Sperm-Borne Mitochondrial Activity Influenced by Season and Age of Holstein Bulls
Abstract
1. Introduction
2. Results
2.1. Variation in mtDNA Copy Number Between Young and Old Bulls’ Spermatozoa
2.2. Differential mRNA Expression Patterns of Mitochondrial Protein-Coding Genes in Old and Young Bulls’ Spermatozoa
2.3. Comparative Expression Analysis of All Mitochondrial Protein-Coding Genes Among Each Age Group of Bulls Throughout the Year
2.4. Differential Abundance of the Mitochondrial Expressed Genes in Old and Young Bulls Throughout the Year
2.5. Gene Ontology Analysis of the Top 6 Abundant Protein-Coding Mitochondrial Genes Throughout the Year of Old and Young Bulls’ Spermatozoa
3. Discussion
4. Materials and Methods
4.1. Experimental Design
4.2. DNA Extraction and Quality Control
4.3. RNA Extraction and cDNA Synthesis
4.4. Mitochondrial DNA Copy Number
4.5. Sperm-Borne mRNA Expression Analysis
4.6. Gene Ontology Enrichment and Protein–Protein Interaction Analysis Network
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abdollahi-Arpanahi, R.; Morota, G.; Peñagaricano, F. Predicting bull fertility using genomic data and biological information. J. Dairy Sci. 2017, 100, 9656–9666. [Google Scholar] [CrossRef] [PubMed]
- Braundmeier, A.G.; Miller, D.J. The search is on: Finding accurate molecular markers of male fertility. J. Dairy Sci. 2001, 84, 1915–1925. [Google Scholar] [CrossRef]
- DeJarnette, J.M.; Marshall, C.E.; Lenz, R.W.; Monke, D.R.; Ayars, W.H.; Sattler, C.G. Sustaining the Fertility of Artificially Inseminated Dairy Cattle: The Role of the Artificial Insemination Industry. J. Dairy Sci. 2004, 87, E93–E104. [Google Scholar] [CrossRef]
- Bhave, K.G.; Jawahar, K.T.P.; Kumarasamy, P.; Sivakumar, T.; Joseph, C.; Shirsath, T.; Deshmukh, P.; Venkataramanan, R. Genetic and non-genetic factors affecting semen production and quality characteristics of Gir cattle breed under semi-arid climate. Vet. World 2020, 13, 1714–1718. [Google Scholar] [CrossRef]
- Carvalho, F.E.; Ferraz, J.B.S.; Pedrosa, V.B.; Matos, E.C.; Eler, J.P.; Silva, M.R.; Guimarães, J.D.; Bussiman, F.O.; Silva, B.C.A.; Cançado, F.A.; et al. Genetic parameters for various semen production and quality traits and indicators of male and female reproductive performance in Nellore cattle. BMC Genom. 2023, 24, 150. [Google Scholar] [CrossRef] [PubMed]
- Murphy, E.M.; Kelly, A.K.; O’Meara, C.; Eivers, B.; Lonergan, P.; Fair, S. Influence of bull age, ejaculate number, and season of collection on semen production and sperm motility parameters in Holstein Friesian bulls in a commercial artificial insemination centre. J. Anim. Sci. 2018, 96, 2408–2418. [Google Scholar] [CrossRef]
- Kastelic, J.P. Male involvement in fertility and factors affecting semen quality in bulls. Anim. Front. 2013, 3, 20–25. [Google Scholar] [CrossRef]
- Harrison, T.D.; Chaney, E.M.; Brandt, K.J.; Ault-Seay, T.B.; Schneider, L.G.; Strickland, L.G.; Schrick, F.N.; McLean, K.J. The effects of differing nutritional levels and body condition score on scrotal circumference, motility, and morphology of bovine sperm. Transl. Anim. Sci. 2022, 6, txac001. [Google Scholar] [CrossRef]
- Foote, R.H. Factors influencing the quantity and quality of semen harvested from bulls, rams, boars and stallions. J. Anim. Sci. 1978, 47 (Suppl. S2), 1–11. [Google Scholar]
