Exposure of Primary Human Skin Fibroblasts to Carbon Dioxide-Containing Solution Significantly Reduces TGF-β-Induced Myofibroblast Differentiation In Vitro
Abstract
1. Introduction
2. Results
2.1. Impact of CO2 or N2 Exposure on Viability, Proliferation, and Migration of Primary Human Skin Fibroblasts
2.2. Impact of CO2- and N2-Saturated Solutions on α-SMA Protein Expression of Primary Human Skin Fibroblasts
2.3. Impact of 2-Deoxy-Glucose on TGF-β-Induced α-SMA Protein Expression and Basal ATP Production Rates
2.4. Impact of CO2- or N2-Saturated Solutions, Acidic Solutions, and Lactate on Parameters of Cellular Energy Metabolism
2.5. CO2 Exposure Enhanced Local Blood Flow and Tissue Oxygen Saturation in Human Skin Tissue of the Hand In Vivo
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture
4.3. Generation of CO2- or N2-Saturated Solutions
4.4. Induction of Fibroblast Differentiation and CO2 Treatment Protocols
4.5. Toxicity Assay
4.6. Proliferation Assay
4.7. Fibroblast Migration Assay
4.8. Immunocytochemistry
4.9. Cell Protein Collection, Gel Electrophoresis, Western Blotting, and Real-Time qPCR
4.10. Evaluation of Oxygen Consumption Rate (OCR) and Extracellular Acidification Rate (ECAR)
4.11. Inhibition of Glycolysis by 2-Deoxy-Glucose
4.12. Enzyme Activity Assays
4.13. Impact of CO2 Exposure on Local Blood Flow and Tissue Oxygen Saturation in Human Skin Tissue In Vivo
4.14. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Friedman, S.L. Mechanisms of disease: Mechanisms of hepatic fibrosis and therapeutic implications. Nat. Clin. Pract. Gastroenterol. Hepatol. 2004, 1, 98–105. [Google Scholar] [CrossRef] [PubMed]
- Tomasek, J.J.; Gabbiani, G.; Hinz, B.; Chaponnier, C.; Brown, R.A. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol. 2002, 3, 349–363. [Google Scholar] [CrossRef] [PubMed]
- Quan, T.E.; Cowper, S.E.; Bucala, R. The role of circulating fibrocytes in fibrosis. Curr. Rheumatol. Rep. 2006, 8, 145–150. [Google Scholar] [CrossRef]
- Tomasek, J.J.; Schultz, R.J.; Episalla, C.W.; Newman, S.A. The cytoskeleton and extracellular matrix of the Dupuytren’s disease “myofibroblast”: An immunofluorescence study of a nonmuscle cell type. J. Hand Surg. Am. 1986, 11, 365–371. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, T.; Barker, T.A.; Berk, B.C. Angiotensin II and the endothelium: Diverse signals and effects. Hypertension 2005, 45, 163–169. [Google Scholar] [CrossRef]
- Liu, R.M.; Desai, L.P. Reciprocal regulation of TGF-β and reactive oxygen species: A perverse cycle for fibrosis. Redox Biol. 2015, 6, 565–577. [Google Scholar] [CrossRef]
- Gonzalez-Gonzalez, F.J.; Chandel, N.S.; Jain, M.; Budinger, G.R.S. Reactive oxygen species as signaling molecules in the development of lung fibrosis. Transl. Res. 2017, 190, 61–68. [Google Scholar] [CrossRef]
