Pancreastatin Inhibition Alters the Colonic Epithelial Cells Profile in a Sex-Dependent Manner
Abstract
1. Introduction
2. Results
2.1. PST Inhibition Is Associated with Delayed Colitis Onset in Male Mice but Moderately Worsens Disease Severity in Female Mice
2.2. PST Inhibition Correlated with Reduced Levels of Several Colonic Mucosal Cytokines in Female Mice at a Steady State
2.3. PST Inhibition Is Associated with Changes in the Expression of Several Colonic Mucosal Repair Markers Between Sexes That Differ at Steady State and Colitic Conditions
2.4. PST Inhibition Is Associated with No Significant Changes in the Colonic Mucosal Antimicrobial Activities in Male and Female Mice at Steady State and Colitic Conditions
2.5. PST Inhibition Is Associated with Changes in the Expression of Colonic Mucosal Repair Markers Between Sexes at Steady State and During Colitis
2.6. PST Inhibition Is Associated with Levels of Colonic Differentiated Epithelial Cells That Differ in a Sex-Dependent Manner at Steady State and Colitic Conditions
2.7. PST Inhibition Is Associated with Changes in Several Stem Cell Populations in a Sex-Dependent Manner at Steady State and During Colitis
2.8. PST Inhibition Correlates with Altered Expression of Colonic Mucosal Self-Renewal and Differentiation Markers Between Sexes at Steady-State and Colitic Conditions
2.9. PSTi8 Treatment Correlates with Changes in the Expression of Several UPR Signaling Markers in Female Mice at Steady State and Colitic Conditions
3. Discussion
4. Materials and Methods
4.1. Peptides
4.2. Mice
4.3. Mice Treatment with Pancreastatin Inhibitor 8 (PSTi8)
4.4. Induction and Assessment of Experimental Colitis
4.5. Serum Preparation
4.6. Procedure for RNA Extraction, Purification, and Quantification
4.7. Epithelial Cells Associated Markers Gene Expression
4.8. Proteins Extraction
4.9. Cytokines Analysis
4.10. Immunofluorescence
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rees, W.D.; Tandun, R.; Yau, E.; Zachos, N.C.; Steiner, T.S. Regenerative Intestinal Stem Cells Induced by Acute and Chronic Injury: The Saving Grace of the Epithelium? Front. Cell Dev. Biol. 2020, 8, 583919. [Google Scholar] [CrossRef] [PubMed]
- Gerbe, F.; Van Es, J.H.; Makrini, L.; Brulin, B.; Mellitzer, G.; Robine, S.; Romagnolo, B.; Shroyer, N.F.; Bourgaux, J.F.; Pignodel, C.; et al. Distinct ATOH1 and Neurog3 Requirements Define Tuft Cells as a New Secretory Cell Type in the Intestinal Epithelium. J. Cell Biol. 2011, 192, 767–780. [Google Scholar] [CrossRef] [PubMed]
- Karmakar, S.; Deng, L.; He, X.C.; Li, L. Intestinal Epithelial Regeneration: Active versus Reserve Stem Cells and Plasticity Mechanisms. Am. J. Physiol.-Gastrointest. Liver Physiol. 2020, 318, G796–G802. [Google Scholar] [CrossRef] [PubMed]
- Martini, E.; Krug, S.M.; Siegmund, B.; Neurath, M.F.; Becker, C. Mend Your Fences: The Epithelial Barrier and Its Relationship with Mucosal Immunity in Inflammatory Bowel Disease. Cell. Mol. Gastroenterol. Hepatol. 2017, 4, 33–46. [Google Scholar] [CrossRef] [PubMed]
- Noah, T.K.; Donahue, B.; Shroyer, N.F. Intestinal Development and Differentiation. Exp. Cell Res. 2011, 317, 2702–2710. [Google Scholar] [CrossRef]
- Schneider, C.; O’Leary, C.E.; Locksley, R.M. Regulation of Immune Responses by Tuft Cells. Nat. Rev. Immunol. 2019, 19, 584–593. [Google Scholar] [CrossRef]
- Braniste, V.; Leveque, M.; Buisson-Brenac, C.; Bueno, L.; Fioramonti, J.; Houdeau, E. Oestradiol Decreases Colonic Permeability through Oestrogen Receptor β-Mediated up-Regulation of Occludin and Junctional Adhesion Molecule-A in Epithelial Cells. J. Physiol. 2009, 587, 3317–3328. [Google Scholar] [CrossRef]
