Epigenomic Alterations of the Human CYP11B Gene in Adrenal Zonation
Abstract
1. Introduction
2. Results
2.1. The CpG Methylation Status of the CYP11B2 Promoter Region in Zones of the Human Adrenal Cortex
2.2. CpG Methylation Status of the CYP11B1 Promoter Region in Zones of Human Adrenal Cortex
2.3. CpG Methylation Status and Expression of the CYP11B2 Gene in the Human Adrenal Medulla, Pheochromocytomas, and Non-Functioning Adenomas
3. Discussion
4. Materials and Methods
4.1. Human Tissue Collection
4.2. Laser Capture Microdissection
4.3. DNA Methylation Assay
4.4. Real-Time Reverse Transcriptase PCR
4.5. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Augsburger, P.; Liimatta, J.; Flück, C.E. Update on adrenarche-still a mystery. J. Clin. Endocrinol. Metab. 2024, 109, 1403–1422. [Google Scholar] [CrossRef] [PubMed]
- Warde, K.M.; Smith, L.J.; Basham, K.J. Age-related Changes in the Adrenal Cortex: Insights and Implications. J. Endocr. Soc. 2023, 7, bvad097. [Google Scholar] [CrossRef]
- Takeda, Y.; Demura, M.; Wang, F.; Karashima, S.; Yoneda, T.; Kometani, M.; Aomo, D.; Hashimoto, A.; Horike, S.; Meguro-Horike, M.; et al. Effect of potassium on DNA methylation of aldosterone synthase gene. J. Hypertens. 2021, 39, 1018–1024. [Google Scholar] [CrossRef] [PubMed]
- Verma, S.; Pandey, A.; Pandey, A.K.; Butler, J.; Lee, J.S.; Teoh, H.; Mazer, C.D.; Kosiborod, M.N.; Cosentino, F.; Anker, S.D.; et al. Aldosterone and aldosterone synthase inhibitors in cardiorenal disease. Am. J. Physiol. Circ. Physiol. 2024, 326, H670–H688. [Google Scholar] [CrossRef] [PubMed]
- Kometani, M.; Demura, M.; Koide, H.; Nishimoto, K.; Mukai, K.; Gomez-Sanchez, C.E.; Akagi, T.; Yokota, T.; Horike, S.-I.; Karashima, S.; et al. Cortisol overproduction results from DNA methylation of CYP11B1 in hypercortisolemia. Sci. Rep. 2017, 7, 11205. [Google Scholar] [CrossRef]
- Prete, A.; Bancos, I. Mild autonomous cortisol secretion: Pathophysiology, comorbidities and management approaches. Nat. Rev. Endocrinol. 2024, 20, 460–473. [Google Scholar] [CrossRef]
- Nishimoto, M.; Griffin, K.A.; Wynne, B.M.; Fujita, T. Salt-Sensitive Hypertension and the Kidney. Hypertension 2024, 81, 1206–1217. [Google Scholar] [CrossRef]
- Preissl, S.; Gaulton, K.J.; Ren, B. Characterizing cis-regulatory elements using single-cell epigenomics. Nat. Rev. Genet. 2022, 24, 21–43. [Google Scholar] [CrossRef]
- Howard, B.; Wang, Y.; Xekouki, P.; Faucz, F.R.; Jain, M.; Zhang, L.; Meltzer, P.G.; Stratakis, C.A.; Kebebew, E. Integrated analysis of genome-wide methylation and gene expression shows epigenetic regulation of CYP11B2 in aldosteronomas. J. Clin. Endocrinol. Metab. 2014, 99, E536–E543. [Google Scholar] [CrossRef]
- Takeda, Y.; Demura, M.; Wang, F.; Karashima, S.; Yoneda, T.; Kometani, M.; Hashimoto, A.; Aono, D.; Horike, S.; Meguro-Horike, M.; et al. Epigenetic Regulation of Aldosterone Synthase Gene by Sodium and Angiotensin II. J. Am. Heart Assoc. 2018, 7, e008281. [Google Scholar] [CrossRef]
- Baquedano, M.S.; Belgorosky, A. Human Adrenal Cortex: Epigenetics and Postnatal Functional Zonation. Horm. Res. Paediatr. 2018, 89, 331–340. [Google Scholar] [CrossRef] [PubMed]
- Martin-Grace, J.; Tomkins, M.; O’reilly, M.W.; Sherlock, M. Iatrogenic adrenal insufficiency in adults. Nat. Rev. Endocrinol. 2024, 20, 209–227. [Google Scholar] [CrossRef] [PubMed]
- Singh, H.; Kumar, R.; Mazumder, A.; Salahuddin; Mazumder, R.; Abdullah, M.M. Insights into interactions of human cytochrome P450 17A1: A review. Curr. Drug Metab. 2022, 23, 172–187. [Google Scholar] [CrossRef]
- Gomez-Sanchez, C.E.; Sapiro, D.R.; May, K.V.; Rainey, W.E.; Nishimoto, K.; Gomez-Sanchez, E.P. Origin of circulating 18-oxocortisol in the normal human adrenal. Mol. Cell. Endocrinol. 2022, 555, 111720. [Google Scholar] [CrossRef] [PubMed]
- Takeda, Y.; Kometani, M.; Cheng, Y.; Demura, M.; Ohe, M.; Karashima, S.; Hashimoto, A.; Yoneda, T.; Takeda, T. Aldosterone synthesis in the pheochromocytoma. In Proceedings of the 7th International Aldosterone Forum, Tokyo, Japan, 28 May 2014. [Google Scholar]
- Ugi, S.; Yonishi, M.; Sato, D.; Nakaizumi, N.; Horikawa, O.; Fujita, Y.; Inoue, K.; Wada, A.; Kageyama, S.; Kawauchi, A.; et al. Coexistence of Pheochromocytoma and Primary Aldosteronism due to Multiple Aldosterone-producing Micronodules in the Ipsilateral Adrenal Gland. Intern. Med. 2023, 62, 2685–2691. [Google Scholar] [CrossRef]
- Mai, X.; Kometani, M.; Kato, T.; Mori, S.; Aono, D.; Konishi, S.; Karashima, S.; Takeda, Y.; Yoneda, M.; Furukawa, K.; et al. PS-BPR01-2: Pheochromocytoma with hyperaldosteronism-linked mutations in the potassium channel kcnj5. J. Hypertens. 2023, 41, e345. [Google Scholar] [CrossRef]
- Lu, L.; Suzuki, T.; Yoshikawa, Y.; Murakami, O.; Miki, Y.; Moriya, T.; Bassett, M.H.; Rainey, W.E.; Hayashi, Y.; Sasano, H. Nur-Related Factor 1 and Nerve Growth Factor-Induced Clone B in Human Adrenal Cortex and Its Disorders. J. Clin. Endocrinol. Metab. 2004, 89, 4113–4118. [Google Scholar] [CrossRef]
- Tezuka, Y.; Atsumi, N.; Blinder, A.R.; Rege, J.; Giordano, T.J.; E Rainey, W.; Turcu, A.F. The Age-Dependent Changes of the Human Adrenal Cortical Zones Are Not Congruent. J. Clin. Endocrinol. Metab. 2021, 106, 1389–1397. [Google Scholar] [CrossRef]
- van de Wiel, E.; Chaman Baz, A.H.; Küsters, B.; Mukai, K.; van Bonzel, L.; van Erp, M.; Deinum, J.; Langenhuijsen, J. Changes of the CYP11B2 expressing zona glomerulosa in human adrenals from birth to 40 years of age. Hypertension 2022, 79, 2565–2572. [Google Scholar] [CrossRef]
- Bassett, M.H.; Mayhew, B.; Rehman, K.; White, P.C.; Mantero, F.; Arnaldi, G.; Stewart, P.M.; Bujalska, I.; Rainey, W.E. Expres-sion profiles for steroidogenic enzymes in adrenocortical disease. J. Clin. Endocrinol. Metab. 2005, 90, 5446–5455. [Google Scholar] [CrossRef]
- Vaduva, P.; Bonnet, F.; Bertherat, J. Molecular Basis of Primary Aldosteronism and Adrenal Cushing Syndrome. J. Endocr. Soc. 2020, 4, bvaa075. [Google Scholar] [CrossRef] [PubMed]
- Pereira, S.S.; Costa, M.M.; Gomez-Sanchez, C.E.; Monteiro, M.P.; Pignatelli, D. Incomplete Pattern of Steroidogenic Protein Expression in Functioning Adrenocortical Carcinomas. Biomedicines 2020, 8, 256. [Google Scholar] [CrossRef]
- Kubota-Nakayama, F.; Nakamura, Y.; Konosu-Fukaya, S.; Azmahani, A.; Ise, K.; Yamazaki, Y.; Kitawaki, Y.; Felizola, S.J.; Ono, Y.; Omata, K.; et al. Expression of steroidogenic enzymes and their transcription factors in cortisol-producing adrenocortical adenomas: Immunohistochemical analysis and quantitative real-time polymerase chain reaction studies. Hum. Pathol. 2016, 54, 165–173. [Google Scholar] [CrossRef] [PubMed]
- Duparc, C.; Camponova, P.; Roy, M.; Lefebvre, H.; Thomas, M. Ectopic localization of CYP11B1 and CYP11B2-expressing cells in the normal human adrenal gland. PLoS ONE 2022, 17, e0279682. [Google Scholar] [CrossRef]
- Zhai, Y.-S.; Li, J.; Peng, L.; Lu, G.; Gao, X. Phosphorylation of CaMK and CREB-Mediated Cardiac Aldosterone Synthesis Induced by Arginine Vasopressin in Rats with Myocardial Infarction. Int. J. Mol. Sci. 2022, 23, 15061. [Google Scholar] [CrossRef]
- Xu, C. Extra-adrenal aldosterone: A mini review focusing on the physiology and pathophysiology of intrarenal aldosterone. Endocrine 2023, 83, 285–301. [Google Scholar] [CrossRef] [PubMed]
- Briones, A.M.; Nguyen Dinh Cat, A.; Callera, G.E.; Yogi, A.; Burger, D.; He, Y.; Corrêa, J.W.; Gagnon, A.M.; Gomez-Sanchez, C.E.; Gomez-Sanchez, E.P.; et al. Adipocytes produce aldosterone through cal-cineurin-dependent signaling pathways: Implications in diabetes mellitus-associated obesity and vascular dysfunction. Hyper-Tens. 2012, 59, 1069–1078. [Google Scholar] [CrossRef] [PubMed]
- Ye, P.; Kenyon, C.J.; Mackenzie, S.M.; Nichol, K.; Seckl, J.R.; Fraser, R.; Connell, J.M.; Davies, E. Effects of ACTH, dexamethasone, and adrenalectomy on 11beta-hydroxylase (CYP11B1) and aldosterone synthase (CYP11B2) gene expression in the rat central nervous system. J. Endocrinol. 2008, 196, 305–311. [Google Scholar] [CrossRef]
- Mohamed, D.M.; Shaqura, M.; Li, X.; Shakibaei, M.; Beyer, A.; Treskatsch, S.; Schäfer, M.; Mousa, S.A. Aldosterone Synthase in Peripheral Sensory Neurons Contributes to Mechanical Hypersensitivity during Local Inflammation in Rats. Anesthesiology 2020, 132, 867–880. [Google Scholar] [CrossRef]
- Dehe, L.; Mousa, S.A.; Aboryag, N.; Shaqura, M.; Beyer, A.; Schäfer, M.; Treskatsch, S. Identification of Mineralocorticoid Receptors, Aldosterone, and Its Processing Enzyme CYP11B2 on Parasympathetic and Sympathetic Neurons in Rat Intracardiac Ganglia. Front. Neuroanat. 2022, 15, 802359. [Google Scholar] [CrossRef]
- Scholl, U.I. Genetics of Primary Aldosteronism. Hypertension 2022, 79, 887–897. [Google Scholar] [CrossRef] [PubMed]
- Hundemer, G.L.; Leung, A.A.; Kline, G.A.; Brown, J.M.; Turcu, A.F.; Vaidya, A. Biomarkers to guide medical therapy in primary aldosteronism. Endocr. Rev. 2024, 45, 69–94. [Google Scholar] [CrossRef] [PubMed]
- Oki, K.; Gomez-Sanches, C.E. The landscape of molecular mechanism for aldosterone production in aldosterone-producing adenoma. Endocr. J. 2020, 67, 989–995. [Google Scholar] [CrossRef] [PubMed]