- Riccardi, C.; Nicoletti, I. Analysis of apoptosis by propidium iodide staining and flow cytometry. Nat. Protoc. 2006, 1, 1458–1461. [Google Scholar] [CrossRef]
- Abrigo, J.; Campos, F.; Simon, F.; Riedel, C.; Cabrera, D.; Vilos, C.; Cabello-Verrugio, C. TGF-β requires the activation of canonical and non-canonical signalling pathways to induce skeletal muscle atrophy. Biol. Chem. 2018, 399, 253–264. [Google Scholar] [CrossRef]
- Brenner, M.; Herzinger, T.; Berking, C.; Plewig, G.; Degitz, K. Phototherapy and photochemotherapy of sclerosing skin diseases. Photodermatol. Photo 2005, 21, 157–165. [Google Scholar] [CrossRef]
- Kroft, E.B.M.; Berkhof, N.J.G.; van de Kerkhof, P.C.M.; Gerritsen, M.M.J.P.; de Jong, E.M.G.J. Ultraviolet A phototherapy for sclerotic skin diseases: A systematic review. J. Am. Acad. Dermatol. 2008, 59, 1017–1030. [Google Scholar] [CrossRef] [PubMed]
- Oplander, C.; Hidding, S.; Werners, F.B.; Born, M.; Pallua, N.; Suschek, C.V. Effects of blue light irradiation on human dermal fibroblasts. J. Photochem. Photobiol. B Biol. 2011, 103, 118–125. [Google Scholar] [CrossRef] [PubMed]
- Wataya-Kaneda, M.; Ohno, Y.; Fujita, Y.; Yokozeki, H.; Niizeki, H.; Ogai, M.; Fukai, K.; Nagai, H.; Yoshida, Y.; Hamada, I.; et al. Sirolimus Gel Treatment vs Placebo for Facial Angiofibromas in Patients With Tuberous Sclerosis Complex A Randomized Clinical Trial. JAMA Dermatol. 2018, 154, 781–788. [Google Scholar] [CrossRef] [PubMed]
- Olson, J.E.; Stravino, V.D. A review of cryotherapy. Phys. Ther. 1972, 52, 840–853. [Google Scholar] [CrossRef]
- Schallhorn, J.M.; Schallhorn, S.C.; Hettinger, K.A.; Venter, J.A.; Pelouskova, M.; Teenan, D.; Hannan, S.J. Outcomes and complications of excimer laser surgery in patients with collagen vascular and other immune-mediated inflammatory diseases. J. Cataract. Refr Surg. 2016, 42, 1742–1752. [Google Scholar] [CrossRef]
- Kim, S.; Choi, T.H.; Liu, W.; Ogawa, R.; Suh, J.S.; Mustoe, T.A. Update on scar management: Guidelines for treating Asian patients. Plast. Reconstr. Surg. 2013, 132, 1580–1589. [Google Scholar] [CrossRef]
- El Ayadi, A.; Jay, J.W.; Prasai, A. Current Approaches Targeting the Wound Healing Phases to Attenuate Fibrosis and Scarring. Int. J. Mol. Sci. 2020, 21, 1105. [Google Scholar] [CrossRef]
- Taheri, A.; Mansoori, P.; Al-Dabagh, A.; Feldman, S.R. Are corticosteroids effective for prevention of scar formation after second-degree skin burn? J. Dermatol. Treat. 2014, 25, 360–362. [Google Scholar] [CrossRef]
- Nguyen, J.K.; Austin, E.; Huang, A.; Mamalis, A.; Jagdeo, J. The IL-4/IL-13 axis in skin fibrosis and scarring: Mechanistic concepts and therapeutic targets. Arch. Dermatol. Res. 2020, 312, 81–92. [Google Scholar] [CrossRef]
- Hosseini, M.; Brown, J.; Khosrotehrani, K.; Bayat, A.; Shafiee, A. Skin biomechanics: A potential therapeutic intervention target to reduce scarring. Burn. Trauma 2022, 10, tkac036. [Google Scholar] [CrossRef]
- Occleston, N.L.; O’Kane, S.; Goldspink, N.; Ferguson, M.W. New therapeutics for the prevention and reduction of scarring. Drug Discov. Today 2008, 13, 973–981. [Google Scholar] [CrossRef] [PubMed]
- Rosique, R.G.; Rosique, M.J.; Farina Junior, J.A. Curbing Inflammation in Skin Wound Healing: A Review. Int. J. Inflam. 2015, 2015, 316235. [Google Scholar] [CrossRef] [PubMed]
- Vohwinkel, C.U.; Lecuona, E.; Sun, H.Y.; Sommer, N.; Vadasz, I.; Chandel, N.S.; Sznajder, J.I. Elevated CO2 Levels Cause Mitochondrial Dysfunction and Impair Cell Proliferation. J. Biol. Chem. 2011, 286, 37067–37076. [Google Scholar] [CrossRef]
- Brandi, C.; Grimaldi, L.; Nisi, G.; Brafa, A.; Campa, A.; Calabro, M.; Campana, M.; D’Aniello, C. The role of carbon dioxide therapy in the treatment of chronic wounds. In Vivo 2010, 24, 223–226. [Google Scholar]
- Finzgar, M.; Melik, Z.; Cankar, K. Effect of transcutaneous application of gaseous carbon dioxide on cutaneous microcirculation. Clin. Hemorheol. Microcirc. 2015, 60, 423–435. [Google Scholar] [CrossRef]
- Akamine, T.; Taguchi, N. Effects of an artificially carbonated bath on athletic warm-up. J. Hum. Ergol. 1998, 27, 22–29. [Google Scholar]
- Irie, H.; Tatsumi, T.; Takamiya, M.; Zen, K.; Takahashi, T.; Azuma, A.; Tateishi, K.; Nomura, T.; Hayashi, H.; Nakajima, N.; et al. Carbon dioxide-rich water bathing enhances collateral blood flow in ischemic hindlimb via mobilization of endothelial progenitor cells and activation of NO-cGMP system. Circulation 2005, 111, 1523–1529. [Google Scholar] [CrossRef]
- Yamamoto, N.; Hashimoto, M. Immersion in CO2-rich water containing NaCl diminishes blood pressure fluctuation in anesthetized rats. Int. J. Biometeorol. 2007, 52, 109–116. [Google Scholar] [CrossRef]
- Onishi, Y.; Kawamoto, T.; Ueha, T.; Kishimoto, K.; Hara, H.; Fukase, N.; Toda, M.; Harada, R.; Minoda, M.; Sakai, Y.; et al. Transcutaneous application of carbon dioxide (CO2) induces mitochondrial apoptosis in human malignant fibrous histiocytoma in vivo. PLoS ONE 2012, 7, e49189. [Google Scholar] [CrossRef]
- Akahane, S.; Sakai, Y.; Ueha, T.; Nishimoto, H.; Inoue, M.; Niikura, T.; Kuroda, R. Transcutaneous carbon dioxide application accelerates muscle injury repair in rat models. Int. Orthop. 2017, 41, 1007–1015. [Google Scholar] [CrossRef]
- Pieraggi, M.T.; Bouissou, H.; Angelier, C.; Uhart, D.; Magnol, J.P.; Kokolo, J. The fibroblast. Ann. Pathol. 1985, 5, 65–76. [Google Scholar] [PubMed]
- Baum, C.L.; Arpey, C.J. Normal cutaneous wound healing: Clinical correlation with cellular and molecular events. Dermatol. Surg. 2005, 31, 674–686. [Google Scholar] [CrossRef] [PubMed]
- Gabbiani, G. The myofibroblast in wound healing and fibrocontractive diseases. J. Pathol. 2003, 200, 500–503. [Google Scholar] [CrossRef] [PubMed]
- Darby, I.A.; Hewitson, T.D. Fibroblast differentiation in wound healing and fibrosis. Int. Rev. Cytol. 2007, 257, 143–179. [Google Scholar]
- Desmouliere, A.; Chaponnier, C.; Gabbiani, G. Tissue repair, contraction, and the myofibroblast. Wound Repair. Regen. 2005, 13, 7–12. [Google Scholar] [CrossRef]
- Desmouliere, A. Factors influencing myofibroblast differentiation during wound healing and fibrosis. Cell Biol. Int. 1995, 19, 471–476. [Google Scholar] [CrossRef]
- Shin, D.; Minn, K.W. The effect of myofibroblast on contracture of hypertrophic scar. Plast. Reconstr. Surg. 2004, 113, 633–640. [Google Scholar] [CrossRef]
- Hinz, B. Formation and function of the myofibroblast during tissue repair. J. Investig. Dermatol. 2007, 127, 526–537. [Google Scholar] [CrossRef]
- Ogawa, R. The Most Current Algorithms for the Treatment and Prevention of Hypertrophic Scars and Keloids: A 2020 Update of the Algorithms Published 10 Years Ago. Plast. Reconstr. Surg. 2022, 149, 79e–94e. [Google Scholar] [CrossRef]
- West, J.B. Respiratory Physiology: The Essentials; Lippincott Williams & Wilkins: Philadelphia, PA, USA, 2012. [Google Scholar]
- Ganong, W.F. Review of Medical Physiology; McGraw-Hill Medical: New York, NY, USA, 2010. [Google Scholar]
- Tadokoro, Y.; Takeda, D.; Murakami, A.; Yatagai, N.; Saito, I.; Arimoto, S.; Kakei, Y.; Akashi, M.; Hasegawa, T. Transcutaneous carbon dioxide application suppresses the expression of cancer-associated fibroblasts markers in oral squamous cell carcinoma xenograft mouse model. PLoS ONE 2023, 18, e0290357. [Google Scholar] [CrossRef]
- Kolodziejczak, A.; Podgorna, K.; Rotsztejn, H. Is carboxytherapy a good alternative method in the removal of various skin defects? Dermatol. Ther. 2018, 31, e12699. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Z.K.; Zhang, M.Z.; Zhang, W.C.; Li, Z.J.; Si, L.B.; Long, X.; Yu, N.Z.; Wang, X.J. Role of HIF-1α in pathogenic mechanisms of keloids. J. Cosmet. Dermatol. 2023, 22, 1436–1448. [Google Scholar] [CrossRef] [PubMed]
- Kabei, K.; Tateishi, Y.; Nozaki, M.; Tanaka, M.; Shiota, M.; Osada-Oka, M.; Nishide, S.; Uchida, J.; Nakatani, T.; Tomita, S.; et al. Role of hypoxia-inducible factor-1 in the development of renal fibrosis in mouse obstructed kidney: Special references to HIF-1 dependent gene expression of profibrogenic molecules. J. Pharmacol. Sci. 2018, 136, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Livingston, M.J.; Dong, G.; Wei, Q.; Zhang, M.; Mei, S.; Zhu, J.; Zhang, C.; Dong, Z. HIF-1 contributes to autophagy activation via BNIP3 to facilitate renal fibrosis in hypoxia in vitro and UUO in vivo. Am. J. Physiol. Cell Physiol. 2024, 326, C935–C947. [Google Scholar] [CrossRef]
- Mesarwi, O.A.; Moya, E.A.; Zhen, X.; Gautane, M.; Zhao, H.; Wegbrans Giro, P.; Alshebli, M.; McCarley, K.E.; Breen, E.C.; Malhotra, A. Hepatocyte HIF-1 and Intermittent Hypoxia Independently Impact Liver Fibrosis in Murine Nonalcoholic Fatty Liver Disease. Am. J. Respir. Cell Mol. Biol. 2021, 65, 390–402. [Google Scholar] [CrossRef]
