Evaluation of the Anti-Cancer Potential of Extracellular Vesicles Derived from Human Amniotic Fluid Stem Cells: Focus on Effective miRNAs in the Treatment of Melanoma Progression
Abstract
1. Introduction
2. Results
2.1. Characterization of Cell Population from Amniotic Fluid of Second and Third Trimester
2.2. EVs Isolation and Characterization
2.3. hAFSCs-EVs Inhibited the Proliferation and Cancer Progression of SK-MEL-28 Cells
3. Discussion
4. Materials and Methods
4.1. Amniotic Fluid Stem Cell Isolation
4.2. Limit Dilution Test
4.3. Cellular Proliferation
4.4. Senescence Assay
4.5. FACS Analyses
4.6. Immunofluorescence and Confocal Microscopy
4.7. RNA Isolation and Quantification
- NANOG:Fw CCAGAACCAGAGAATGAAATC, Rv TGGTGGTAGGAAGAGTAAAG, (NM_024865);
- SOX2: Fw ATAATAACAATCATCGGCGG, Rv AAAAAGAGAGAGGCAAACTG, (NM_003106);
- OCT4: Fw AGAGAAAGCGAACCAGTATC, Rv TTACAGAACCACACTCGG, (NM_002701.5);
- GAPDH: Fw ACAGTTGCCATGTAGACC, Rv TTGAGCACAGGGTACTTTA, (NM_002046);
4.8. Differentiation Protocols
4.9. Histological Staining
4.10. EV Isolation
4.11. ELISA Assays
4.12. SDS PAGE and Western Blot
4.13. Mass Spectrometry and Bioinformatic Analysis
4.14. miRNA Analysis
4.15. Melanoma Cell Line Culture
4.16. Cell Cycle and Apoptosis Analyses
4.17. Migration Assay
4.18. Invasion Test
4.19. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jafari, A.; Rezaei-Tavirani, M.; Farhadihosseinabadi, B.; Zali, H.; Niknejad, H. Human amniotic mesenchymal stem cells to promote/suppress cancer: Two sides of the same coin. Stem Cell Res. Ther. 2021, 12, 126. [Google Scholar] [CrossRef]
- Dai, L.J.; Moniri, M.R.; Zeng, Z.R.; Zhou, J.X.; Rayat, J.; Warnock, G.L. Potential implications of mesenchymal stem cells in cancer therapy. Cancer Lett. 2011, 305, 8–20. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.W.; Ryu, S.; Kim, D.S.; Lee, J.W.; Sung, K.W.; Koo, H.H.; Yoo, K.H. Mesenchymal stem cells in suppression or progression of hematologic malignancy: Current status and challenges. Leukemia 2019, 33, 597–611. [Google Scholar] [CrossRef]
- Xuan, X.; Tian, C.; Zhao, M.; Sun, Y.; Huang, C. Mesenchymal stem cells in cancer progression and anticancer therapeutic resistance. Cancer Cell Int. 2021, 21, 595. [Google Scholar] [CrossRef]
- Hamid, A.A.; Joharry, M.K.; Mun-Fun, H.; Hamzah, S.N.; Rejali, Z.; Yazid, M.N.; Thilakavathy, K.; Nordin, N. Highly potent stem cells from full-term amniotic fluid: A realistic perspective. Reprod. Biol. 2017, 17, 9–18. [Google Scholar] [CrossRef]
- Teixo, R.; Pires, A.S.; Pereira, E.; Serambeque, B.; Marques, I.A.; Laranjo, M.; Mojsilović, S.; Gramignoli, R.; Ponsaerts, P.; Schoeberlein, A.; et al. Application of Perinatal Derivatives on Oncological Preclinical Models: A Review of Animal Studies. Int. J. Mol. Sci. 2022, 23, 8570. [Google Scholar] [CrossRef] [PubMed]
- Silini, A.R.; Cancelli, S.; Signoroni, P.B.; Cargnoni, A.; Magatti, M.; Parolini, O. The dichotomy of placenta-derived cells in cancer growth. Placenta 2017, 59, 154–162. [Google Scholar] [CrossRef]
- Jiao, H.; Guan, F.; Yang, B.; Li, J.; Song, L.; Hu, X.; Du, Y. Human amniotic membrane derived-mesenchymal stem cells induce C6 glioma apoptosis in vivo through the Bcl-2/caspase pathways. Mol. Biol. Rep. 2012, 39, 467–473. [Google Scholar] [CrossRef]
- Philipp, D.; Suhr, L.; Wahlers, T.; Choi, Y.H.; Paunel-Görgülü, A. Preconditioning of bone marrow-derived mesenchymal stem cells highly strengthens their potential to promote IL-6-dependent M2b polarization. Stem Cell Res. Ther. 2018, 9, 286. [Google Scholar] [CrossRef]
- Javan, M.R.; Khosrojerdi, A.; Moazzeni, S.M. New Insights Into Implementation of Mesenchymal Stem Cells in Cancer Therapy: Prospects for Anti-angiogenesis Treatment. Front. Oncol. 2019, 9, 840. [Google Scholar] [CrossRef]
- Sedrakyan, S.; Villani, V.; Da Sacco, S.; Tripuraneni, N.; Porta, S.; Achena, A.; Lavarreda-Pearce, M.; Petrosyan, A.; Soloyan, H.; Filippo, R.E.D.; et al. Amniotic fluid stem cell-derived vesicles protect from VEGF-induced endothelial damage. Sci. Rep. 2017, 7, 16875. [Google Scholar] [CrossRef] [PubMed]
- Rosner, M.; Pham, H.T.T.; Moriggl, R.; Hengstschläger, M. Human stem cells alter the invasive properties of somatic cells via paracrine activation of mTORC1. Nat. Commun. 2017, 8, 595. [Google Scholar] [CrossRef]
- Chen, Y.C.; Lan, Y.W.; Huang, S.M.; Yen, C.C.; Chen, W.; Wu, W.J.; Staniczek, T.; Chong, K.Y.; Chen, C.M. Human amniotic fluid mesenchymal stem cells attenuate pancreatic cancer cell proliferation and tumor growth in an orthotopic xenograft mouse model. Stem Cell Res. Ther. 2022, 13, 235. [Google Scholar] [CrossRef]
- Gholizadeh-Ghaleh Aziz, S.; Fardyazar, Z.; Pashaiasl, M. The human amniotic fluid mesenchymal stem cells therapy on, SKOV3, ovarian cancer cell line. Mol. Genet. Genom. Med. 2019, 7, e00726. [Google Scholar] [CrossRef] [PubMed]
- Pashaei-Asl, R.; Pashaiasl, M.; Ebrahimie, E.; Lale Ataei, M.; Paknejad, M. Apoptotic effects of human amniotic fluid mesenchymal stem cells conditioned medium on human MCF-7 breast cancer cell line. Bioimpacts 2023, 13, 191–206. [Google Scholar] [CrossRef]
- Beretti, F.; Gatti, M.; Zavatti, M.; Bassoli, S.; Pellacani, G.; Maraldi, T. Reactive Oxygen Species Regulation of Chemoresistance and Metastatic Capacity of Melanoma: Role of the Cancer Stem Cell Marker CD271. Biomedicines 2023, 11, 1229. [Google Scholar] [CrossRef]
- Phinney, D.G.; Pittenger, M.F. Concise Review: MSC-Derived Exosomes for Cell-Free Therapy. Stem Cells 2017, 35, 851–858. [Google Scholar] [CrossRef] [PubMed]
- Shaw, S.W.S.; Cheng, P.J.; Chang, Y.L.; Chao, A.S.; Wang, T.H.; Chang, S.D.; Hsieh, T.T.; Chang, K.H. Human amniotic fluid stem cells have better potential in early second trimester of pregnancy and can be reprogramed to iPS. Taiwan. J. Obstet. Gynecol. 2017, 56, 770–774. [Google Scholar] [CrossRef]
- Chitti, S.V.; Gummadi, S.; Kang, T.; Shahi, S.; Marzan, A.L.; Nedeva, C.; Sanwlani, R.; Bramich, K.; Stewart, S.; Petrovska, M.; et al. Vesiclepedia 2024: An extracellular vesicles and extracellular particles repository. Nucleic Acids Res. 2024, 52, D1694–D1698. [Google Scholar] [CrossRef]
- Feng, P.; Ding, H.; Lin, H.; Chen, W. AOD: The antioxidant protein database. Sci. Rep. 2017, 7, 7449. [Google Scholar] [CrossRef]
