.0) | 1.04 | 0.550 |
Pre-pregnancy BMI [kg/m2] | 24.9 (22.6–28.1) | 24.2 (22.2–26.8) | 1.03 | 0.352 |
Pregnancy weight [kg] | 76.6 (69.3–85.0) | 74.1 (65.6–85.8) | 1.03 | 0.219 |
GWG [kg] | 9.0 (5.4–11.3) | 8.0 (5.0–12.0) | 1.13 | 0.853 |
FPG [mg/dL] | 87.0 (81.0–94.0) | 81.0 (74.5–84.5) | 1.07 | <0.001 |
1 h-PG [mg/dL] | 182.5 (156.0–192.0) | 152.0 (129.0–163.0) | 1.20 | <0.001 |
2 h-PG [mg/dL] | 158.0 (145.0–167.0) | 139.5 (120.0–147.0) | 1.13 | <0.001 |
HbA1C [%] | 5.0 (4.8–5.3) | 5.2 (5.0–5.5) | 0.95 | 0.472 |
FI [μIU/mL] | 12.4 (7.9–15.8) | 6.8 (2.6–8.9) | 1.82 | <0.001 |
HOMA-B | 144.2 (116.8–221.9) | 124.6 (70.4–174.0) | 1.16 | 0.068 |
HOMA-IR | 2.6 (1.7–3.8) | 1.3 (0.5–1.82) | 1.96 | <0.001 |
TC [mg/dL] | 249.0 (224.2–279.0) | 271.5 (236.0–296.7) | 0.92 | 0.075 |
HDL-C [mg/dL] | 78.0 (65.1–87.0) | 81.7 (70.4–91.1) | 0.95 | 0.241 |
LDL-C [mg/dL] | 134.0 (114.0–159.0) | 144.0 (125.0–168.0) | 0.93 | 0.217 |
TGs [mg/dL] | 216.9 (182.1–257.3) | 214.00 (179.2–246.8) | 1.01 | 0.746 |
CRP [mg/dL] | 4.1 (2.1–6.1) | 3.3 (2.0–6.4) | 1.23 | 0.692 |
Variable | pGDM | FC pGDM vs. GDM | p-Value pGDM vs. GDM | FC pGDM vs. NGT | p-Value pGDM vs. NGT |
---|---|---|---|---|---|
Postpartum BMI [kg/m2] | 24.6 (21.9–30.1) | 0.99 | 0.505 | 1.02 | 0.440 |
FPG [mg/dL] | 90.2 (86.0–98.0) | 1.04 | 0.028 | 1.11 | <0.001 |
2 h-PG [mg/dL] | 105.5 (92.0–125.0) | 0.67 | <0.001 | 0.76 | <0.001 |
HbA1C [%] | 5.1 (5.0–5.3) | 1.03 | 0.790 | 0.98 | 0.792 |
FI [μIU/mL] | 9.5 (5.9–12.4) | 0.77 | 0.001 | 1.40 | 0.005 |
HOMA-B | 115.4 (89.2–173.6) | 0.69 | <0.001 | 0.93 | 0.831 |
HOMA-IR | 2.1 (1.2–3.1) | 0.78 | 0.005 | 1.52 | 0.001 |
TC [mg/dL] | 187.0 (158.0–206.0) | 0.75 | <0.001 | 0.69 | <0.001 |
HDL-C [mg/dL] | 59.0 (51.0–68.0) | 0.76 | <0.001 | 0.72 | <0.001 |
LDL-C [mg/dL] | 97.0 (86.0–132.0) | 0.72 | <0.001 | 0.67 | <0.001 |
TGs [mg/dL] | 91.3 (61.3–114.1) | 0.42 | <0.001 | 0.43 | <0.001 |
CRP [mg/dL] | 1.8 (1.0–3.3) | 0.44 | <0.001 | 0.55 | 0.002 |
Group/ Comparison | SLC2A1 | SLC2A3 | SLC2A4 | PIK3R1 | INSR | IRS1 | IRS2 |
---|---|---|---|---|---|---|---|
NGT (n =44) | 0.008 | 0.108 | 0.261 | 0.140 | 0.240 | 2.122 | 0.563 |
(0.006–0.010) | (0.025–0.215) | (0.145–0.510) | (0.071–0.377) | (0.013–0.603) | (0.427–4.091) | (0.117–0.903) | |
GDM (n = 48) | 0.013 | 0.432 | 0.194 | 1.058 | 0.355 | 0.498 | 0.470 |
(0.011–0.017) | (0.313–0.715) | (0.134–0.536) | (0.803–1.442) | (0.065–0.808) | (0.105–1.259) | (0.015–0.970) | |
pGDM (n = 48) | 0.019 | 0.595 | 0.642 | 0.673 | 0.329 | 0.893 | 0.577 |