- Pardede, B.P.; Agil, M.; Yudi, Y.; Supriatna, I. Relationship of frozen-thawed semen quality with the fertility rate after being distributed in the Brahman Cross Breeding Program. Vet. World 2020, 13, 2649–2657. [Google Scholar] [CrossRef]
- Turri, F.; Capra, E.; Lazzari, B.; Cremonesi, P.; Stella, A.; Pizzi, F. A Combined Flow Cytometric Semen Analysis and miRNA Profiling as a Tool to Discriminate Between High- and Low-Fertility Bulls. Front. Vet. Sci. 2021, 8, 703101. [Google Scholar] [CrossRef] [PubMed]
- Kirkman-Brown, J.; Björndahl, L. Evaluation of a disposable plastic Neubauer counting chamber for semen analysis. Fertil. Steril. 2009, 91, 627–631. [Google Scholar] [CrossRef] [PubMed]
- Morrell, J.M.; Nongbua, T.; Valeanu, S.; Lima Verde, I.; Lundstedt-Enkel, K.; Edman, A.; Johannisson, A. Sperm quality variables as indicators of bull fertility may be breed dependent. Anim. Reprod. Sci. 2017, 185, 42–52. [Google Scholar] [CrossRef] [PubMed]
- Samplaski, M.K.; Dimitromanolakis, A.; Lo, K.C.; Grober, E.D.; Mullen, B.; Garbens, A.; Jarvi, K.A. The relationship between sperm viability and DNA fragmentation rates. Reprod. Biol. Endocrinol. 2015, 13, 42. [Google Scholar] [CrossRef] [PubMed]
- Van der Horst, G.; Maree, L.; Du Plessis, S.S. Current perspectives of CASA applications in diverse mammalian spermatozoa. Reprod. Fertil. Dev. 2018, 30, 875. [Google Scholar] [CrossRef]
- Indriastuti, R.; Pardede, B.P.; Gunawan, A.; Ulum, M.F.; Arifiantini, R.I.; Purwantara, B. Sperm Transcriptome Analysis Accurately Reveals Male Fertility Potential in Livestock. Animals 2022, 12, 2955. [Google Scholar] [CrossRef]
- Özbek, M.; Hitit, M.; Kaya, A.; Jousan, F.D.; Memili, E. Sperm Functional Genome Associated With Bull Fertility. Front. Vet. Sci. 2021, 8, 610888. [Google Scholar] [CrossRef]
- Firouzabadi, A.M.; Rezvani, M.E.; Zare, F.; Azizian, H.; Fesahat, F. Possible Impact of Human β-defensin 1 on sperm motility in infertile men with abnormal sperm parameters. Reprod. Biol. 2024, 24, 100887. [Google Scholar] [CrossRef]
- Durairajanayagam, D.; Singh, D.; Agarwal, A.; Henkel, R. Causes and consequences of sperm mitochondrial dysfunction. Andrologia 2021, 53, e13666. [Google Scholar] [CrossRef]
- Vertika, S.; Singh, K.K.; Rajender, S. Mitochondria, spermatogenesis, and male infertility—An update. Mitochondrion 2020, 54, 26–40. [Google Scholar] [CrossRef]
- Rubino, P.; Palini, S.; Chigioni, S.; Carlomagno, G.; Quagliariello, A.; de Stefani, S.; Baglioni, A.; Bulletti, C. Improving fertilization rate in ICSI cycles by adding myoinositol to the semen preparation procedures: A prospective, bicentric, randomized trial on sibling oocytes. J. Assist. Reprod. Genet. 2015, 32, 387–394. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Losano, J.D.A.; Padín, J.F.; Méndez-López, I.; Angrimani, D.S.R.; García, A.G.; Barnabe, V.H.; Nichi, M. The Stimulated Glycolytic Pathway Is Able to Maintain ATP Levels and Kinetic Patterns of Bovine Epididymal Sperm Subjected to Mitochondrial Uncoupling. Oxid. Med. Cell. Longev. 2017, 2017, 1682393. [Google Scholar] [CrossRef] [PubMed]
- Hu, C.H.; Zhuang, X.J.; Wei, Y.M.; Zhang, M.; Lu, S.S.; Lu, Y.Q.; Yang, X.G.; Lu, K.H. Comparison of Mitochondrial Function in Boar and Bull Spermatozoa Throughout Cryopreservation Based on JC-1 Staining. Cryo Lett. 2017, 38, 75–79. [Google Scholar]