- Kumar, R.; Raghava, G.P.S. ApoCanD: Database of human apoptotic proteins in the context of cancer. Sci. Rep. 2016, 6, 20797. [Google Scholar] [CrossRef]
- Varrone, F.; Caputo, E. The miRNAs Role in Melanoma and in Its Resistance to Therapy. Int. J. Mol. Sci. 2020, 21, 878. [Google Scholar] [CrossRef] [PubMed]
- Ciesielska, S.; Slezak-prochazka, I.; Bil, P.; Rzeszowska-wolny, J. Micro RNAs in Regulation of Cellular Redox Homeostasis. Int. J. Mol. Sci. 2021, 22, 6022. [Google Scholar] [CrossRef] [PubMed]
- Wallace, S.R.; Pagano, P.J.; Kračun, D. MicroRNAs in the Regulation of NADPH Oxidases in Vascular Diabetic and Ischemic Pathologies: A Case for Alternate Inhibitory Strategies? Antioxidants 2022, 12, 70. [Google Scholar] [CrossRef]
- Xia, Y.; Li, Y.; Westover, K.D.; Sun, J.; Chen, H.; Zhang, J.; Fisher, D.E. Inhibition of Cell Proliferation in an NRAS Mutant Melanoma Cell Line by Combining Sorafenib and α-Mangostin. PLoS ONE 2016, 11, e0155217. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Li, H.; Zhao, J.; Zhang, Q.; Han, Z.; Han, Z.C.; Zhu, L.; Wang, H.; Li, Z. Extracellular vesicles derived from mesenchymal stem cells suppress breast cancer progression by inhibiting angiogenesis. Mol. Med. Rep. 2024, 30, 192. [Google Scholar] [CrossRef] [PubMed]
- Moradi-Chaleshtori, M.; Bandehpour, M.; Heidari, N.; Mohammadi-Yeganeh, S.; Mahmoud Hashemi, S. Exosome-mediated miR-33 transfer induces M1 polarization in mouse macrophages and exerts antitumor effect in 4T1 breast cancer cell line. Int. Immunopharmacol. 2021, 90, 107198. [Google Scholar] [CrossRef]
- Wang, M.; Li, J.; Wang, D.; Xin, Y.; Liu, Z. The effects of mesenchymal stem cells on the chemotherapy of colorectal cancer. Biomed. Pharmacother. 2023, 160, 114373. [Google Scholar] [CrossRef]
- Hong, I.S.; Lee, H.Y.; Kang, K.S. Mesenchymal stem cells and cancer: Friends or enemies? Mutat. Res. 2014, 768, 98–106. [Google Scholar] [CrossRef]
- Rahimi Tesiye, M.; Abrishami Kia, Z.; Rajabi-Maham, H. Mesenchymal stem cells and prostate cancer: A concise review of therapeutic potentials and biological aspects. Stem Cell Res. 2022, 63, 102864. [Google Scholar] [CrossRef]
- Zhao, Y.; Shen, M.; Wu, L.; Yang, H.; Yao, Y.; Yang, Q.; Du, J.; Liu, L.; Li, Y.; Bai, Y. Stromal cells in the tumor microenvironment: Accomplices of tumor progression? Cell Death Dis. 2023, 14, 587. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Cheng, Y.; Wang, D.; Guan, H.; Chen, D.; Zeng, J.; Lu, D.; Li, Y.; Yang, Y.; Luo, Q.; et al. Tissue-specific populations from amniotic fluid-derived mesenchymal stem cells manifest variant in vitro and in vivo properties. Hum. Cell 2024, 37, 408–419. [Google Scholar] [CrossRef]
- Casciaro, F.; Beretti, F.; Gatti, M.; Persico, G.; Bertucci, E.; Giorgio, M.; Maraldi, T. Effect of the Enrichment in c-Kit Stem Cell Potential of Foetal Human Amniotic Fluid Cells: Characterization from Single Cell Analysis to the Secretome Content. Biomedicines 2023, 11, 430. [Google Scholar] [CrossRef]
- Moraes, D. What the relationship between CD90 e CD44 in Mesenchymal Stem Cells? Cytotherapy 2018, 20, S47. [Google Scholar] [CrossRef]