- van der Giessen, J.; van der Woude, C.; Peppelenbosch, M.; Fuhler, G. A Direct Effect of Sex Hormones on Epithelial Barrier Function in Inflammatory Bowel Disease Models. Cells 2019, 8, 261. [Google Scholar] [CrossRef]
- Zhou, W.; Davis, E.A.; Li, K.; Nowak, R.A.; Dailey, M.J. Sex Differences Influence Intestinal Epithelial Stem Cell Proliferation Independent of Obesity. Physiol. Rep. 2018, 6, e13746. [Google Scholar] [CrossRef]
- Lee, G.S.; Cody, A.S.; Johnson, K.C.; Zhao, H.; Odelberg, S.J.; Li, D.Y.; Zhu, W. Estrogen Enhances Female Small Intestine Epithelial Organoid Regeneration. J. Bio-X Res. 2019, 2, 9–15. [Google Scholar] [CrossRef]
- Shah, S.C.; Khalili, H.; Chen, C.Y.; Ahn, H.S.; Ng, S.C.; Burisch, J.; Colombel, J.F. Sex-Based Differences in the Incidence of Inflammatory Bowel Diseases—Pooled Analysis of Population-Based Studies from the Asia-Pacific Region. Aliment. Pharmacol. Ther. 2019, 49, 904–911. [Google Scholar] [CrossRef] [PubMed]
- Shah, S.C.; Khalili, H.; Gower-Rousseau, C.; Olen, O.; Benchimol, E.I.; Lynge, E.; Nielsen, K.R.; Brassard, P.; Vutcovici, M.; Bitton, A.; et al. Sex-Based Differences in Incidence of Inflammatory Bowel Diseases—Pooled Analysis of Population-Based Studies from Western Countries. Gastroenterology 2018, 155, 1079–1089.e3. [Google Scholar] [CrossRef] [PubMed]
- Macken, L.; Blaker, P.A. Management of Acute Severe Ulcerative Colitis. Clin. Med. 2015, 15, 473–476. [Google Scholar] [CrossRef] [PubMed]
- Okamoto, R.; Watanabe, M. Role of Epithelial Cells in the Pathogenesis and Treatment of Inflammatory Bowel Disease. J. Gastroenterol. 2016, 51, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Mizoguchi, E.; Xavier, R.J.; Reinecker, H.C.; Uchino, H.; Bhan, A.K.; Podolsky, D.K.; Mizoguchi, A. Colonic Epithelial Functional Phenotype Varies with Type and Phase of Experimental Colitis. Gastroenterology 2003, 125, 148–161. [Google Scholar] [CrossRef]
- Prasad, S.; Mingrino, R.; Kaukinen, K.; Hayes, K.L.; Powell, R.M.; MacDonald, T.T.; Collins, J.E. Inflammatory Processes Have Differential Effects on Claudins 2, 3 and 4 in Colonic Epithelial Cells. Lab. Investig. 2005, 85, 1139–1162. [Google Scholar] [CrossRef]
- Shashikanth, N.; France, M.M.; Xiao, R.; Haest, X.; Rizzo, H.E.; Yeste, J.; Reiner, J.; Turner, J.R. Tight Junction Channel Regulation by Interclaudin Interference. Nat. Commun. 2022, 13, 3780. [Google Scholar] [CrossRef]
- Kaser, A.; Adolph, T.E.; Blumberg, R.S. The Unfolded Protein Response and Gastrointestinal Disease. Semin. Immunopathol. 2013, 35, 307–319. [Google Scholar] [CrossRef]
- Lyu, D.; Kou, G.; Li, S.; Li, L.; Li, B.; Zhou, R.; Yang, X.; Tian, W.; Li, Y.; Zuo, X. Digital Spatial Profiling Reveals Functional Shift of Enterochromaffin Cell in Patients with Ulcerative Colitis. Front. Cell Dev. Biol. 2022, 10, 841090. [Google Scholar] [CrossRef]
- Parikh, K.; Antanaviciute, A.; Fawkner-Corbett, D.; Jagielowicz, M.; Aulicino, A.; Lagerholm, C.; Davis, S.; Kinchen, J.; Chen, H.H.; Alham, N.K.; et al. Colonic Epithelial Cell Diversity in Health and Inflammatory Bowel Disease. Nature 2019, 567, 49–55. [Google Scholar] [CrossRef]
- Sciola, V.; Massironi, S.; Conte, D.; Caprioli, F.; Ferrero, S.; Ciafardini, C.; Peracchi, M.; Bardella, M.T.; Piodi, L. Plasma Chromogranin A in Patients with Inflammatory Bowel Disease. Inflamm. Bowel Dis. 2009, 15, 867–871. [Google Scholar] [CrossRef] [PubMed]
- Taupenot, L.; Harper, K.L. The Chromogranin–Secretogranin Family. N. Engl. J. Med. 2003, 348, 1134–1149. [Google Scholar] [CrossRef] [PubMed]