- Darr, C.R.; Cortopassi, G.A.; Datta, S.; Varner, D.D.; Meyers, S.A. Mitochondrial oxygen consumption is a unique indicator of stallion spermatozoal health and varies with cryopreservation media. Theriogenology 2016, 86, 1382–1392. [Google Scholar] [CrossRef]
- Espinoza, J.A.; Schulz, M.A.; Sánchez, R.; Villegas, J.V. Integrity of mitochondrial membrane potential reflects human sperm quality. Andrologia 2009, 41, 51–54. [Google Scholar] [CrossRef]
- La Vignera, S.; Condorelli, R.A.; Duca, Y.; Mongioi, L.M.; Cannarella, R.; Giacone, F.; Calogero, A.E. FSH therapy for idiopathic male infertility: Four schemes are better than one. Aging Male 2020, 23, 750–755. [Google Scholar] [CrossRef] [PubMed]
- Madeja, Z.E.; Podralska, M.; Nadel, A.; Pszczola, M.; Pawlak, P.; Rozwadowska, N. Mitochondria Content and Activity Are Crucial Parameters for Bull Sperm Quality Evaluation. Antioxidants 2021, 10, 1204. [Google Scholar] [CrossRef]
- Costa, J.; Braga, P.C.; Rebelo, I.; Oliveira, P.F.; Alves, M.G. Mitochondria Quality Control and Male Fertility. Biology 2023, 12, 827. [Google Scholar] [CrossRef] [PubMed]
- Hecht, N.B.; Liem, H.; Kleene, K.C.; Distel, R.J.; Ho, S.M. Maternal inheritance of the mouse mitochondrial genome is not mediated by a loss or gross alteration of the paternal mitochondrial DNA or by methylation of the oocyte mitochondrial DNA. Dev. Biol. 1984, 102, 452–461. [Google Scholar] [CrossRef]
- Card, C.J.; Krieger, K.E.; Kaproth, M.; Sartini, B.L. Oligo-dT selected spermatozoal transcript profiles differ among higher and lower fertility dairy sires. Anim. Reprod. Sci. 2017, 177, 105–123. [Google Scholar] [CrossRef]
- Hosken, D.J.; Hodgson, D.J. Why do sperm carry RNA? Relatedness, conflict, and control. Trends Ecol. Evol. 2014, 29, 451–455. [Google Scholar] [CrossRef] [PubMed]
- Dadoune, J.-P. Spermatozoal RNAs: What about their functions? Microsc. Res. Tech. 2009, 72, 536–551. [Google Scholar] [CrossRef] [PubMed]
- Goodwin, L.O.; Karabinus, D.S.; Pergolizzi, R.G.; Benoff, S. L-type voltage-dependent calcium channel alpha-1C subunit mRNA is present in ejaculated human spermatozoa. Mol. Hum. Reprod. 2000, 6, 127–136. [Google Scholar] [CrossRef] [PubMed]
- Grivna, S.T.; Beyret, E.; Wang, Z.; Lin, H. A novel class of small RNAs in mouse spermatogenic cells. Genes Dev. 2006, 20, 1709–1714. [Google Scholar] [CrossRef]
- Lalancette, C.; Miller, D.; Li, Y.; Krawetz, S.A. Paternal contributions: New functional insights for spermatozoal RNA. J. Cell. Biochem. 2008, 104, 1570–1579. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Li, Q.; Yao, C.; Wang, Z.; Zhou, Y.; Wang, Y.; Liu, L.; Wang, Y.; Wang, L.; Qiao, Z. Characterization and quantification of mRNA transcripts in ejaculated spermatozoa of fertile men by serial analysis of gene expression. Hum. Reprod. 2006, 21, 1583–1590. [Google Scholar] [CrossRef]
- Lalancette, C.; Thibault, C.; Bachand, I.; Caron, N.; Bissonnette, N. Transcriptome analysis of bull semen with extreme nonreturn rate: Use of suppression-subtractive hybridization to identify functional markers for fertility. Biol. Reprod. 2008, 78, 618–635. [Google Scholar] [CrossRef]