(0.014–0.023) | (0.178–0.897) | (0.399–1.194) | (0.510–0.942) | (0.014–0.805) | (0.438–2.069) | (0.053–4.427) | |
GDM/NGT | |||||||
FC | 1.61 | 4.01 | 0.75 | 7.57 | 1.48 | 0.23 | 0.83 |
p-value | <0.001 | <0.001 | 0.312 | <0.001 | 0.371 | 0.046 t | 0.705 |
pGDM/GDM | |||||||
FC | 1.44 | 1.38 | 3.30 | 0.64 | 0.93 | 1.79 | 1.23 |
p-value | 0.005 | 0.626 | <0.001 | 0.012 w | 0.975 | 0.221 | 0.157 w |
pGDM/NGT | |||||||
FC | 2.32 | 5.51 | 2.46 | 4.81 | 1.37 | 0.42 | 1.02 |
p-value | <0.001 | <0.001 | 0.002 | <0.001 | 0.651 | 0.030 t | 0.667 |
Variable | SLC2A1 | SLC2A3 | SLC2A4 | PIK3R1 | INSR | IRS1 | IRS2 |
---|---|---|---|---|---|---|---|
Maternal age [years] | 0.20 | −0.03 | −0.26 | 0.07 | 0.00 | −0.03 | 0.03 |
Pre-pregnancy BMI [kg/m2] | −0.08 | −0.21 | −0.36 | 0.15 | −0.17 | −0.36 | 0.26 |
Pregnancy weight [kg] | −0.24 | −0.17 | −0.31 | 0.04 | −0.17 | −0.37 | 0.46 * |
GWG [kg] | 0.10 | 0.12 | 0.19 | 0.24 | −0.05 | −0.23 | 0.17 |
FPG [mg/dL] | 0.26 | 0.04 | −0.27 | 0.18 | 0.18 | 0.13 | 0.42 * |
1 h-PG [mg/dL] | 0.06 | 0.08 | −0.12 | 0.19 | 0.10 | −0.20 | 0.02 |
2 h-PG [mg/dL] | 0.06 | −0.41 | −0.12 | 0.14 | −0.15 | −0.03 | 0.18 |
HbA1C [%] | 0.25 | 0.06 | −0.13 | 0.16 | −0.10 | −0.20 | 0.14 |
FI [μIU/mL] | −0.02 | −0.24 | −0.31 | −0.18 | −0.26 | −0.36 | 0.44 * |
HOMA-B | −0.16 | −0.25 | −0.29 | −0.33 | −0.30 | −0.54 * | 0.15 |
HOMA-IR | −0.01 | −0.18 | −0.28 | −0.19 | −0.21 | −0.22 | 0.48 ** |
TC [mg/dL] | −0.23 | −0.02 | 0.29 | −0.02 | 0.04 | −0.15 | −0.16 |
HDL-C [mg/dL] | −0.43 | −0.05 | 0.16 | −0.07 | 0.00 | 0.14 | −0.20 |
LDL-C [mg/dL] | 0.08 | 0.09 | 0.15 | 0.00 | 0.01 | −0.07 | −0.13 |
TGs [mg/dL] | −0.02 | −0.31 | −0.20 | 0.06 | −0.06 | −0.43 | 0.20 |
CRP [mg/dL] | −0.06 | 0.03 | 0.11 | −0.23 | 0.09 | −0.12 | 0.21 |
Variable | SLC2A1 | SLC2A3 | SLC2A4 | PIK3R1 | INSR | IRS1 | IRS2 |
---|---|---|---|---|---|---|---|
Maternal age [years] | −0.10 | −0.16 | −0.20 | 0.05 | 0.01 | 0.22 | −0.03 |
Pre-pregnancy BMI [kg/m2] | −0.36 | −0.03 | 0.03 | −0.23 | 0.22 | −0.07 | 0.19 |
Postpartum BMI [kg/m2] | 0.00 | −0.24 | −0.31 | 0.22 | −0.06 | −0.36 | 0.21 |
FPG [mg/dL] | 0.13 | −0.44 | −0.52 * | 0.58 * | 0.05 | 0.08 | 0.29 |
2 h OGTT [mg/dL] | −0.21 | 0.29 | −0.26 | −0.05 | −0.02 | −0.08 | 0.32 |
HbA1C [%] | −0.05 | −0.37 | −0.14 | 0.33 | 0.02 | −0.18 | 0.21 |
FI [μIU/mL] | 0.01 | −0.36 | −0.43 | 0.35 | −0.25 | −0.28 | 0.32 |
HOMA-B | 0.03 | −0.05 | 0.02 | −0.09 | −0.11 | −0.23 | 0.09 |
HOMA-IR | −0.06 | −0.44 | −0.48 ** | 0.39 | −0.25 | −0.19 | 0.26 |
TC [mg/dL] | 0.04 | 0.04 | −0.15 | 0.07 | 0.08 | −0.16 | −0.12 |
HDL-C [mg/dL] | −0.10 | 0.38 | 0.49 | −0.13 | 0.21 | 0.52 * | −0.28 |
LDL-C [mg/dL] | 0.17 | −0.19 | −0.24 | 0.16 | −0.10 | −0.35 | −0.05 |
TGs [mg/dL] | −0.11 | 0.06 | −0.17 | −0.38 | 0.07 | −0.28 | 0.13 |
CRP [mg/dL] | −0.34 | 0.17 | 0.08 | −0.31 | −0.09 | −0.43 | 0.25 |
Variable | AUC | SE | 95% CI | p-Value | Cut-Point | Youden’s Index | Sensitivity * | Specificity * |
---|---|---|---|---|---|---|---|---|
SLC2A1 | 0.63 | 0.15 | 0.32–0.93 | 0.416 | 0.01 | 0.35 | 0.75 | 0.60 |
SLC2A3 | 0.65 | 0.13 | 0.40–0.90 | 0.234 | 0.38 | 0.53 | 1.00 | 0.53 |
SLC2A4 | 0.58 | 0.13 | 0.32–0.83 | 0.562 | 0.21 | 0.40 | 1.00 | 0.40 |
PIK3R1 | 0.62 | 0.16 | 0.31–0.92 | 0.456 | 0.99 | 0.35 | 0.50 | 0.85 |
INSR | 0.77 | 0.09 | 0.59–0.94 | 0.003 | 0.66 | 0.54 | 0.70 | 0.84 |
IRS1 | 0.71 | 0.12 | 0.46–0.95 | 0.097 | 0.55 | 0.55 | 1.00 | 0.55 |
IRS2 | 0.63 | 0.11 | 0.42–0.84 | 0.238 | 0.05 | 0.32 | 0.90 | 0.42 |
Maternal age [years] | 0.47 | 0.09 | 0.29–0.65 | 0.737 | 26.00 | 0.09 | 1.00 | 0.09 |
Pre-pregnancy BMI [kg/m2] | 0.66 | 0.10 | 0.46–0.86 | 0.114 | 28.91 | 0.48 | 0.57 | 0.91 |
Pregnancy weight [kg] | 0.71 | 0.09 | 0.52–0.89 | 0.030 | 82.90 | 0.49 | 0.69 | 0.79 |
GWG [kg] | 0.47 | 0.10 | 0.28–0.66 | 0.732 | 9.60 | 0.17 | 0.46 | 0.71 |
FPG [mg/dL] | 0.65 | 0.09 | 0.48–0.82 | 0.094 | 101.00 | 0.31 | 0.43 | 0.88 |
1 h-PG [mg/dL] | 0.63 | 0.10 | 0.44–0.83 | 0.185 | 178.00 | 0.37 | 0.83 | 0.54 |
2 h-PG [mg/dL] | 0.43 | 0.10 | 0.23–0.63 | 0.518 | 167.00 | 0.12 | 0.36 | 0.77 |
HbA1C [%] | 0.62 | 0.10 | 0.42–0.81 | 0.241 | 5.42 | 0.28 | 0.39 | 0.90 |
FI [μIU/mL] | 0.51 | 0.11 | 0.29–0.72 | 0.965 | 25.30 | 0.28 | 0.31 | 0.97 |
HOMA-B | 0.43 | 0.10 | 0.24–0.63 | 0.494 | 191.52 | 0.16 | 0.54 | 0.63 |
HOMA-IR | 0.53 | 0.11 | 0.32–0.75 | 0.757 | 6.37 | 0.28 | 0.31 | 0.97 |
TC [mg/dL] | 0.44 | 0.09 | 0.26–0.63 | 0.543 | 260.00 | 0.12 | 0.46 | 0.66 |
HDL-C [mg/dL] | 0.64 | 0.10 | 0.44–0.84 | 0.171 | 61.10 | 0.37 | 0.46 | 0.91 |
LDL-C [mg/dL] | 0.50 | 0.09 | 0.32–0.69 | 0.990 | 157.00 | 0.14 | 0.39 | 0.75 |
TGs [mg/dL] | 0.47 | 0.10 | 0.28–0.66 | 0.785 | 217.70 | 0.18 | 0.62 | 0.56 |
CRP [mg/dL] | 0.57 | 0.09 | 0.39–0.75 | 0.436 | 3.75 | 0.22 | 0.69 | 0.53 |
Source | B (SE) | Wald χ2 | p-Value | OR (95% CI) |
---|---|---|---|---|
Intercept | −9.44 (3.96) | 5.67 | 0.017 | 0.00 (0.00–0.19) |
Pregnancy INSR expression | 2.45 (1.09) | 5.02 | 0.025 | 11.61 (1.36–99.16) |
Pregnancy body weight [kg] | 0.09 (0.04) | 4.32 | 0.038 | 1.09 (1.01–1.19) |
GenBank | Gene | Description | Sequence 5′ → 3′ | Product Length [bp] | |
---|---|---|---|---|---|
NM_006516.4 | SLC2A1 | Solute carrier family 2 member 1 | F R | CTTCACTGTCGTGTCGCTGT TGAGTATGGCACAACCCGC | 95 |
NM_006931.3 | SLC2A3 | Solute carrier family 2 member 3 | F R | TGGAGAAAACTTGCTGCTGAGA TCAGAGCTGGGGTGACCTTCT | 141 |
NM_001042.3 | SLC2A4 | Solute carrier family 2 member 4 | F R | CCTGCCAGAAAGAGTCTGAA GCTTCCGCTTCTCATCCTT | 85 |
NM_181523.3 NM_181504.4 NM_181524.2 NM_001242466.2 | PIK3R1 | Phosphoinositide-3-kinase regulatory subunit 1 | F R | GGAAGCGAGATGGCACTTTT ACAATGCTTTACTTCGCCGTC | 92 |
NM_000208.4 NM_001079817.3 | INSR | Insulin receptor | F R | CAAGCACTTCGCTCTGGAAC ACGTCTAAATAGTCTGTCACGTAG | 144 |
NM_005544.3 | IRS1 | Insulin receptor substrate 1 | F R | TCAAGTGAGGATTTAAGCGCC TTAGGTCTTCATTCTGCTGTGA | 100 |
NM_003749.3 | IRS2 | Insulin receptor substrate 2 | F R | ACCATCGTGAAAGAGTGAAGAT ACACAGTCATTGCTCAGATCCA | 142 |
NM_001101.5 | ACTB | Actin beta | FR | GCACAGAGCCTCGCCTT GTTGTCGACGACGAGCG | 93 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zieleniak, A.; Zurawska-Klis, M.; Laszcz, K.; Bulash, K.; Pacyga, D.; Cypryk, K.; Wozniak, L.; Wojcik, M. Assessment of Changes in the Expression of Genes Involved in Insulin Signaling and Glucose Transport in Leukocytes of Women with Gestational Diabetes During Pregnancy and in the Postpartum Period. Int. J. Mol. Sci. 2024, 25, 13094. https://doi.org/10.3390/ijms252313094
Zieleniak A, Zurawska-Klis M, Laszcz K, Bulash K, Pacyga D, Cypryk K, Wozniak L, Wojcik M. Assessment of Changes in the Expression of Genes Involved in Insulin Signaling and Glucose Transport in Leukocytes of Women with Gestational Diabetes During Pregnancy and in the Postpartum Period. International Journal of Molecular Sciences. 2024; 25(23):13094. https://doi.org/10.3390/ijms252313094
Chicago/Turabian StyleZieleniak, Andrzej, Monika Zurawska-Klis, Karolina Laszcz, Krystsina Bulash, Dagmara Pacyga, Katarzyna Cypryk, Lucyna Wozniak, and Marzena Wojcik. 2024. "Assessment of Changes in the Expression of Genes Involved in Insulin Signaling and Glucose Transport in Leukocytes of Women with Gestational Diabetes During Pregnancy and in the Postpartum Period" International Journal of Molecular Sciences 25, no. 23: 13094. https://doi.org/10.3390/ijms252313094
APA StyleZieleniak, A., Zurawska-Klis, M., Laszcz, K., Bulash, K., Pacyga, D., Cypryk, K., Wozniak, L., & Wojcik, M. (2024). Assessment of Changes in the Expression of Genes Involved in Insulin Signaling and Glucose Transport in Leukocytes of Women with Gestational Diabetes During Pregnancy and in the Postpartum Period. International Journal of Molecular Sciences, 25(23), 13094. https://doi.org/10.3390/ijms252313094