- Williams, J.A. Pancreastatin. In Pancreapedia: Exocrine Pancreas Knowledge Base; American Psychological Association: Washington, DC, USA, 2019; pp. 4–9. [Google Scholar]
- Allu, P.K.R. Pancreastatin in Metabolic Diseases. J. Hear. Cardiol. 2019, 4, 34–38. [Google Scholar]
- Hossain, Z.; Valicherla, G.R.; Gupta, A.P.; Syed, A.A.; Riyazuddin, M.; Chandra, S.; Siddiqi, M.I.; Gayen, J.R. Discovery of Pancreastatin Inhibitor PSTi8 for the Treatment of Insulin Resistance and Diabetes: Studies in Rodent Models of Diabetes Mellitus. Sci. Rep. 2018, 8, 8715. [Google Scholar] [CrossRef] [PubMed]
- Gayen, J.R.; Saberi, M.; Schenk, S.; Biswas, N.; Vaingankar, S.M.; Cheung, W.W.; Najjar, S.M.; O’Connor, D.T.; Bandyopadhyay, G.; Mahata, S.K. A Novel Pathway of Insulin Sensitivity in Chromogranin A Null Mice. A Crucial Role for Pancreastatin in Glucose Homeostasis. J. Biol. Chem. 2009, 284, 28498–28509. [Google Scholar] [CrossRef]
- Eissa, N.; Elgazzar, O.; Hussein, H.; Hendy, G.N.; Bernstein, C.N.; Ghia, J.E. Pancreastatin Reduces Alternatively Activated Macrophages, Disrupts the Epithelial Homeostasis and Aggravates Colonic Inflammation. A Descriptive Analysis. Biomedicines 2021, 9, 134. [Google Scholar] [CrossRef]
- Ioannidis, M.; Mahata, S.K.; van den Bogaart, G. The Immunomodulatory Functions of Chromogranin A-Derived Peptide Pancreastatin. Peptides 2022, 158, 170893. [Google Scholar] [CrossRef]
- Muntjewerff, E.M.; Tang, K.; Lutter, L.; Christoffersson, G.; Nicolasen, M.J.T.; Gao, H.; Katkar, G.D.; Das, S.; Beest, M.; Ying, W. Chromogranin A Regulates Gut Permeability via the Antagonistic Actions of Its Proteolytic Peptides. Acta Physiol. 2021, 232, e13655. [Google Scholar] [CrossRef]
- Bandyopadhyay, G.K.; Lu, M.; Avolio, E.; Siddiqui, J.A.; Gayen, J.R.; Wollam, J.; Vu, C.U.; Chi, N.W.; O’Connor, D.T.; Mahata, S.K. Pancreastatin-Dependent Inflammatory Signaling Mediates Obesity-Induced Insulin Resistance. Diabetes 2015, 64, 104–116. [Google Scholar] [CrossRef]
- Razali, N.N.; Ali, R.A.R.; Nawawi, K.N.M.; Yahaya, A.; Rathi, N.D.M.; Mokhtar, N.M. Roles of Phosphatidylinositol-3-Kinases Signaling Pathway in Inflammation-Related Cancer: Impact of Rs10889677 Variant and Buparlisib in Colitis-Associated Cancer. World J. Gastroenterol. 2023, 29, 5543–5556. [Google Scholar] [CrossRef]
- Lichtenstein, G.R.; Rutgeerts, P. The Importance of Mucosal Healing in Ulcerative Colitis. Inflamm. Bowel Dis. 2010, 16, 338–346. [Google Scholar] [CrossRef] [PubMed]
- Peyrin-Biroulet, L. Advances in IBD. Gastroenterol. Hepatol. 2020, 16, 206–208. [Google Scholar]
- He, W.; Wang, M.L.; Jiang, H.Q.; Steppan, C.M.; Shin, M.E.; Thurnheer, M.C.; Cebra, J.J.; Lazar, M.A.; Wu, G.D. Bacterial Colonization Leads to the Colonic Secretion of RELMB/FIZZ2, A Novel Goblet Cell–Specific Protein. Gastroenterology 2003, 5085, 1388–1397. [Google Scholar] [CrossRef] [PubMed]
- Gunawardene, A.R.; Corfe, B.M.; Staton, C.A. Classification and Functions of Enteroendocrine Cells of the Lower Gastrointestinal Tract. Int. J. Exp. Pathol. 2011, 92, 219–231. [Google Scholar] [CrossRef] [PubMed]
- Worthington, J.J.; Reimann, F.; Gribble, F.M. Enteroendocrine Cells-Sensory Sentinels of the Intestinal Environment and Orchestrators of Mucosal Immunity. Mucosal Immunol. 2018, 11, 3–20. [Google Scholar] [CrossRef] [PubMed]
- Tshikudi, D.M.; Hitchinson, H.; Hesampour, F.; Ghia, J. A269 Sex-Dependent Effect of Pancreastatin Inhibition on Colon Mucosal Integrity in Homeostatic Condition. J. Can. Assoc. Gastroenterol. 2024, 7, 216–217. [Google Scholar] [CrossRef]
- Neurath, M.F. New Targets for Mucosal Healing and Therapy in Inflammatory Bowel Diseases. Mucosal Immunol. 2014, 7, 6–19. [Google Scholar] [CrossRef]
- Seno, H.; Miyoshi, H.; Brown, S.L.; Geske, M.J.; Colonna, M.; Stappenbeck, T.S. Efficient Colonic Mucosal Wound Repair Requires Trem2 Signaling. Proc. Natl. Acad. Sci. USA 2009, 106, 256–261. [Google Scholar] [CrossRef]
- Hogan, S.P.; Seidu, L.; Blanchard, C.; Groschwitz, K.; Mishra, A.; Karow, M.L.; Ahrens, R.; Artis, D.; Murphy, A.J.; Valenzuela, D.M.; et al. Resistin-like Molecule β Regulates Innate Colonic Function: Barrier Integrity and Inflammation Susceptibility. J. Allergy Clin. Immunol. 2006, 118, 257–268. [Google Scholar] [CrossRef]
- Morampudi, V.; Dalwadi, U.; Bhinder, G.; Sham, H.P.; Gill, S.K.; Chan, J.; Bergstrom, K.S.B.; Huang, T.; Ma, C.; Jacobson, K.; et al. The Goblet Cell-Derived Mediator RELM-β Drives Spontaneous Colitis in Muc2-Deficient Mice by Promoting Commensal Microbial Dysbiosis. Mucosal Immunol. 2016, 9, 1218–1233. [Google Scholar] [CrossRef]
- Hu, J.C.E.; Weiß, F.; Bojarski, C.; Branchi, F.; Schulzke, J.D.; Fromm, M.; Krug, S.M. Expression of Tricellular Tight Junction Proteins and the Paracellular Macromolecule Barrier Are Recovered in Remission of Ulcerative Colitis. BMC Gastroenterol. 2021, 21, 141. [Google Scholar] [CrossRef] [PubMed]
- Chiang, H.Y.; Lu, H.H.; Sudhakar, J.N.; Chen, Y.W.; Shih, N.S.; Weng, Y.T.; Shui, J.W. IL-22 Initiates an IL-18-Dependent Epithelial Response Circuit to Enforce Intestinal Host Defence. Nat. Commun. 2022, 13, 874. [Google Scholar] [CrossRef] [PubMed]
- Shahini, A.; Shahini, A. Role of Interleukin-6-Mediated Inflammation in the Pathogenesis of Inflammatory Bowel Disease: Focus on the Available Therapeutic Approaches and Gut Microbiome. J. Cell Commun. Signal. 2023, 17, 55–74. [Google Scholar] [CrossRef] [PubMed]
- Okumura, R.; Kodama, T.; Hsu, C.C.; Sahlgren, B.H.; Hamano, S.; Kurakawa, T.; Iida, T.; Takeda, K. Lypd8 Inhibits Attachment of Pathogenic Bacteria to Colonic Epithelia. Mucosal Immunol. 2020, 13, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.; Yoshimura, T.; Yao, X.; Gong, W.; Huang, J.; Dzutsev, A.K.; McCulloch, J.; O’hUigin, C.; Bian, X.W.; Trinchieri, G.; et al. Distinct Contributions of Cathelin-Related Antimicrobial Peptide (CRAMP) Derived from Epithelial Cells and Macrophages to Colon Mucosal Homeostasis. J. Pathol. 2021, 253, 339–350. [Google Scholar] [CrossRef]
- Andrews, C.; McLean, M.H.; Durum, S.K. Cytokine Tuning of Intestinal Epithelial Function. Front. Immunol. 2018, 9, 1270. [Google Scholar] [CrossRef]
- Sommer, K.; Wiendl, M.; Müller, T.M.; Heidbreder, K.; Voskens, C.; Neurath, M.F.; Zundler, S. Intestinal Mucosal Wound Healing and Barrier Integrity in IBD–Crosstalk and Trafficking of Cellular Players. Front. Med. 2021, 8, 643973. [Google Scholar] [CrossRef]
- Rieder, F.; Karrasch, T.; Ben-Horin, S.; Schirbel, A.; Ehehalt, R.; Wehkamp, J.; de Haar, C.; Velin, D.; Latella, G.; Scaldaferri, F.; et al. Results of the 2nd Scientific Workshop of the ECCO (III): Basic Mechanisms of Intestinal Healing. J. Crohn’s Colitis 2012, 6, 373–385. [Google Scholar] [CrossRef]
- Zhou, Q.; Shen, Z.F.; Wu, B.S.; Xu, C.B.; He, Z.Q.; Chen, T.; Shang, H.T.; Xie, C.F.; Huang, S.Y.; Chen, Y.G.; et al. Risk of Colorectal Cancer in Ulcerative Colitis Patients: A Systematic Review and Meta-Analysis. Gastroenterol. Res. Pract. 2019, 2019, 5363261. [Google Scholar] [CrossRef]
- Inoue, T.; Murano, M.; Kuramoto, T.; Ishida, K.; Kawakami, K.; Abe, Y.; Morita, E.; Murano, N.; Toshina, K.; Nishikawa, T.; et al. Increased Proliferation of Middle to Distal Colonic Cells during Colorectal Carcinogenesis in Experimental Murine Ulcerative Colitis. Oncol. Rep. 2007, 18, 1457–1462. [Google Scholar] [CrossRef]
- Biton, M.; Haber, A.L.; Rogel, N.; Burgin, G.; Beyaz, S.; Schnell, A.; Ashenberg, O.; Su, C.W.; Smillie, C.; Shekhar, K.; et al. T Helper Cell Cytokines Modulate Intestinal Stem Cell Renewal and Differentiation. Cell 2018, 175, 1307–1320. [Google Scholar] [CrossRef] [PubMed]
- Giugliano, F.P.; Navis, M.; Ouahoud, S.; Garcia, T.M.; Kreulen, I.A.M.; Ferrantelli, E.; Meisner, S.; Vermeulen, J.L.M.; van Roest, M.; Billaud, J.N.; et al. Pro-Inflammatory T Cells-Derived Cytokines Enhance the Maturation of the Human Fetal Intestinal Epithelial Barrier. iScience 2024, 27, 109909. [Google Scholar] [CrossRef] [PubMed]
- Yi, J.; Bergstrom, K.; Fu, J.; Shan, X.; McDaniel, J.M.; McGee, S.; Qu, D.; Houchen, C.W.; Liu, X.; Xia, L. Dclk1 in Tuft Cells Promotes Inflammation-Driven Epithelial Restitution and Mitigates Chronic Colitis. Cell Death Differ. 2019, 26, 1656–1669. [Google Scholar] [CrossRef] [PubMed]
- Viragova, S.; Li, D.; Klein, O.D. Activation of Fetal-like Molecular Programs during Regeneration in the Intestine and Beyond. Cell Stem Cell 2024, 31, 949–960. [Google Scholar] [CrossRef] [PubMed]
- Ishikawa, K.; Sugimoto, S.; Oda, M.; Fujii, M.; Takahashi, S.; Ohta, Y.; Takano, A.; Ishimaru, K.; Matano, M.; Yoshida, K.; et al. Identification of Quiescent LGR5+ Stem Cells in the Human Colon. Gastroenterology 2022, 163, 1391–1406. [Google Scholar] [CrossRef]
- Goldsmith, J.R.; Spitofsky, N.; Zamani, A.; Hood, R.; Boggs, A.; Li, X.; Li, M.; Reiner, E.; Ayyaz, A.; Etwebi, Z.; et al. TNFAIP8 Controls Murine Intestinal Stem Cell Homeostasis and Regeneration by Regulating Microbiome-Induced Akt Signaling. Nat. Commun. 2020, 11, 2591. [Google Scholar] [CrossRef]
- Ramalingam, S.; Daughtridge, G.W.; Johnston, M.J.; Gracz, A.D.; Magness, S.T. Distinct Levels of Sox9 Expression Mark Colon Epithelial Stem Cells That form Colonoids in Culture. Am. J. Physiol.-Gastrointest. Liver Physiol. 2012, 302, 10–20. [Google Scholar] [CrossRef]
- Gao, F.; Zhang, Y.; Wang, S.; Liu, Y.; Zheng, L.; Yang, J.; Huang, W.; Ye, Y.; Luo, W.; Xiao, D. Hes1 Is Involved in the Self-Renewal and Tumourigenicity of Stem-like Cancer Cells in Colon Cancer. Sci. Rep. 2014, 4, 3963. [Google Scholar] [CrossRef]
- Qi, Z.; Li, Y.; Zhao, B.; Xu, C.; Liu, Y.; Li, H.; Zhang, B.; Wang, X.; Yang, X.; Xie, W.; et al. BMP Restricts Stemness of Intestinal Lgr5+ Stem Cells by Directly Suppressing Their Signature Genes. Nat. Commun. 2017, 8, 13824. [Google Scholar] [CrossRef]
- Yu, T.; Chen, X.; Zhang, W.; Li, J.; Xu, R.; Wang, T.C.; Ai, W.; Liu, C. Krüppel-like Factor 4 Regulates Intestinal Epithelial Cell Morphology and Polarity. PLoS ONE 2012, 7, e32492. [Google Scholar] [CrossRef]
- Li, H.J.; Ray, S.K.; Kucukural, A.; Gradwohl, G.; Leiter, A.B. Reduced Neurog3 Gene Dosage Shifts Enteroendocrine Progenitor Towards Goblet Cell Lineage in the Mouse Intestine. Cell. Mol. Gastroenterol. Hepatol. 2021, 11, 433–448. [Google Scholar] [CrossRef] [PubMed]
- Bjerknes, M.; Cheng, H. Cell Lineage Metastability in Gfi1-Deficient Mouse Intestinal Epithelium. Dev. Biol. 2010, 345, 49–63. [Google Scholar] [CrossRef] [PubMed]
- Casas, C. GRP78 at the Centre of the Stage in Cancer and Neuroprotection. Front. Neurosci. 2017, 11, 177. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H.; Yoon, Y.M.; Lee, S.H. GRP78 Regulates Apoptosis, Cell Survival and Proliferation in 5-Fluorouracil-Resistant SNUC5 Colon Cancer Cells. Anticancer. Res. 2017, 37, 4943–4951. [Google Scholar] [CrossRef] [PubMed]
- Whittle, B.J.R.; Varga, C.; Pósa, A.; Molnár, A.; Collin, M.; Thiemermann, C. Reduction of Experimental Colitis in the Rat by Inhibitors of Glycogen Synthase Kinase-3β. Br. J. Pharmacol. 2006, 147, 575–582. [Google Scholar] [CrossRef]
- Qiao, D.; Zhang, Z.; Zhang, Y.; Chen, Q.; Chen, Y.; Tang, Y.; Sun, X.; Tang, Z.; Dai, Y. Regulation of Endoplasmic Reticulum Stress-Autophagy: A Potential Therapeutic Target for Ulcerative Colitis. Front. Pharmacol. 2021, 12, 697360. [Google Scholar] [CrossRef]
- Yuasa, T.; Takata, Y.; Aki, N.; Kunimi, K.; Satoh, M.; Nii, M.; Izumi, Y.; Otoda, T.; Hashida, S.; Osawa, H.; et al. Insulin Receptor Cleavage Induced by Estrogen Impairs Insulin Signaling. BMJ Open Diabetes Res. Care 2021, 9, e002467. [Google Scholar] [CrossRef]
- Hebert-Schuster, M.; Rotta, B.E.; Kirkpatrick, B.; Guibourdenche, J.; Cohen, M. The Interplay between Glucose-Regulated Protein 78 (GRP78) and Steroids in the Reproductive System. Int. J. Mol. Sci. 2018, 19, 1842. [Google Scholar] [CrossRef]
- Andres, S.F.; Agostina Santoro, M.; Mah, A.T.; Adeola Keku, J.; Bortvedt, A.E.; Eric Blue, R.; Kay Lund, P. Deletion of Intestinal Epithelial Insulin Receptor Attenuates High-Fat Diet-Induced Elevations in Cholesterol and Stem, Enteroendocrine, and Paneth Cell MRNAs. Am. J. Physiol.-Gastrointest. Liver Physiol. 2015, 308, G100–G111. [Google Scholar] [CrossRef]
- Liu, Y.; Beyer, A.; Aebersold, R. On the Dependency of Cellular Protein Levels on MRNA Abundance. Cell 2016, 165, 535–550. [Google Scholar] [CrossRef]
- Bernstein, M.T.; Graff, L.A.; Targownik, L.E.; Downing, K.; Shafer, L.A.; Rawsthorne, P.; Bernstein, C.N.; Avery, L. Gastrointestinal Symptoms before and during Menses in Women with IBD. Aliment. Pharmacol. Ther. 2012, 36, 135–144. [Google Scholar] [CrossRef] [PubMed]
- Shen, Z.H.; Zhu, C.X.; Quan, Y.S.; Yang, Z.Y.; Wu, S.; Luo, W.W.; Tan, B.; Wang, X.Y. Relationship between Intestinal Microbiota and Ulcerative Colitis: Mechanisms and Clinical Application of Probiotics and Fecal Microbiota Transplantation. World J. Gastroenterol. 2018, 24, 5–14. [Google Scholar] [CrossRef] [PubMed]
- Markle, J.G.M.; Frank, D.N.; Mortin-Toth, S.; Robertson, C.E.; Feazel, L.M.; Rolle-Kampczyk, U.; Von Bergen, M.; McCoy, K.D.; Macpherson, A.J.; Danska, J.S. Sex Differences in the Gut Microbiome Drive Hormone-Dependent Regulation of Autoimmunity. Science 2013, 339, 1084–1088. [Google Scholar] [CrossRef] [PubMed]
- Hsiao, T.H.; Chou, C.H.; Chen, Y.L.; Wang, P.H.; Brandon-Mong, G.J.; Lee, T.H.; Wu, T.Y.; Li, P.T.; Li, C.W.; Lai, Y.L.; et al. Circulating Androgen Regulation by Androgen-Catabolizing Gut Bacteria in Male Mouse Gut. Gut Microbes 2023, 15, 2183685. [Google Scholar] [CrossRef]
- Colldén, H.; Landin, A.; Wallenius, V.; Elebring, E.; Fändriks, L.; Nilsson, M.E.; Ryberg, H.; Poutanen, M.; Sjögren, K.; Vandenput, L.; et al. The Gut Microbiota Is a Major Regulator of Androgen Metabolism in Intestinal Contents. Am. J. Physiol.-Endocrinol. Metab. 2019, 317, E1182–E1192. [Google Scholar] [CrossRef]
- Eissa, N.; Diarra, A.; Hussein, H.; Bernstein, C.N.; Ghia, J.-E. The Lack of Chromogranin-a Modifies the Gut Microbiota Composition and Regulates Experimental Colonic Inflammation. J. Can. Assoc. Gastroenterol. 2020, 3 (Suppl. S1), 137–138. [Google Scholar] [CrossRef][Green Version]