- Moczydlowska, J.; Miltyk, W.; Hermanowicz, A.; Lebensztejn, D.M.; Palka, J.A.; Debek, W. HIF-1α as a Key Factor in Bile Duct Ligation-Induced Liver Fibrosis in Rats. J. Investig. Surg. 2017, 30, 41–46. [Google Scholar] [CrossRef]
- Wu, H.; Chen, W.; Zhao, F.; Zhou, Q.; Reinach, P.S.; Deng, L.; Ma, L.; Luo, S.; Srinivasalu, N.; Pan, M.; et al. Scleral hypoxia is a target for myopia control. Proc. Natl. Acad. Sci.USA 2018, 115, E7091–E7100. [Google Scholar] [CrossRef]
- Xu, X.; Li, Y.; Niu, Z.; Xia, J.; Dai, K.; Wang, C.; Yao, W.; Guo, Y.; Deng, X.; He, J.; et al. Inhibition of HIF-1α Attenuates Silica-Induced Pulmonary Fibrosis. J. Environ. Res. Public Health 2022, 19, 6775. [Google Scholar] [CrossRef]
- Hong, W.X.; Hu, M.S.; Esquivel, M.; Liang, G.Y.; Rennert, R.C.; McArdle, A.; Paik, K.J.; Duscher, D.; Gurtner, G.C.; Lorenz, H.P.; et al. The Role of Hypoxia-Inducible Factor in Wound Healing. Adv. Wound Care 2014, 3, 390–399. [Google Scholar] [CrossRef]
- Lei, R.; Li, J.; Liu, F.; Li, W.; Zhang, S.; Wang, Y.; Chu, X.; Xu, J. HIF-1α promotes the keloid development through the activation of TGF-β/Smad and TLR4/MyD88/NF-κB pathways. Cell Cycle 2019, 18, 3239–3250. [Google Scholar] [CrossRef]
- Kang, Y.; Roh, M.R.; Rajadurai, S.; Rajadurai, A.; Kumar, R.; Njauw, C.N.; Zheng, Z.; Tsao, H. Hypoxia and HIF-1α Regulate Collagen Production in Keloids. J. Investig. Dermatol. 2020, 140, 2157–2165. [Google Scholar] [CrossRef] [PubMed]
- Long, F.; Si, L.; Long, X.; Yang, B.; Wang, X.; Zhang, F. 2ME2 increase radiation-induced apoptosis of keloid fibroblasts by targeting HIF-1α in vitro. Australas. J. Dermatol. 2016, 57, e32–e38. [Google Scholar] [CrossRef] [PubMed]
- Jusman, S.W.A.; Sari, D.H.; Ningsih, S.S.; Hardiany, N.S.; Sadikin, M. Role of Hypoxia Inducible Factor-1 Alpha (HIF-1α) in Cytoglobin Expression and Fibroblast Proliferation of Keloids. Kobe J. Med. Sci. 2019, 65, E10–E18. [Google Scholar] [PubMed]
- Henderson, J.; Duffy, L.; Stratton, R.; Ford, D.; O’Reilly, S. Metabolic reprogramming of glycolysis and glutamine metabolism are key events in myofibroblast transition in systemic sclerosis pathogenesis. J. Cell Mol. Med. 2020, 24, 14026–14038. [Google Scholar] [CrossRef]
- Hewitson, T.D.; Smith, E.R. A Metabolic Reprogramming of Glycolysis and Glutamine Metabolism Is a Requisite for Renal Fibrogenesis-Why and How? Front. Physiol. 2021, 12, 645857. [Google Scholar] [CrossRef]
- Gibb, A.A.; Lazaropoulos, M.P.; Elrod, J.W. Myofibroblasts and Fibrosis: Mitochondrial and Metabolic Control of Cellular Differentiation. Circ. Res. 2020, 127, 427–447. [Google Scholar] [CrossRef]
- Bernard, K.; Logsdon, N.J.; Ravi, S.; Xie, N.; Persons, B.P.; Rangarajan, S.; Zmijewski, J.W.; Mitra, K.; Liu, G.; Darley-Usmar, V.M.; et al. Metabolic Reprogramming Is Required for Myofibroblast Contractility and Differentiation. J. Biol. Chem. 2015, 290, 25427–25438. [Google Scholar] [CrossRef]