- Lenders, J.W.; Duh, Q.Y.; Eisenhofer, G.; Gimenez-Roqueplo, A.P.; Grebe, S.K.; Murad, M.H.; Naruse, M.; Pacak, K.; Young, W.F., Jr. Pheochromocytoma and paraganglioma: An endocrine society clinical practice guideline. J. Clin. Endo-Crinol. Metab. 2014, 99, 1915–1942. [Google Scholar] [CrossRef]
- Sasano, H.; Mason, J.; Sasano, N. Immunohistochemical study of cytochrome P-45017α in human adrenocortical disorders. Hum. Pathol. 1989, 20, 113–117. [Google Scholar] [CrossRef]
Pyrosequence | |
---|---|
Primer | Sequence (5′ to 3′) |
CYP11B1 Pyro-F 1-2 | TTGTAATTTTTTTATTTTGTTTGGTGTTT |
CYP11B1 Pyro-R 1-2 | ATACACCCCCAATAAATCCCTAC |
CYP11B1 Pyro-S1 | TGTTTGGTGTTTTGTTTT |
CYP11B1 Pyro-S2 | TGGTTTTGGATTTGTTTGAG |
CYP11B1 Pyro-F3 | AGGTTAGGGTTGGAGGTAGG |
CYP11B1 Pyro-R3 | AACCCCATCCATCTTACTCCTC |
CYP11B1 Pyro-S3 | ATTGGGGGTGTATGA |
CYP11B1 Pyro-F4 | GGATGGGGTTTTTATTTTATTTAAGAGT |
CYP11B1 Pyro-R4 | CCCAATAATCATTCAAAAACAAATTACTCA |
CYP11B1 Pyro-S4 | ATTTATTTTTTTGTAAGGTTTATA |
CYPB2 Pyro-F1 | TTTTATTTAGGAATTTGTTTTGGAAATATA |
CYPB2 Pyro-R1 | AAACACCTAACTTCTCCTTCATCTAC |
CYPB2 Pyro-S1 | AGGAATTTGTTTTGGAAATATATTA |
CYPB2 Pyro-F2 | ATTGGTTTTGGATTTGTTTGAGATT |
CYPB2 Pyro-S2 | GGATTTGTTTGAGATTTTTAGA |
CYPB2 Pyro-F3 | GTTGGAGGTTTTTAGTTAAAGGTAGAT |
CYPB2 Pyro-R2 | TTCCACCAACATAAACCCCCAAT |
CYPB2 PyroS3 | GTTTGAGGATGTTGAGA |
Bisulfite sequencing | |
Human CYP11B2F1 | GAAAGGAGAGGTTAGGTTTTATTATTTT |
Human CYP11B2R1 | ACCCTTTACAAAAACAACCAAAA |
Human CYP11B2F2 | GAAAGGAGAGGTTAGGTTTTATTATTTT |
Human CYP11B2R2 | ACCCTTTACAAAAACAACCAAAA |
Real-time reverse transcriptase PCR | |
GAPDH (F) | TCATTGACCTCAACTACATGGTTT |
GAPDH (R) | TTGATTTTGGAGGGATCTCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Takeda, Y.; Demura, M.; Yoneda, T.; Karashima, S.; Kometani, M.; Aono, D.; Konishi, S.; Horike, S.-i.; Nakamura, Y.; Yamazaki, Y.; et al. Epigenomic Alterations of the Human CYP11B Gene in Adrenal Zonation. Int. J. Mol. Sci. 2024, 25, 11956. https://doi.org/10.3390/ijms252211956
Takeda Y, Demura M, Yoneda T, Karashima S, Kometani M, Aono D, Konishi S, Horike S-i, Nakamura Y, Yamazaki Y, et al. Epigenomic Alterations of the Human CYP11B Gene in Adrenal Zonation. International Journal of Molecular Sciences. 2024; 25(22):11956. https://doi.org/10.3390/ijms252211956
Chicago/Turabian StyleTakeda, Yoshimichi, Masashi Demura, Takashi Yoneda, Shigehiro Karashima, Mitsuhiro Kometani, Daisuke Aono, Seigo Konishi, Shin-ichi Horike, Yasuhiro Nakamura, Yuto Yamazaki, and et al. 2024. "Epigenomic Alterations of the Human CYP11B Gene in Adrenal Zonation" International Journal of Molecular Sciences 25, no. 22: 11956. https://doi.org/10.3390/ijms252211956
APA StyleTakeda, Y., Demura, M., Yoneda, T., Karashima, S., Kometani, M., Aono, D., Konishi, S., Horike, S.-i., Nakamura, Y., Yamazaki, Y., Sasano, H., & Takeda, Y. (2024). Epigenomic Alterations of the Human CYP11B Gene in Adrenal Zonation. International Journal of Molecular Sciences, 25(22), 11956. https://doi.org/10.3390/ijms252211956