- Li, X.; Duan, C.; Li, R.; Wang, D. Insights into the Mechanism of Bovine Spermiogenesis Based on Comparative Transcriptomic Studies. Animals 2021, 11, 80. [Google Scholar] [CrossRef]
- Liu, X.; Ju, Z.; Wang, L.; Zhang, Y.; Huang, J.; Li, Q.; Li, J.; Zhong, J.; An, L.; Wang, C. Six novel single-nucleotide polymorphisms in SPAG11 gene and their association with sperm quality traits in Chinese Holstein bulls. Anim. Reprod. Sci. 2011, 129, 14–21. [Google Scholar] [CrossRef]
- Selvaraju, S.; Parthipan, S.; Somashekar, L.; Binsila, B.K.; Kolte, A.P.; Arangasamy, A.; Ravindra, J.P.; Krawetz, S.A. Current status of sperm functional genomics and its diagnostic potential of fertility in bovine (Bos taurus). Syst. Biol. Reprod. Med. 2018, 64, 484–501. [Google Scholar] [CrossRef]
- Selvaraju, S.; Swathi, D.; Ramya, L.; Lavanya, M.; Archana, S.S.; Sivaram, M. Orchestrating the expression levels of sperm mRNAs reveals CCDC174 as an important determinant of semen quality and bull fertility. Syst. Biol. Reprod. Med. 2021, 67, 89–101. [Google Scholar] [CrossRef] [PubMed]
- Gur, Y.; Breitbart, H. Mammalian sperm translate nuclear-encoded proteins by mitochondrial-type ribosomes. Genes Dev. 2006, 20, 411–416. [Google Scholar] [CrossRef] [PubMed]
- Gur, Y.; Breitbart, H. Protein synthesis in sperm: Dialog between mitochondria and cytoplasm. Mol. Cell. Endocrinol. 2008, 282, 45–55. [Google Scholar] [CrossRef] [PubMed]
- Herskovits, A.A.; Bibi, E. Association of Escherichia coli ribosomes with the inner membrane requires the signal recognition particle receptor but is independent of the signal recognition particle. Proc. Natl. Acad. Sci. USA 2000, 97, 4621–4626. [Google Scholar] [CrossRef]
- Mai, Z.; Yang, D.; Wang, D.; Zhang, J.; Zhou, Q.; Han, B.; Sun, Z. A narrative review of mitochondrial dysfunction and male infertility. Transl. Androl. Urol. 2024, 13, 2134–2145. [Google Scholar] [CrossRef]
- Moustakli, E.; Zikopoulos, A.; Skentou, C.; Bouba, I.; Tsirka, G.; Stavros, S.; Vrachnis, D.; Vrachnis, N.; Potiris, A.; Georgiou, I.; et al. Sperm Mitochondrial Content and Mitochondrial DNA to Nuclear DNA Ratio Are Associated with Body Mass Index and Progressive Motility. Biomedicines 2023, 11, 3014. [Google Scholar] [CrossRef]
- Narud, B.; Khezri, A.; Nordborg, A.; Klinkenberg, G.; Zeremichael, T.T.; Stenseth, E.-B.; Heringstad, B.; Kommisrud, E.; Myromslien, F.D. Semen quality parameters including metabolites, sperm production traits and fertility in young Norwegian Red AI bulls. Livest. Sci. 2022, 255, 104803. [Google Scholar] [CrossRef]
- Dahadhah, F.W.; Saleh Jaweesh, M.; Al Zoubi, M.S.; Issam Abu Alarjah, M.; Hammadeh, M.E.; Amor, H. Lack of association between single polymorphic variants of the mitochondrial nicotinamide adenine dinucleotide dehydrogenase 3, and 4L (MT-ND3 and MT-ND4L) and male infertility. Andrologia 2021, 53, e14139. [Google Scholar] [CrossRef]
- Díez-Sánchez, C.; Ruiz-Pesini, E.; Lapeña, A.C.; Montoya, J.; Pérez-Martos, A.; Enríquez, J.A.; López-Pérez, M.J. Mitochondrial DNA content of human spermatozoa. Biol. Reprod. 2003, 68, 180–185. [Google Scholar] [CrossRef]
- Popova, D.; Bhide, P.; D’Antonio, F.; Basnet, P.; Acharya, G. Sperm mitochondrial DNA copy numbers in normal and abnormal semen analysis: A systematic review and meta-analysis. BJOG 2022, 129, 1434–1446. [Google Scholar] [CrossRef]