- Eissa, N.; Hussein, H.; Mesgna, R.; Bonin, S.; Hendy, G.N.; Marie-Hélène Metz-BoutigueBernstein, C.N.; Ghia, J. Catestatin Regulates Epithelial Cell Dynamics to Improve Intestinal Inflammation. Vaccines 2018, 6, 67. [Google Scholar] [CrossRef]
- McDonald, J.H. Handbook of Biological Statistics, 3rd ed.; Sparky House Publishing: Baltimore, MD, USA, 2015. [Google Scholar]
Target Gene Names | Primer Sequences (5′ to 3′) | PCR Temperature Profile Denature/Anneal/Extend | |
---|---|---|---|
TATA box protein (Tbp) | Forward | ACCGTGAATCTTGGCTGTAAAC | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | GCAGCAAATCGCTTGGGATTA | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
Differentiated epithelial cells | |||
Resistin-like molecule β (RelmB) | Forward | CCATTTCCTGAGCTTTCTGG | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | AGCACATCCAGTGACAACCA | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
Carbonic anhydrases (Ca2) | Forward | CAAGCACAACGGACCAGA | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | ATGAGCAGAGGCTGTAGG | 95 °C, 30 s/52 °C, 30 s/72 °C, 45 s | |
Mucin 2 (Muc2) | Forward | GAT GGC ACC TAC CTC GTT GT | 95 °C, 30 s/52 °C, 30 s/72 °C, 45 s |
Reverse | GTC CTG GCA CTT GTT GGA AT | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
Chromogranin A (Chga) | Forward | CAGGCTACAAAGCGATCCAG | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | GCCTCTGTCTTTCCATCTCC | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
Doublecortin Like Kinase 1 (Dclk1) | Forward | CTGGGTTAATGATGATGGTCTCC | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | ACAGAAACTCCTGCTGCAGT | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
Stem epithelial cells | |||
Leucine-rich repeat-containing G-protein coupled receptor 5 (Lgr5) | Forward | CTTCCGAATCGTCGATCTTC | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | AACGATCGCTCTCAGGCTAA | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
homeodomain-only protein homeobox (Hopx) | Forward | TCTCCATCCTTAGTCAGACGC | 95 °C, 30 s/59 °C, 30 s/72 °C, 45 s |
Reverse | GGGTGCTTGTTGACCTTGTT | 95 °C, 30 s/59 °C, 30 s/72 °C, 45 s | |
Lymphocyte antigen-6 A (Ly6a/Sca1) | Forward | AGGAGGCAGCAGTTATTGTGG | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | CGTTGACCTTAGTACCCAGGA | 95 °C, 30 s/52 °C, 30 s/72 °C, 45 s | |
Lineage commitments | |||
hairy and enhancer of split 1 (Hes1) | Forward | CTTATGAAAGTCAAGTAAAAGGACG | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | ATAGGCTTTGATGACTTTCTGTG | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
Atonal homolog 1 (Atoh1) | Forward | GACAAATATCCCTGCACCCT | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | CAGAGGCAGAGATACGACAT | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
Neurogenic locus notch homolog protein 1 (Notch 1) | Forward | CTGAGAGCTCCTGCTTCAAT | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | AGTACCATAGCTGTCTTGGC | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
Bone morphogenetic protein 4 (Bmp4) | Forward | TTCCTGGTAACCGAATGCTGA | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | CCTGAATCTCGGCGACTTTTT | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
Growth Factor Independent 1B (Gfi1b) | Forward | ATGCCACGGTCCTTTCTAGTG | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | GGAAGGCTCTGGTTCAGCAA | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
Krüppel-like factor 4 (Klf4) | Forward | CAGACCAGATGCAGTCACAA | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | GTTTCTCGCCTGTGTGAGTT | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
Neurogenin 3 (Neurog3) | Forward | TCTCGCCTCTTCTGGCTTTC | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | AAGTCGGTGAAGAACGGACAA | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