- Beretti, F.; Zavatti, M.; Casciaro, F.; Comitini, G.; Franchi, F.; Barbieri, V.; La Sala, G.B.; Maraldi, T. Amniotic fluid stem cell exosomes: Therapeutic perspective. BioFactors 2018, 44, 158–167. [Google Scholar] [CrossRef]
- Senesi, G.; Guerricchio, L.; Ghelardoni, M.; Bertola, N.; Rebellato, S.; Grinovero, N.; Bartolucci, M.; Costa, A.; Raimondi, A.; Grange, C.; et al. Extracellular vesicles from II trimester human amniotic fluid as paracrine conveyors counteracting oxidative stress. Redox Biol. 2024, 75, 103241. [Google Scholar] [CrossRef]
- Lange, T.; Stracke, S.; Rettig, R.; Lendeckel, U.; Kuhn, J.; Schlüter, R.; Rippe, V.; Endlich, K.; Endlich, N. Identification of miR-16 as an endogenous reference gene for the normalization of urinary exosomal miRNA expression data from CKD patients. PLoS ONE 2017, 12, e0183435. [Google Scholar] [CrossRef]
- Guo, S.; Guo, W.; Li, S.; Dai, W.; Zhang, N.; Zhao, T.; Wang, H.; Ma, J.; Yi, X.; Ge, R.; et al. Serum miR-16: A Potential Biomarker for Predicting Melanoma Prognosis. J. Investig. Dermatol. 2016, 136, 985–993. [Google Scholar] [CrossRef]
- Saad, M.N.; Hamed, M. Transcriptome-Wide Association Study Reveals New Molecular Interactions Associated with Melanoma Pathogenesis. Cancers 2024, 16, 2517. [Google Scholar] [CrossRef]
- Du, L.; Tao, X.; Shen, X. Human umbilical cord mesenchymal stem cell-derived exosomes inhibit migration and invasion of breast cancer cells via miR-21-5p/ZNF367 pathway. Breast Cancer 2021, 28, 829–837. [Google Scholar] [CrossRef]
- Jahangiri, B.; Khalaj-Kondori, M.; Asadollahi, E.; Kian Saei, A.; Sadeghizadeh, M. Dual impacts of mesenchymal stem cell-derived exosomes on cancer cells: Unravelling complex interactions. J. Cell Commun. Signal. 2023, 17, 1229–1247. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Fang, Y.; Li, L.; Luo, H.; Cao, T.; Tu, B. Exosomal miR-22-3p from Mesenchymal Stem Cells Inhibits the Epithelial-Mesenchymal Transition (EMT) of Melanoma Cells by Regulating LGALS1. Front. Biosci. (Landmark Ed.) 2022, 27, 275. [Google Scholar] [CrossRef]
- Deng, J.; Li, Y.; Song, J.; Zhu, F. Regulation of the TUG1/miR-145-5p/SOX2 axis on the migratory and invasive capabilities of melanoma cells. Exp. Ther. Med. 2022, 24, 599. [Google Scholar] [CrossRef] [PubMed]
- Tan, L.; Liu, L.; Yao, J.; Piao, C. miR-145-5p attenuates inflammatory response and apoptosis in myocardial ischemia-reperfusion injury by inhibiting (NADPH) oxidase homolog 1. Exp. Anim. 2021, 70, 311–321. [Google Scholar] [CrossRef] [PubMed]
- Banzhaf-Strathmann, J.; Edbauer, D. Good guy or bad guy: The opposing roles of microRNA 125b in cancer. Cell Commun. Signal. 2014, 12, 30. [Google Scholar] [CrossRef]
- Michniewicz, A.G.; Czyz, M. Role of miRNAs in Melanoma Metastasis. Cancers 2019, 11, 326. [Google Scholar] [CrossRef]
- Liang, Y.; Xu, J.; Wang, Y.; Tang, J.Y.; Yang, S.L.; Xiang, H.G.; Wu, S.X.; Li, X.J. Inhibition of MiRNA-125b Decreases Cerebral Ischemia/Reperfusion Injury by Targeting CK2α/NADPH Oxidase Signaling. Cell. Physiol. Biochem. 2018, 45, 1818–1826. [Google Scholar] [CrossRef] [PubMed]