- Chen, Y.; Liao, T.; Zhu, L.; Lin, X.; Wu, R.; Jin, L. Seminal plasma cell-free mitochondrial DNA copy number is associated with human semen quality. Eur. J. Obstet. Gynecol. Reprod. Biol. 2018, 231, 164–168. [Google Scholar] [CrossRef] [PubMed]
- Malik, A.N.; Czajka, A. Is mitochondrial DNA content a potential biomarker of mitochondrial dysfunction? Mitochondrion 2013, 13, 481–492. [Google Scholar] [CrossRef] [PubMed]
- Rosati, A.J.; Whitcomb, B.W.; Brandon, N.; Buck Louis, G.M.; Mumford, S.L.; Schisterman, E.F.; Pilsner, J.R. Sperm mitochondrial DNA biomarkers and couple fecundity. Hum. Reprod. 2020, 35, 2619–2625. [Google Scholar] [CrossRef] [PubMed]
- Smith, A.R.; Lin, P.-I.D.; Rifas-Shiman, S.L.; Rahman, M.L.; Gold, D.R.; Baccarelli, A.A.; Claus Henn, B.; Amarasiriwardena, C.; Wright, R.O.; Coull, B.; et al. Prospective Associations of Early Pregnancy Metal Mixtures with Mitochondria DNA Copy Number and Telomere Length in Maternal and Cord Blood. Environ. Health Perspect. 2021, 129, 117007. [Google Scholar] [CrossRef] [PubMed]
- Tiegs, A.W.; Tao, X.; Landis, J.; Zhan, Y.; Franasiak, J.M.; Seli, E.; Wells, D.; Fragouli, E.; Scott, R.T. Sperm Mitochondrial DNA Copy Number Is Not a Predictor of Intracytoplasmic Sperm Injection (ICSI) Cycle Outcomes. Reprod. Sci. 2020, 27, 1350–1356. [Google Scholar] [CrossRef] [PubMed]
- Song, G.J.; Lewis, V. Mitochondrial DNA integrity and copy number in sperm from infertile men. Fertil. Steril. 2008, 90, 2238–2244. [Google Scholar] [CrossRef]
- Orsztynowicz, M.; Pawlak, P.; Podstawski, Z.; Nizanski, W.; Partyka, A.; Gotowiecka, M.; Kosiniak-Kamysz, K.; Lechniak, D. Mitochondrial DNA Copy Number in Spermatozoa of Fertile Stallions. Reprod. Domest. Anim. 2016, 51, 378–385. [Google Scholar] [CrossRef]
- Lima-Verde, I.; Hurri, E.; Ntallaris, T.; Johannisson, A.; Stålhammar, H.; Morrell, J.M. Sperm Quality in Young Bull Semen Can Be Improved by Single Layer Centrifugation. Animals 2022, 12, 2435. [Google Scholar] [CrossRef]
- Meuwissen, T.H.; Hayes, B.J.; Goddard, M.E. Prediction of total genetic value using genome-wide dense marker maps. Genetics 2001, 157, 1819–1829. [Google Scholar] [CrossRef] [PubMed]
- Karabinus, D.S.; Evenson, D.P.; Jost, L.K.; Baer, R.K.; Kaproth, M.T. Comparison of semen quality in young and mature Holstein bulls measured by light microscopy and flow cytometry. J. Dairy Sci. 1990, 73, 2364–2371. [Google Scholar] [CrossRef]
- Pardede, B.P.; Supriatna, I.; Yudi, Y.; Agil, M. Decreased bull fertility: Age-related changes in sperm motility and DNA fragmentation. E3S Web Conf. 2020, 151, 1010. [Google Scholar] [CrossRef]
- Anwar, K.; Thaller, G.; Saeed-Zidane, M. Genetic Variations in the NRF2 Microsatellite Contribute to the Regulation of Bovine Sperm-Borne Antioxidant Capacity. Cells 2024, 13, 1601. [Google Scholar] [CrossRef] [PubMed]
- Butler, M.L.; Bormann, J.M.; Weaber, R.L.; Grieger, D.M.; Rolf, M.M. Selection for bull fertility: A review. Transl. Anim. Sci. 2020, 4, 423–441. [Google Scholar] [CrossRef] [PubMed]
- Piomboni, P.; Focarelli, R.; Stendardi, A.; Ferramosca, A.; Zara, V. The role of mitochondria in energy production for human sperm motility. Int. J. Androl. 2012, 35, 109–124. [Google Scholar] [CrossRef]
- Wai, T.; Ao, A.; Zhang, X.; Cyr, D.; Dufort, D.; Shoubridge, E.A. The role of mitochondrial DNA copy number in mammalian fertility. Biol. Reprod. 2010, 83, 52–62. [Google Scholar] [CrossRef]
- Koller, A.; Fazzini, F.; Lamina, C.; Rantner, B.; Kollerits, B.; Stadler, M.; Klein-Weigel, P.; Fraedrich, G.; Kronenberg, F. Mitochondrial DNA copy number is associated with all-cause mortality and cardiovascular events in patients with peripheral arterial disease. J. Intern. Med. 2020, 287, 569–579. [Google Scholar] [CrossRef]
- Guha, M.; Avadhani, N.G. Mitochondrial retrograde signaling at the crossroads of tumor bioenergetics, genetics and epigenetics. Mitochondrion 2013, 13, 577–591. [Google Scholar] [CrossRef]
- Zhang, Z.; Yang, D.; Zhou, B.; Luan, Y.; Yao, Q.; Liu, Y.; Yang, S.; Jia, J.; Xu, Y.; Bie, X.; et al. Decrease of MtDNA copy number affects mitochondrial function and involves in the pathological consequences of ischaemic stroke. J. Cell. Mol. Med. 2022, 26, 4157–4168. [Google Scholar] [CrossRef]
- Wu, Z.; Puigserver, P.; Andersson, U.; Zhang, C.; Adelmant, G.; Mootha, V.; Troy, A.; Cinti, S.; Lowell, B.; Scarpulla, R.C.; et al. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 1999, 98, 115–124. [Google Scholar] [CrossRef]
- Reznik, E.; Miller, M.L.; Şenbabaoğlu, Y.; Riaz, N.; Sarungbam, J.; Tickoo, S.K.; Al-Ahmadie, H.A.; Lee, W.; Seshan, V.E.; Hakimi, A.A.; et al. Mitochondrial DNA copy number variation across human cancers. Elife 2016, 5, e10769. [Google Scholar] [CrossRef]
- Zhao, Z.; Yang, T.; Li, F. Sperm RNA code in spermatogenesis and male infertility. Reprod. Biomed. Online 2024, 49, 104375. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Umehara, T.; Okazaki, T.; Goto, M.; Fujita, Y.; Hoque, S.A.M.; Kawai, T.; Zeng, W.; Shimada, M. Gene Expression and Protein Synthesis in Mitochondria Enhance the Duration of High-Speed Linear Motility in Boar Sperm. Front. Physiol. 2019, 10, 252. [Google Scholar] [CrossRef]
- Manev, H.; Dzitoyeva, S. Progress in mitochondrial epigenetics. Biomol. Concepts 2013, 4, 381–389. [Google Scholar] [CrossRef]
- Oluwayiose, O.A.; Josyula, S.; Houle, E.; Marcho, C.; Brian, W.W.; Rahil, T.; Sites, C.K.; Pilsner, J.R. Association between sperm mitochondarial DNA copy number and nuclear DNA methylation. Epigenomics 2020, 12, 2141–2153. [Google Scholar] [CrossRef]
- Sirard, M.-A. Distribution and dynamics of mitochondrial DNA methylation in oocytes, embryos and granulosa cells. Sci. Rep. 2019, 9, 11937. [Google Scholar] [CrossRef] [PubMed]
- Timón-Gómez, A.; Nývltová, E.; Abriata, L.A.; Vila, A.J.; Hosler, J.; Barrientos, A. Mitochondrial cytochrome c oxidase biogenesis: Recent developments. Semin. Cell Dev. Biol. 2018, 76, 163–178. [Google Scholar] [CrossRef]
- Perrotta, I.; Santoro, M.; Guido, C.; Avena, P.; Tripepi, S.; de Amicis, F.; Gervasi, M.C.; Aquila, S. Expression of cyclooxygenase-1 (COX-1) and COX-2 in human male gametes from normal patients, and those with varicocele and diabetes: A potential molecular marker for diagnosing male infertility disorders. J. Anat. 2012, 221, 209–220. [Google Scholar] [CrossRef] [PubMed]
- Kern, S.; Maddocks, S. Indomethacin blocks the immunosuppressive activity of rat testicular macrophages cultured in vitro. J. Reprod. Immunol. 1995, 28, 189–201. [Google Scholar] [CrossRef] [PubMed]
- Carbajo, R.J.; Kellas, F.A.; Runswick, M.J.; Montgomery, M.G.; Walker, J.E.; Neuhaus, D. Structure of the F1-binding domain of the stator of bovine F1Fo-ATPase and how it binds an alpha-subunit. J. Mol. Biol. 2005, 351, 824–838. [Google Scholar] [CrossRef]
- Anderson, S.; Bankier, A.T.; Barrell, B.G.; de Bruijn, M.H.; Coulson, A.R.; Drouin, J.; Eperon, I.C.; Nierlich, D.P.; Roe, B.A.; Sanger, F.; et al. Sequence and organization of the human mitochondrial genome. Nature 1981, 290, 457–465. [Google Scholar] [CrossRef]
- Zhao, X.-M.; Du, W.-H.; Wang, D.; Hao, H.-S.; Liu, Y.; Qin, T.; Zhu, H.-B. Recovery of mitochondrial function and endogenous antioxidant systems in vitrified bovine oocytes during extended in vitro culture. Mol. Reprod. Dev. 2011, 78, 942–950. [Google Scholar] [CrossRef] [PubMed]
- Klinke, D.J. Signal transduction networks in cancer: Quantitative parameters influence network topology. Cancer Res. 2010, 70, 1773–1782. [Google Scholar] [CrossRef] [PubMed]
- Selvaraju, S.; Parthipan, S.; Somashekar, L.; Kolte, A.P.; Krishnan Binsila, B.; Arangasamy, A.; Ravindra, J.P. Occurrence and functional significance of the transcriptome in bovine (Bos taurus) spermatozoa. Sci. Rep. 2017, 7, 42392. [Google Scholar] [CrossRef] [PubMed]
- Puri, P.; Myers, K.; Kline, D.; Vijayaraghavan, S. Proteomic analysis of bovine sperm YWHA binding partners identify proteins involved in signaling and metabolism. Biol. Reprod. 2008, 79, 1183–1191. [Google Scholar] [CrossRef]
- Leahy, T.; Marti, J.I.; Crossett, B.; Evan, G.; Maxwell, W.M.C. Two-dimensional polyacrylamide gel electrophoresis of membrane proteins from flow cytometrically sorted ram sperm. Theriogenology 2011, 75, 962–971. [Google Scholar] [CrossRef]
- Mimaki, M.; Wang, X.; McKenzie, M.; Thorburn, D.R.; Ryan, M.T. Understanding mitochondrial complex I assembly in health and disease. Biochim. Biophys. Acta 2012, 1817, 851–862. [Google Scholar] [CrossRef]
- Al Smadi, M.A.; Hammadeh, M.E.; Solomayer, E.; Batiha, O.; Altalib, M.M.; Jahmani, M.Y.; Shboul, M.A.; Nusair, B.; Amor, H. Impact of Mitochondrial Genetic Variants in ND1, ND2, ND5, and ND6 Genes on Sperm Motility and Intracytoplasmic Sperm Injection (ICSI) Outcomes. Reprod. Sci. 2021, 28, 1540–1555. [Google Scholar] [CrossRef]
- Reverter, A.; Okimoto, R.; Sapp, R.; Bottje, W.G.; Hawken, R.; Hudson, N.J. Chicken muscle mitochondrial content appears co-ordinately regulated and is associated with performance phenotypes. Biol. Open 2017, 6, 50–58. [Google Scholar] [CrossRef]
Node1 | Node2 | Score | Node1 | Node2 | Score | Node1 | Node2 | Score |
---|---|---|---|---|---|---|---|---|
ND5 | ND4 | 0.989 | COX3 | COX1 | 0.942 | ND6 | COX3 | 0.322 |
ND4 | CYTB | 0.989 | COX1 | COX3 | 0.942 | COX3 | ND6 | 0.322 |
ND4 | ND2 | 0.989 | ND4 | COX1 | 0.940 | ND1 | ATP8 | 0.311 |
ND4 | ND5 | 0.989 | ND3 | ND1 | 0.940 | ATP8 | ND1 | 0.311 |
ND2 | ND4 | 0.989 | ND1 | ND3 | 0.940 | ND5 | ATP8 | 0.302 |
CYTB | ND4 | 0.989 | COX2 | COX1 | 0.940 | ATP8 | ND5 | 0.302 |
ND5 | ND2 | 0.985 | COX1 | ND4 | 0.940 | CYTB | ATP8 | 0.285 |
ND2 | ND5 | 0.985 | COX1 | COX2 | 0.940 | ATP8 | CYTB | 0.285 |
CYTB | COX3 | 0.985 | CYTB | COX1 | 0.938 | COX2 | ATP8 | 0.273 |
COX3 | CYTB | 0.985 | COX1 | CYTB | 0.938 | ATP8 | COX2 | 0.273 |