SRY-Box Transcription Factor 9 (Sox9) | Forward | CAAGCACAACGGACCAGA | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | CAGCGCCTTGAAGATAGCATT | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
GRP78 signaling pathway | |||
Activating transcription factor 6 (Atf6) | Forward | CTGGGCTCGGTAGTTTGTATC | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | AGACCTGAATGGCTGCTTAC | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
X-box binding protein 1 (Xbp1) | Forward | CCTTCAGTGACATGTCTTCTCC | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s |
Reverse | CCCAGTGTTATGTGGCTCTTTA | 95 °C, 30 s/55 °C, 30 s/72 °C, 45 s | |
C/EBP homologous protein (Chop) | Forward | GGAGGTCCTGTCCTCAGATGAA | 95 °C, 30 s/59 °C, 30 s/72 °C, 45 s |
Reverse | GCTCCTCTGTCAGCCAAGCTAG | 95 °C, 30 s/59 °C, 30 s/72 °C, 45 s | |
Glycogen synthase kinase-3 beta (Gsk3b) | Forward | GAGCCACTGATTACACGTCCAG | 95 °C, 30 s/59 °C, 30 s/72 °C, 45 s |
Reverse | CCAACTGATCCACACCACTGTC | 95 °C, 30 s/59 °C, 30 s/72 °C, 45 s | |
Mammalian target of rapamycin (mTor) | Forward | AGAAGGGTCTCCAAGGACGACT | 95 °C, 30 s/59 °C, 30 s/72 °C, 45 s |
Reverse | GCAGGACACAAAGGCAGCATTG | 95 °C, 30 s/59 °C, 30 s/72 °C, 45 s |
Antibodies | Sources | Locations | Identifier Catalogue Numbers |
---|---|---|---|
Rat Ki-67 Monoclonal Antibody (SolA15) | Invitrogen | Winnipeg, MB, CA | 14-5698-82 |
Rabbit Keratin 20 (D9Z1Z) XP® antibody | Cell Signaling Technology | Danvers, MA, USA | 13063S |
Rabbit Anti-MUC2 (EPR23479-47) antibody | Abcam, Inc. | Waltham, MA, USA | ab272692 |
Rabbit Chromogranin A antibody | Invitrogen | Winnipeg, MB, CA | PA5-16685 |
Mouse Doublecortin (E-6) antibody | Santa Cruz | San Diego, CA, USA | sc-271390 |
Rabbit LGR5/GPR49 antibody | Bio-Techne | Minneapolis, MN, USA | NBP1-28904 |
Rat LY-6A/E (D7) antibody | Santa Cruz | San Diego, CA, USA | SC-52601 |
Mouse HOP (E-1) (HOPX) antibody | Santa Cruz | San Diego, CA, USA | SC-398703 |
Goat anti-Rat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 | Invitrogen | Winnipeg, MB, CA | A11006 |
Goat anti-Rat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 647 | Invitrogen | Winnipeg, MB, CA | A21247 |
Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 | Invitrogen | Winnipeg, MB, CA | A11034 |
Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 647 | Invitrogen | Winnipeg, MB, CA | A21244 |
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 | Invitrogen | Winnipeg, MB, CA | A11001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tshikudi, D.M.; Hutchison, H.; Ghia, J.-E. Pancreastatin Inhibition Alters the Colonic Epithelial Cells Profile in a Sex-Dependent Manner. Int. J. Mol. Sci. 2024, 25, 12757. https://doi.org/10.3390/ijms252312757
Tshikudi DM, Hutchison H, Ghia J-E. Pancreastatin Inhibition Alters the Colonic Epithelial Cells Profile in a Sex-Dependent Manner. International Journal of Molecular Sciences. 2024; 25(23):12757. https://doi.org/10.3390/ijms252312757
Chicago/Turabian StyleTshikudi, Diane M., Hannah Hutchison, and Jean-Eric Ghia. 2024. "Pancreastatin Inhibition Alters the Colonic Epithelial Cells Profile in a Sex-Dependent Manner" International Journal of Molecular Sciences 25, no. 23: 12757. https://doi.org/10.3390/ijms252312757
APA StyleTshikudi, D. M., Hutchison, H., & Ghia, J.-E. (2024). Pancreastatin Inhibition Alters the Colonic Epithelial Cells Profile in a Sex-Dependent Manner. International Journal of Molecular Sciences, 25(23), 12757. https://doi.org/10.3390/ijms252312757