- Alderman, C.; Sehlaoui, A.; Xiao, Z.; Yang, Y. MicroRNA-15a inhibits the growth and invasiveness of malignant melanoma and directly targets on CDCA4 gene. Tumour Biol. 2016, 37, 13941–13950. [Google Scholar] [CrossRef]
- Xiong, Y.; Chen, L.; Yu, T.; Yan, C.; Zhou, W.; Cao, F.; You, X.; Zhang, Y.; Sun, Y.; Liu, J.; et al. Inhibition of circulating exosomal microRNA-15a-3p accelerates diabetic wound repair. Aging 2020, 12, 8968–8986. [Google Scholar] [CrossRef]
- Pang, J.M.; Chien, P.C.; Kao, M.C.; Chiu, P.Y.; Chen, P.X.; Hsu, Y.L.; Liu, C.; Liang, X.; Lin, K.T. MicroRNA-708 emerges as a potential candidate to target undruggable NRAS. PLoS ONE 2023, 18, e0284744. [Google Scholar] [CrossRef]
- Zhang, W.; Cui, S.Y.; Yi, H.; Zhu, X.H.; Liu, W.; Xu, Y.J. MiR-708 inhibits MC3T3-E1 cells against H2O2-induced apoptosis through targeting PTEN. J. Orthop. Surg. Res. 2020, 15, 255. [Google Scholar] [CrossRef]
- Dong, L.; Tian, X.; Zhao, Y.; Tu, H.; Wong, A.; Yang, Y. The Roles of MiRNAs (MicroRNAs) in Melanoma Immunotherapy. Int. J. Mol. Sci. 2022, 23, 14775. [Google Scholar] [CrossRef]
- Poniewierska-Baran, A.; Słuczanowska-Głąbowska, S.; Małkowska, P.; Sierawska, O.; Zadroga, Ł.; Pawlik, A.; Niedźwiedzka-Rystwej, P. Role of miRNA in Melanoma Development and Progression. Int. J. Mol. Sci. 2022, 24, 201. [Google Scholar] [CrossRef] [PubMed]
- Wan, R.J.; Li, Y.H. MicroRNA-146a/NAPDH oxidase4 decreases reactive oxygen species generation and inflammation in a diabetic nephropathy model. Mol. Med. Rep. 2018, 17, 4759–4766. [Google Scholar] [CrossRef] [PubMed]
- Kushwaha, P.P.; Gupta, S.; Singh, A.K.; Prajapati, K.S.; Shuaib, M.; Kumar, S. MicroRNA Targeting Nicotinamide Adenine Dinucleotide Phosphate Oxidases in Cancer. Antioxid. Redox Signal. 2020, 32, 267–284. [Google Scholar] [CrossRef] [PubMed]
- De Tomi, E.; Campagnari, R.; Orlandi, E.; Cardile, A.; Zanrè, V.; Menegazzi, M.; Gomez-Lira, M.; Gotte, G. Upregulation of miR-34a-5p, miR-20a-3p and miR-29a-3p by Onconase in A375 Melanoma Cells Correlates with the Downregulation of Specific Onco-Proteins. Int. J. Mol. Sci. 2022, 23, 1647. [Google Scholar] [CrossRef] [PubMed]
- Qi, J.; Wang, W.; Chen, W.; Lu, W.; Shang, A. Mechanism of miR-137 regulating migration and invasion of melanoma cells by targeting PIK3R3 gene. J. Cell. Biochem. 2019, 120, 8393–8400. [Google Scholar] [CrossRef]
- Becker, A.L.; Indra, A.K. Oxidative Stress in Melanoma: Beneficial Antioxidant and Pro-Oxidant Therapeutic Strategies. Cancers 2023, 15, 3038. [Google Scholar] [CrossRef]
- Lim, S.Y.; Menzies, A.M.; Rizos, H. Mechanisms and strategies to overcome resistance to molecularly targeted therapy for melanoma. Cancer 2017, 123, 2118–2129. [Google Scholar] [CrossRef]
- Zavatti, M.; Beretti, F.; Casciaro, F.; Comitini, G.; Franchi, F.; Barbieri, V.; Bertoni, L.; De Pol, A.; La Sala, G.B.; Maraldi, T. Development of a novel method for amniotic fluid stem cell storage. Cytotherapy 2017, 19, 1002–1012. [Google Scholar] [CrossRef]
- Casciaro, F.; Beretti, F.; Zavatti, M.; McCubrey, J.A.; Ratti, S.; Marmiroli, S.; Follo, M.Y.; Maraldi, T. Nuclear Nox4 interaction with prelamin A is associated with nuclear redox control of stem cell aging. Aging 2018, 10, 2911–2934. [Google Scholar] [CrossRef] [PubMed]