- Vander Heiden, M.G.; Cantley, L.C.; Thompson, C.B. Understanding the Warburg effect: The metabolic requirements of cell proliferation. Science 2009, 324, 1029–1033. [Google Scholar] [CrossRef]
- Bardon, A.; Ceder, O.; Kollberg, H. Increased activity of four glycolytic enzymes in cultured fibroblasts from cystic fibrosis patients. Res. Commun. Chem. Pathol. Pharmacol. 1986, 51, 405–408. [Google Scholar]
- Ding, H.; Jiang, L.; Xu, J.; Bai, F.; Zhou, Y.; Yuan, Q.; Luo, J.; Zen, K.; Yang, J. Inhibiting aerobic glycolysis suppresses renal interstitial fibroblast activation and renal fibrosis. Am. J. Physiol. Renal Physiol. 2017, 313, F561–F575. [Google Scholar] [CrossRef]
- Chen, Y.; Choi, S.S.; Michelotti, G.A.; Chan, I.S.; Swiderska-Syn, M.; Karaca, G.F.; Xie, G.; Moylan, C.A.; Garibaldi, F.; Premont, R.; et al. Hedgehog controls hepatic stellate cell fate by regulating metabolism. Gastroenterology 2012, 143, 1319–1329.e11. [Google Scholar] [CrossRef] [PubMed]
- Kottmann, R.M.; Kulkarni, A.A.; Smolnycki, K.A.; Lyda, E.; Dahanayake, T.; Salibi, R.; Honnons, S.; Jones, C.; Isern, N.G.; Hu, J.Z.; et al. Lactic acid is elevated in idiopathic pulmonary fibrosis and induces myofibroblast differentiation via pH-dependent activation of transforming growth factor-β. Am. J. Respir. Crit. Care Med. 2012, 186, 740–751. [Google Scholar] [CrossRef] [PubMed]
- Xie, N.; Tan, Z.; Banerjee, S.; Cui, H.; Ge, J.; Liu, R.M.; Bernard, K.; Thannickal, V.J.; Liu, G. Glycolytic Reprogramming in Myofibroblast Differentiation and Lung Fibrosis. Am. J. Respir. Crit. Care Med. 2015, 192, 1462–1474. [Google Scholar] [CrossRef] [PubMed]
- Goodwin, J.; Choi, H.; Hsieh, M.H.; Neugent, M.L.; Ahn, J.M.; Hayenga, H.N.; Singh, P.K.; Shackelford, D.B.; Lee, I.K.; Shulaev, V.; et al. Targeting Hypoxia-Inducible Factor-1α/Pyruvate Dehydrogenase Kinase 1 Axis by Dichloroacetate Suppresses Bleomycin-induced Pulmonary Fibrosis. Am. J. Respir. Cell Mol. Biol. 2018, 58, 216–231. [Google Scholar] [CrossRef] [PubMed]
- Ralser, M.; Wamelink, M.M.; Struys, E.A.; Joppich, C.; Krobitsch, S.; Jakobs, C.; Lehrach, H. A catabolic block does not sufficiently explain how 2-deoxy-D-glucose inhibits cell growth. Proc. Natl. Acad. Sci. USA 2008, 105, 17807–17811. [Google Scholar] [CrossRef]
- Kurtoglu, M.; Maher, J.C.; Lampidis, T.J. Differential toxic mechanisms of 2-deoxy-D-glucose versus 2-fluorodeoxy-D-glucose in hypoxic and normoxic tumor cells. Antioxid. Redox Signal 2007, 9, 1383–1390. [Google Scholar] [CrossRef]
- Urakami, K.; Zangiacomi, V.; Yamaguchi, K.; Kusuhara, M. Impact of 2-deoxy-D-glucose on the target metabolome profile of a human endometrial cancer cell line. Biomed. Res. 2013, 34, 221–229. [Google Scholar] [CrossRef]
- Robinson, G.L.; Dinsdale, D.; Macfarlane, M.; Cain, K. Switching from aerobic glycolysis to oxidative phosphorylation modulates the sensitivity of mantle cell lymphoma cells to TRAIL. Oncogene 2012, 31, 4996–5006. [Google Scholar] [CrossRef]
- Giammarioli, A.M.; Gambardella, L.; Barbati, C.; Pietraforte, D.; Tinari, A.; Alberton, M.; Gnessi, L.; Griffin, R.J.; Minetti, M.; Malorni, W. Differential effects of the glycolysis inhibitor 2-deoxy-D-glucose on the activity of pro-apoptotic agents in metastatic melanoma cells, and induction of a cytoprotective autophagic response. Int. J. Cancer 2012, 131, E337–E347. [Google Scholar] [CrossRef]
- Golding, J.P.; Wardhaugh, T.; Patrick, L.; Turner, M.; Phillips, J.B.; Bruce, J.I.; Kimani, S.G. Targeting tumour energy metabolism potentiates the cytotoxicity of 5-aminolevulinic acid photodynamic therapy. Br. J. Cancer 2013, 109, 976–982. [Google Scholar] [CrossRef]
- Hegmann, L.; Sturm, S.; Niegisch, G.; Windolf, J.; Suschek, C.V. Enhancement of human bladder carcinoma cell chemosensitivity to Mitomycin C through quasi-monochromatic blue light (λ = 453 ± 10 nm). J. Photochem. Photobiol. B Biol. 2022, 236, 112582. [Google Scholar] [CrossRef] [PubMed]
- Sturm, S.; Niegisch, G.; Windolf, J.; Suschek, C.V. Exposure of Bladder Cancer Cells to Blue Light (λ = 453 nm) in the Presence of Riboflavin Synergistically Enhances the Cytotoxic Efficiency of Gemcitabine. Int. J. Mol. Sci. 2024, 25, 4868. [Google Scholar] [CrossRef] [PubMed]
- Pallua, N.; Pulsfort, A.K.; Suschek, C.; Wolter, T.P. Content of the growth factors bFGF, IGF-1, VEGF, and PDGF-BB in freshly harvested lipoaspirate after centrifugation and incubation. Plast. Reconstr. Surg. 2009, 123, 826–833. [Google Scholar] [CrossRef] [PubMed]
- Oplander, C.; Muller, T.; Baschin, M.; Bozkurt, A.; Grieb, G.; Windolf, J.; Pallua, N.; Suschek, C.V. Characterization of novel nitrite-based nitric oxide generating delivery systems for topical dermal application. Nitric Oxide Biol. Chem. 2013, 28, 24–32. [Google Scholar] [CrossRef]
- Frerichs, L.M.; Frerichs, B.; Petzsch, P.; Kohrer, K.; Windolf, J.; Bittersohl, B.; Hoffmann, M.J.; Grotheer, V. Tumorigenic effects of human mesenchymal stromal cells and fibroblasts on bladder cancer cells. Front. Oncol. 2023, 13, 1228185. [Google Scholar] [CrossRef]
- Mookerjee, S.A.; Brand, M.D. Measurement and Analysis of Extracellular Acid Production to Determine Glycolytic Rate. J. Vis. Exp. 2015, 106, e53464. [Google Scholar] [CrossRef]
- Chavan, H.; Christudoss, P.; Mickey, K.; Tessman, R.; Ni, H.M.; Swerdlow, R.; Krishnamurthy, P. Arsenite Effects on Mitochondrial Bioenergetics in Human and Mouse Primary Hepatocytes Follow a Nonlinear Dose Response. Oxid. Med. Cell Longev. 2017, 2017, 9251303. [Google Scholar] [CrossRef]