ND5 | CYTB | 0.984 | ND5 | ATP6 | 0.936 | ND6 | COX1 | 0.212 |
ND4 | COX3 | 0.984 | ATP6 | ND5 | 0.936 | COX1 | ND6 | 0.212 |
ND2 | CYTB | 0.984 | ND3 | ND2 | 0.914 | COX3 | ATP8 | 0.205 |
CYTB | ND5 | 0.984 | ND2 | ND3 | 0.914 | ATP8 | COX3 | 0.205 |
CYTB | ND2 | 0.984 | ND6 | ND5 | 0.910 | COX1 | ATP8 | 0.123 |
COX3 | ND4 | 0.984 | ND5 | ND6 | 0.910 | ATP8 | COX1 | 0.123 |
ND4 | ATP6 | 0.979 | ND4L | ND4 | 0.891 | ND2 | COX3 | 0.109 |
ND2 | ND1 | 0.979 | ND4 | ND4L | 0.891 | COX3 | ND2 | 0.109 |
ND1 | ND2 | 0.979 | ND5 | ND3 | 0.884 | ND2 | ND3 | 0.103 |
ATP6 | ND4 | 0.979 | ND3 | ND5 | 0.884 | ND3 | ND2 | 0.103 |
Symbol | Gene Name | Primer Sequence (5′-3′) | Size (bp) |
---|---|---|---|
ND1 | NADH Oxidoreductase Core Subunit 1 | F: 5′CACTACGACCCGCTACATCT3′ R: 5′AGTTGGAAGCTCAGCCTGAT3′ | 195 |
ND2 | NADH Oxidoreductase Core Subunit 2 | F: 5′ATCACAACCCACGAGCTACA3′ R: 5′GATGCCCTGTGTTACTTCTGG3′ | 227 |
ND3 | NADH Oxidoreductase Core Subunit 3 | F: 5′ATCGCATTCTGACTTCCCCA3′ R: 5′CAGTGGTAGGAGGAGTGCAA3′ | 168 |
ND4 | NADH Oxidoreductase Core Subunit 4 | F: 5′GGAAACCAAACAGAACGCCT3′ R: 5′AGGTAGTCAAAGGTGGAGGC3′ | 243 |
ND4L | NADH Oxidoreductase Core Subunit 4L | F: 5′AGCAGCCCTAACAATCCTCA3′ R: 5′AGCATTGGAGTAAGTTGAGGTT3′ | 167 |
ND5 | NADH Oxidoreductase Core Subunit 5 | F: 5′TGAGAAGGCGTCGGAATCAT3′ R: 5′GGATTTTCCGGTTGCAGCTA3′ | 243 |
ND6 | NADH Oxidoreductase Core Subunit 6 | F: 5′ACTGGCTTGTTGATGGAGTTC3′ R: 5′TAAAGCCGCAATCCCTATGG3′ | 156 |
CYTB | Cytochrome B | F: 5′TACCCATATCTGCCGAGACG3′ R: 5′TGGTGATGACTGTTGCTCCT3′ | 245 |
COX1 | Cytochrome C Oxidase Subunits I | F: 5′AGGAGCCATCAACTTCATTACA3′ R: 5′AGGTTCCGGTCTGTTAATAGCA3′ | 168 |
COX2 | Cytochrome C Oxidase Subunits II | F: 5′CCAGGGGAGCTACGACTATT3′ R: 5′GACCCGCAAATTTCTGAGCA3′ | 218 |
COX3 | Cytochrome C Oxidase Subunits II | F: 5′ATCCGAGAAAGCACCTTCCA3′ R: 5′TGTTGAGCAGTGGGACTTCT3′ | 217 |
ATP6 | ATP Synthase Membrane Subunits 6 | F: 5′ACCCACTCCACTAATCCCAATA3′ R: 5′GCAAGTGTAGCTCCTCCGAT3′ | 141 |
ATP8 | ATP Synthase Membrane Subunits 6 | F: 5′CCGCAACTAGACACGTCAAC3′ R: 5′TGTTTCTCAAGGGGTGTTTTGT3′ | 156 |
GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | F: 5′CCCAGAATATCATCCCTGCT3′ R: 5′CTGCTTCACCACCTTCTTGA3′ | 369 |
B2M | Beta-2-microglobulin | F: 5′TCCAGCGTCCTCCAAAGATT3′ R: 5′CCTTGCTGTTGGGAGTGAAC3′ | 222 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Anwar, K.; Thaller, G.; Saeed-Zidane, M. Sperm-Borne Mitochondrial Activity Influenced by Season and Age of Holstein Bulls. Int. J. Mol. Sci. 2024, 25, 13064. https://doi.org/10.3390/ijms252313064
Anwar K, Thaller G, Saeed-Zidane M. Sperm-Borne Mitochondrial Activity Influenced by Season and Age of Holstein Bulls. International Journal of Molecular Sciences. 2024; 25(23):13064. https://doi.org/10.3390/ijms252313064
Chicago/Turabian StyleAnwar, Khurshaid, Georg Thaller, and Mohammed Saeed-Zidane. 2024. "Sperm-Borne Mitochondrial Activity Influenced by Season and Age of Holstein Bulls" International Journal of Molecular Sciences 25, no. 23: 13064. https://doi.org/10.3390/ijms252313064
APA StyleAnwar, K., Thaller, G., & Saeed-Zidane, M. (2024). Sperm-Borne Mitochondrial Activity Influenced by Season and Age of Holstein Bulls. International Journal of Molecular Sciences, 25(23), 13064. https://doi.org/10.3390/ijms252313064