1. Introduction
Oral squamous cell carcinoma (OSCC), commonly referred to as oral cancer (OC), can be a life-threatening disease and is one of the major types of head and neck squamous cell carcinoma (HNSCC) [
1]. The diagnosis usually occurs over the age of 50 years, and the standard treatment is surgery, radiotherapy, chemotherapy, and/or immunotherapy [
1]. Unfortunately, the reported 5-year overall survival (OS) rate is lower than 60% [
2]. Consequently, the main reason for treatment failure is locoregional recurrence, which is possibly associated with our limited molecular understanding of OC tumorigenesis. Furthermore, the surviving patients often suffer from severe treatment-related side effects [
3]. Recently, new insights into the influence of the tumor immune response on OC aggressiveness have been reported [
4]. Nevertheless, the main targets of these cross-talks between cancer cells and tumor immune microenvironments remain undiscovered.
To address this knowledge gap, we highlighted the Sigma-1 receptor (SIGMAR1), encoded by the
SIGMAR1 gene (9p13.3). Notably, SIGMAR1 plays multifaceted roles in both physiological and pathological conditions [
5]. Under normal physiological conditions, SIGMAR1 is involved in cellular processes, such as the modulation of ion channels, regulation of calcium signaling, and maintenance of cellular homeostasis. It is known for its neuroprotective functions, including the enhancement of neuroplasticity, attenuation of neuroinflammation, and protection against oxidative stress [
6]. Pathologically, the dysregulation of SIGMAR1 has been implicated in various neurodegenerative diseases, such as Alzheimer’s and Parkinson’s disease, where its malfunction can exacerbate neuronal damage and cognitive deficits. On the other hand, it was also reported that SIGMAR1 protein also plays an intriguing role in the immunomodulatory process (immunity and inflammation) and cancer progression [
5,
6].
In the context of tumorigenesis and cancer progression, SIGMAR1 has garnered attention due to its potential involvement in cancer biology. Recent studies have highlighted its functions in different types of cancers, indicating that SIGMAR1 might influence cancer cell survival, proliferation, and metastasis [
5]. For instance, in breast cancer, SIGMAR1 has been shown to promote cell proliferation and survival, while in prostate cancer, its expression correlates with increased tumor growth and resistance to apoptosis [
5]. