Evaluation of Salt Resistance of Six Apple Rootstocks
Abstract
1. Introduction
2. Results and Analysis
2.1. Changes in Apple Rootstock Plants Under Salt Stress
2.2. Changes in Apple Rootstock Leaves Under Salt Stress
2.3. Changes in Leaf Structure of Apple Rootstocks Under Salt Stress
2.4. Changes in Elements in Apple Rootstock Leaves Under Salt Stress
2.5. Changes in Antioxidant Enzyme Activity and Osmotic Substances in Apple Rootstock Leaves Under Salt Stress
2.6. Changes in Plant Hormones in Apple Rootstocks Under Salt Stress
2.7. Expression of Stress-Related Genes in Apple Rootstocks Under Salt Stress
2.8. The Effect of Salt Stress on the Physiological Indicators of Rooting Rootstocks
2.9. The Effect of Salt Stress on the Rootstock Root System
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Experimental Design
4.3. Determination of Growth Indicators
4.4. Determination of Relative Moisture Content of Leaves
4.5. Determination of Malondialdehyde
4.6. Determination of Relative Conductivity
4.7. Observation of Leaf Tissue Staining
4.8. Determination of Chlorophyll
4.9. Determination of Anthocyanins
4.10. Observation of Plant Tissue Slices
4.11. Determination of Superoxide Anions and Hydrogen Peroxide
4.12. Determination of Ion Content
4.13. Determination of Oxidase Activity
4.14. Determination of Penetrating Substances
4.15. Determination of Endogenous Hormones
4.16. Related Gene Expression
4.17. Data Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
ABA | Abscisic acid |
GA4 | Gibberellic acid |
SA | Salicylic acid |
FW | Fresh weight |
ddH2O | Double distilled water |
DW | Dry weight |
FW | Fresh weight |
MDA | Malondialdehyde |
H2O2 | Hydrogen peroxide |
O2 | Superoxide anion |
NBT | Nitro Blue Tetrazolium |
DAB | Diaminobenzidine |
CAT | Catalase |
POD | Peroxidase |
SOD | Superoxide dismutase |
References
- Mao, Y.; Cui, X.; Wang, H.; Qin, X.; Liu, Y.; Hu, Y.; Chen, X.; Mao, Z.; Shen, X. Study of the grafting compatibility of the apple rootstock 12-2, resistant to apple replant diseases (ARD). BMC Plant Biol. 2022, 22, 468. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Pan, C. State Analysis of Apple Industry in China, IOP Conference Series: Earth and Environmental Science; IOP Publishing: Bristol, UK, 2021; p. 012067. [Google Scholar]
- Li, X.; Li, M.; Zhou, B.; Yang, Y.; Zhou, J.; Wei, Q.; Zhang, J. Na+ efflux from apple dwarfing rootstocks is associated with high-salt resistance of their scions. J. Plant Growth Regul. 2021, 40, 2139–2147. [Google Scholar] [CrossRef]
- Wada, M.; Nishitani, C.; Komori, S. Stable and efficient transformation of apple. Plant Biotechnol. 2020, 37, 163–170. [Google Scholar] [CrossRef]
- Chen, K.; Song, M.; Guo, Y.; Liu, L.; Xue, H.; Dai, H.; Zhang, Z. MdMYB46 could enhance salt and osmotic stress tolerance in apple by directly activating stress-responsive signals. Plant Biotechnol. J. 2019, 17, 2341–2355. [Google Scholar] [CrossRef] [PubMed]
- Melnyk, C.W.; Meyerowitz, E.M. Plant grafting. Curr. Biol. 2015, 25, R183–R188. [Google Scholar] [CrossRef]
- Marini, R.P.; Fazio, G. Apple rootstocks: History, physiology, management, and breeding. Hortic. Rev. 2018, 45, 197–312. [Google Scholar]
- Sosna, I.; Gudarowska, E.; Spiak, Z. Effect of rootstock on leaf nutrient concentration and productive value of ‘Mutsu’apple trees. J. Elem. 2020, 25, 1581–1593. [Google Scholar]
- Guo, L.L.; Hao, L.H.; Jia, H.H.; Li, F.; Zhang, X.X.; Cao, X.; Xu, M.; Zheng, Y.P. Effects of NaCl stress on stomatal traits, leaf gas exchange parameters, and biomass of two tomato cultivars. Ying Yong Sheng Tai Xue Bao = J. Appl. Ecol. 2018, 29, 3949–3958. [Google Scholar]
- Ondrasek, G.; Rathod, S.; Manohara, K.K.; Gireesh, C.; Anantha, M.S.; Sakhare, A.S.; Parmar, B.; Yadav, B.K.; Bandumula, N.; Raihan, F.; et al. Salt Stress in Plants and Mitigation Approaches. Plants 2022, 11, 717. [Google Scholar] [CrossRef]
- An, J.P.; Li, R.; Qu, F.J.; You, C.X.; Wang, X.F.; Hao, Y.J. Ectopic expression of an apple cytochrome P450 gene MdCYPM1 negatively regulates plant photomorphogenesis and stress response in Arabidopsis. Biochem. Biophys. Res. Commun. 2017, 483, 1–9. [Google Scholar] [CrossRef]
- Valverdi, N.A.; Cheng, L.; Kalcsits, L. Apple scion and rootstock contribute to nutrient uptake and partitioning under different belowground environments. Agronomy 2019, 9, 415. [Google Scholar] [CrossRef]
- Hezema, Y.S.; Shukla, M.R.; Ayyanath, M.M.; Sherif, S.M.; Saxena, P.K. Physiological and molecular responses of six apple rootstocks to osmotic stress. Int. J. Mol. Sci. 2021, 22, 8263. [Google Scholar] [CrossRef] [PubMed]
- Nawaz, M.A.; Imtiaz, M.; Kong, Q.; Cheng, F.; Ahmed, W.; Huang, Y.; Bie, Z. Grafting: A technique to modify ion accumulation in horticultural crops. Front. Plant Sci. 2016, 7, 1457. [Google Scholar] [CrossRef]
- Shahid, M.A.; Balal, R.M.; Khan, N.; Simón-Grao, S.; Alfosea-Simón, M.; Cámara-Zapata, J.M.; Mattson, N.S.; Garcia-Sanchez, F. Rootstocks influence the salt tolerance of Kinnow mandarin trees by altering the antioxidant defense system, osmolyte concentration, and toxic ion accumulation. Sci. Hortic. 2019, 250, 1–11. [Google Scholar] [CrossRef]
- Molassiotis, A.; Sotiropoulos, T.; Tanou, G.; Kofidis, G.; Diamantidis, G.; Therios, E. Antioxidant and anatomical responses in shoot culture of the apple rootstock MM 106 treated with NaCl, KCl, mannitol or sorbitol. Biol. Plant. 2006, 50, 331–338. [Google Scholar] [CrossRef]
- Kviklys, D.; Samuolienė, G. Relationships among the rootstock, crop load, and sugar hormone signaling of apple tree, and their effects on biennial bearing. Front. Plant Sci. 2020, 11, 1213. [Google Scholar] [CrossRef] [PubMed]
- Fazio, G. Genetics, breeding, and genomics of apple rootstocks. Apple Genome 2021, 105–130. [Google Scholar] [CrossRef]
- Li, C.; Sun, X.; Chang, C.; Jia, D.; Wei, Z.; Li, C.; Ma, F. Dopamine alleviates salt-induced stress in Malus hupehensis. Physiol. Plant. 2015, 153, 584–602. [Google Scholar] [CrossRef]
- Li, X.L.; Meng, D.; Li, M.J.; Zhou, J.; Yang, Y.Z.; Zhou, B.B.; Wei, Q.P.; Zhang, J.K. Transcription factors MhDREB2A/MhZAT10 play a role in drought and cold stress response crosstalk in apple. Plant Physiol. 2023, 192, 2203–2220. [Google Scholar] [CrossRef]
- Parvaneh, T.; Abedi, B.; Davarynejad, G.H.; Moghadam, E.G. Enzyme activity, phenolic and flavonoid compounds in leaves of Iranian red flesh apple cultivars grown on different rootstocks. Sci. Hortic. 2019, 246, 862–870. [Google Scholar] [CrossRef]
- Aras, S.; Eşitken, A. Responses of apple plants to salinity stress. Yuz. Yıl Univ. J. Agric. Sci. 2019, 29, 253–257. [Google Scholar] [CrossRef]
- Hu, L.; Zhou, K.; Liu, Y.; Yang, S.; Zhang, J.; Gong, X.; Ma, F. Overexpression of MdMIPS1 enhances salt tolerance by improving osmosis, ion balance, and antioxidant activity in transgenic apple. Plant Sci. Int. J. Exp. Plant Biol. 2020, 301, 110654. [Google Scholar] [CrossRef] [PubMed]
- Ren, Y.R.; Yang, Y.Y.; Zhang, R.; You, C.X.; Zhao, Q.; Hao, Y.J. MdGRF11, an apple 14-3-3 protein, acts as a positive regulator of drought and salt tolerance. Plant Sci. Int. J. Exp. Plant Biol. 2019, 288, 110219. [Google Scholar] [CrossRef]
- Su, Q.; Zheng, X.; Tian, Y.; Wang, C. Exogenous Brassinolide Alleviates Salt Stress in Malus hupehensis Rehd. by Regulating the Transcription of NHX-Type Na(+)(K(+))/H(+) Antiporters. Front. Plant Sci. 2020, 11, 38. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.R.; Yang, K.; Wang, X.; Lin, X.L.; Rui, L.; Liu, H.F.; Liu, D.D.; You, C.X. Overexpression of MdZAT5, an C2H2-Type Zinc Finger Protein, Regulates Anthocyanin Accumulation and Salt Stress Response in Apple Calli and Arabidopsis. Int. J. Mol. Sci. 2022, 23, 1897. [Google Scholar] [CrossRef] [PubMed]
- Matsumoto, K.; Kobayashi, T. Relative tolerance of Japanese apple (Malus spp.) rootstock strains to NaCl stress. IV Balk. Symp. Fruit Grow. 2019, 1289, 9–18. [Google Scholar] [CrossRef]
- Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef]
- Yang, Y.; Guo, Y. Elucidating the molecular mechanisms mediating plant salt-stress responses. New Phytol. 2018, 217, 523–539. [Google Scholar] [CrossRef]
- Jiroutova, P.; Kovalikova, Z.; Toman, J.; Dobrovolna, D.; Andrys, R. Complex analysis of antioxidant activity, abscisic acid level, and accumulation of osmotica in apple and cherry in vitro cultures under osmotic stress. Int. J. Mol. Sci. 2021, 22, 7922. [Google Scholar] [CrossRef]
- Zhang, H.; Zhang, Y.; Deng, C.; Deng, S.; Li, N.; Zhao, C.; Zhao, R.; Liang, S.; Chen, S. The Arabidopsis Ca(2+)-Dependent Protein Kinase CPK12 Is Involved in Plant Response to Salt Stress. Int. J. Mol. Sci. 2018, 19, 4062. [Google Scholar] [CrossRef]
- Mittler, R.; Zandalinas, S.I.; Fichman, Y.; Van Breusegem, F. Reactive oxygen species signalling in plant stress responses. Nat. Rev. Mol. Cell Biol. 2022, 23, 663–679. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Gao, Y.; Sun, S.; Lu, X.; Li, Q.; Li, L.; Wang, K.; Liu, J. Effects of Salt Stress on the Antioxidant Activity and Malondialdehyde, Solution Protein, Proline, and Chlorophyll Contents of Three Malus Species. Life 2022, 12, 1929. [Google Scholar] [CrossRef] [PubMed]