- Aamand, R.; Dalsgaard, T.; Jensen, F.B.; Simonsen, U.; Roepstorff, A.; Fago, A. Generation of nitric oxide from nitrite by carbonic anhydrase: A possible link between metabolic activity and vasodilation. Am. J. Physiol. Heart Circ. Physiol. 2009, 297, H2068–H2074. [Google Scholar] [CrossRef]
- Phillis, J.W.; Lungu, C.L.; Barbu, D.E.; O’Regan, M.H. Adenosine’s role in hypercapnia-evoked cerebral vasodilation in the rat. Neurosci. Lett. 2004, 365, 6–9. [Google Scholar] [CrossRef]
- Kontos, H.A.; Wei, E.P.; Raper, A.J.; Patterson, J.L., Jr. Local mechanism of CO2 action of cat pial arterioles. Stroke 1977, 8, 226–229. [Google Scholar] [CrossRef]
- Faraci, F.M.; Taugher, R.J.; Lynch, C.; Fan, R.; Gupta, S.; Wemmie, J.A. Acid-Sensing Ion Channels: Novel Mediators of Cerebral Vascular Responses. Circ. Res. 2019, 125, 907–920. [Google Scholar] [CrossRef]
- Opländer, C.; Volkmar, C.M.; Paunel-Görgülü, A.; van Faassen, E.E.; Heiss, C.; Kelm, M.; Halmer, D.; Mürtz, M.; Pallua, N.; Suschek, C.V. Whole Body UVA Irradiation Lowers Systemic Blood Pressure by Release of Nitric Oxide From Intracutaneous Photolabile Nitric Oxide Derivates. Circ. Res. 2009, 105, 1031–1040. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Forward Primer (5′ → 3′) | Reverse Primer (5′ → 3′) | Product Length |
---|---|---|---|
EDA-FN | ACTGATTGCACTTCTGAGGGCAG | GATTTCCTCGTGGGCAGCCA | 112 |
TFRC | TTCAGGTCAAAGACAGCGCTCA | CTATACGCCACATAACCCCCAGG | 100 |
α-SMA | AGCCAAGCACTGTCAGGAAT | TTGTCACACACCAAGGCAGT | 108 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fleckner, M.; Döhmen, N.K.; Salz, K.; Christophers, T.; Windolf, J.; Suschek, C.V.; Oezel, L. Exposure of Primary Human Skin Fibroblasts to Carbon Dioxide-Containing Solution Significantly Reduces TGF-β-Induced Myofibroblast Differentiation In Vitro. Int. J. Mol. Sci. 2024, 25, 13013. https://doi.org/10.3390/ijms252313013
Fleckner M, Döhmen NK, Salz K, Christophers T, Windolf J, Suschek CV, Oezel L. Exposure of Primary Human Skin Fibroblasts to Carbon Dioxide-Containing Solution Significantly Reduces TGF-β-Induced Myofibroblast Differentiation In Vitro. International Journal of Molecular Sciences. 2024; 25(23):13013. https://doi.org/10.3390/ijms252313013
Chicago/Turabian StyleFleckner, Maxine, Niklas K. Döhmen, Katharina Salz, Till Christophers, Joachim Windolf, Christoph V. Suschek, and Lisa Oezel. 2024. "Exposure of Primary Human Skin Fibroblasts to Carbon Dioxide-Containing Solution Significantly Reduces TGF-β-Induced Myofibroblast Differentiation In Vitro" International Journal of Molecular Sciences 25, no. 23: 13013. https://doi.org/10.3390/ijms252313013
APA StyleFleckner, M., Döhmen, N. K., Salz, K., Christophers, T., Windolf, J., Suschek, C. V., & Oezel, L. (2024). Exposure of Primary Human Skin Fibroblasts to Carbon Dioxide-Containing Solution Significantly Reduces TGF-β-Induced Myofibroblast Differentiation In Vitro. International Journal of Molecular Sciences, 25(23), 13013. https://doi.org/10.3390/ijms252313013