- Marrazzo, P.; Angeloni, C.; Freschi, M.; Lorenzini, A.; Prata, C.; Maraldi, T.; Hrelia, S. Combination of epigallocatechin gallate and sulforaphane counteracts in vitro oxidative stress and delays stemness loss of amniotic fluid stem cells. Oxid. Med. Cell. Longev. 2018, 2018, 5263985. [Google Scholar] [CrossRef] [PubMed]
- Casciaro, F.; Zia, S.; Forcato, M.; Zavatti, M.; Beretti, F.; Bertucci, E.; Zattoni, A.; Reschiglian, P.; Alviano, F.; Bonsi, L.; et al. Unravelling Heterogeneity of Amplified Human Amniotic Fluid Stem Cells Sub-Populations. Cells 2021, 10, 158. [Google Scholar] [CrossRef] [PubMed]
- Zavatti, M.; Gatti, M.; Beretti, F.; Palumbo, C.; Maraldi, T. Exosomes Derived from Human Amniotic Fluid Mesenchymal Stem Cells Preserve Microglia and Neuron Cells from Aβ. Int. J. Mol. Sci. 2022, 23, 4967. [Google Scholar] [CrossRef]
- Marassi, V.; La Rocca, G.; Placci, A.; Muntiu, A.; Vincenzoni, F.; Vitali, A.; Desiderio, C.; Maraldi, T.; Beretti, F.; Russo, E.; et al. Native characterization and QC profiling of human amniotic mesenchymal stromal cell vesicular fractions for secretome-based therapy. Talanta 2024, 276, 126216. [Google Scholar] [CrossRef]
- Ravegnini, G.; Nannini, M.; Indio, V.; Serrano, C.; Gorini, F.; Astolfi, A.; Di Vito, A.; Morroni, F.; Pantaleo, M.A.; Hrelia, P.; et al. miRNA Expression May Have Implications for Immunotherapy in PDGFRA Mutant GISTs. Int. J. Mol. Sci. 2022, 23, 12248. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gatti, M.; Beretti, F.; Ravegnini, G.; Gorini, F.; Ceneri, E.; Bertucci, E.; Follo, M.Y.; Maraldi, T. Evaluation of the Anti-Cancer Potential of Extracellular Vesicles Derived from Human Amniotic Fluid Stem Cells: Focus on Effective miRNAs in the Treatment of Melanoma Progression. Int. J. Mol. Sci. 2024, 25, 12502. https://doi.org/10.3390/ijms252312502
Gatti M, Beretti F, Ravegnini G, Gorini F, Ceneri E, Bertucci E, Follo MY, Maraldi T. Evaluation of the Anti-Cancer Potential of Extracellular Vesicles Derived from Human Amniotic Fluid Stem Cells: Focus on Effective miRNAs in the Treatment of Melanoma Progression. International Journal of Molecular Sciences. 2024; 25(23):12502. https://doi.org/10.3390/ijms252312502
Chicago/Turabian StyleGatti, Martina, Francesca Beretti, Gloria Ravegnini, Francesca Gorini, Eleonora Ceneri, Emma Bertucci, Matilde Y. Follo, and Tullia Maraldi. 2024. "Evaluation of the Anti-Cancer Potential of Extracellular Vesicles Derived from Human Amniotic Fluid Stem Cells: Focus on Effective miRNAs in the Treatment of Melanoma Progression" International Journal of Molecular Sciences 25, no. 23: 12502. https://doi.org/10.3390/ijms252312502
APA StyleGatti, M., Beretti, F., Ravegnini, G., Gorini, F., Ceneri, E., Bertucci, E., Follo, M. Y., & Maraldi, T. (2024). Evaluation of the Anti-Cancer Potential of Extracellular Vesicles Derived from Human Amniotic Fluid Stem Cells: Focus on Effective miRNAs in the Treatment of Melanoma Progression. International Journal of Molecular Sciences, 25(23), 12502. https://doi.org/10.3390/ijms252312502