- Waszczak, C.; Carmody, M.; Kangasjärvi, J. Reactive Oxygen Species in Plant Signaling. Annu. Rev. Plant Biol. 2018, 69, 209–236. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Zhao, Y.; Ai, S.; Chen, X.; Liu, X.; Wang, H.; Han, Y.; Ma, F.; Li, C. Induction of polyploid Malus prunifolia and analysis of its salt tolerance. Tree Physiol. 2022, 42, 2100–2115. [Google Scholar] [CrossRef]
- Zhu, Y.; Kuang, W.; Leng, J.; Wang, X.; Qiu, L.; Kong, X.; Wang, Y.; Zhao, Q. The apple 14-3-3 gene MdGRF6 negatively regulates salt tolerance. Front. Plant Sci. 2023, 14, 1161539. [Google Scholar] [CrossRef]
- Mishra, A.; Tanna, B. Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters. Front. Plant Sci. 2017, 8, 829. [Google Scholar] [CrossRef]
- Chen, K.; Guo, Y.; Song, M.; Liu, L.; Xue, H.; Dai, H.; Zhang, Z. Dual role of MdSND1 in the biosynthesis of lignin and in signal transduction in response to salt and osmotic stress in apple. Hortic. Res. 2020, 7, 204. [Google Scholar] [CrossRef]
- Zhang, Q.Y.; Ma, C.N.; Gu, K.D.; Wang, J.H.; Yu, J.Q.; Liu, B.; Wang, Y.; He, J.X.; Hu, D.G.; Sun, Q. The BTB-BACK-TAZ domain protein MdBT2 reduces drought resistance by weakening the positive regulatory effect of MdHDZ27 on apple drought tolerance via ubiquitination. Plant J. Cell Mol. Biol. 2024, 119, 283–299. [Google Scholar] [CrossRef]
- Tahir, M.M.; Li, S.; Mao, J.; Liu, Y.; Li, K.; Zhang, X.; Lu, X.; Ma, X.; Zhao, C.; Zhang, D. High nitrate inhibited adventitious roots formation in apple rootstock by altering hormonal contents and miRNAs expression profiles. Sci. Hortic. 2021, 286, 110230. [Google Scholar] [CrossRef]
- Yang, W.; Liu, X.D.; Chi, X.J.; Wu, C.A.; Li, Y.Z.; Song, L.L.; Liu, X.M.; Wang, Y.F.; Wang, F.W.; Zhang, C.; et al. Dwarf apple MbDREB1 enhances plant tolerance to low temperature, drought, and salt stress via both ABA-dependent and ABA-independent pathways. Planta 2011, 233, 219–229. [Google Scholar] [CrossRef]
- Hubbard, K.E.; Nishimura, N.; Hitomi, K.; Getzoff, E.D.; Schroeder, J.I. Early abscisic acid signal transduction mechanisms: Newly discovered components and newly emerging questions. Genes Dev. 2010, 24, 1695–1708. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.H.; Zhang, F.J.; Sun, P.; Li, Z.Y.; Zheng, P.F.; Gu, K.D.; Hao, Y.J.; Zhang, Z.; You, C.X. Apple receptor-like kinase FERONIA regulates salt tolerance and ABA sensitivity in Malus domestica. J. Plant Physiol. 2022, 270, 153616. [Google Scholar] [CrossRef] [PubMed]
- Jing, X.; Liu, Y.; Liu, X.; Wang, X.F.; You, C.; Chang, D.; Zhang, S. Nitrogen-doped carbon dots enhanced seedling growth and salt tolerance with distinct requirements of excitation light. RSC Adv. 2023, 13, 12114–12122. [Google Scholar] [CrossRef] [PubMed]
- Xue, H.; Zhang, F.; Zhang, Z.-H.; Fu, J.-F.; Wang, F.; Zhang, B.; Ma, Y. Differences in salt tolerance between diploid and autotetraploid apple seedlings exposed to salt stress. Sci. Hortic. 2015, 190, 24–30. [Google Scholar] [CrossRef]
- Landi, M. Commentary to: “Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds” by Hodges et al. Planta (1999) 207:604–611. Planta 2017, 245, 1067. [Google Scholar] [CrossRef]
- Jambunathan, N. Determination and detection of reactive oxygen species (ROS), lipid peroxidation, and electrolyte leakage in plants. Methods Mol. Biol. 2010, 639, 292–298. [Google Scholar]
- Li, C.; Wei, Z.; Liang, D.; Zhou, S.; Li, Y.; Liu, C.; Ma, F. Enhanced salt resistance in apple plants overexpressing a Malus vacuolar Na+/H+ antiporter gene is associated with differences in stomatal behavior and photosynthesis. Plant Physiol. Biochem. 2013, 70, 164–173. [Google Scholar] [CrossRef]
- Yan, R.; Zhang, T.; Wang, Y.; Wang, W.; Sharif, R.; Liu, J.; Dong, Q.; Luan, H.; Zhang, X.; Li, H.; et al. The apple MdGA2ox7 modulates the balance between growth and stress tolerance in an anthocyanin-dependent manner. Plant Physiol. Biochem. 2024, 212, 108707. [Google Scholar] [CrossRef]
- Yang, J.; Li, W.; Guo, X.; Chen, P.; Cheng, Y.; Mao, K.; Ma, F. Cation/Ca(2+) Exchanger 1 (MdCCX1), a Plasma Membrane-Localized Na(+) Transporter, Enhances Plant Salt Tolerance by Inhibiting Excessive Accumulation of Na(+) and Reactive Oxygen Species. Front. Plant Sci. 2021, 12, 746189. [Google Scholar] [CrossRef]
18s | F:ACACGGGGAGGTAGTGACAA R:CCTCCAATGGATCCTCGTTA |
---|---|
MdSOS1 | F:TCCGGTTAATCCATCACACACCGT R:TTTGCTGCCCTGGAGGATTTGTTG |
MdSOS2 | F:TTAGTGGACAGGGTTACGA R:CCATTGAGTTCGCTACAGC |
MdSOS3 | F:GGTGTGAATGTGAAGATGAT R:CACAACTGACTCGACG |
MdAREB1A | F:CAGAGAATCAGCTGCCAGGT R:TCTCCATGTCCTGATTCTTC |
MdAREB1B | F:TTAGAACTAGAGGCAGAAGT R:CTGTCAATGTTCGTCGTAAG |
MdWRKY30 | F:AAGGGAGGGATCTGGCTAGG R:TGAGGCTGAGCTGCTAGAGT |
MdRD29A | F:CTGAAGAAGGTAAAGGAGAA R:CCTTCAAAATATCTCCTTGC |
MdRD29B | F:CCAAATTACCATGCCTCAAC R:CCTTGGACTTGTACTCTCCC |
MdNHX1 | F:CATCGCTATTGGCGTAAGT R:TTGTTCCGTTCAGTTGGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, L.; Chen, G.; Sun, Q.; Wang, Q.; Wang, S.; Wang, H.; Ni, Z.; Jiang, C.; Li, L.; Li, T. Evaluation of Salt Resistance of Six Apple Rootstocks. Int. J. Mol. Sci. 2024, 25, 12568. https://doi.org/10.3390/ijms252312568
Li L, Chen G, Sun Q, Wang Q, Wang S, Wang H, Ni Z, Jiang C, Li L, Li T. Evaluation of Salt Resistance of Six Apple Rootstocks. International Journal of Molecular Sciences. 2024; 25(23):12568. https://doi.org/10.3390/ijms252312568
Chicago/Turabian StyleLi, Lun, Guolin Chen, Qingrong Sun, Qing Wang, Sen Wang, Haibo Wang, Zhihua Ni, Caina Jiang, Linguang Li, and Tianhong Li. 2024. "Evaluation of Salt Resistance of Six Apple Rootstocks" International Journal of Molecular Sciences 25, no. 23: 12568. https://doi.org/10.3390/ijms252312568
APA StyleLi, L., Chen, G., Sun, Q., Wang, Q., Wang, S., Wang, H., Ni, Z., Jiang, C., Li, L., & Li, T. (2024). Evaluation of Salt Resistance of Six Apple Rootstocks. International Journal of Molecular Sciences, 25(23), 12568. https://doi.org/10.3390/ijms252312568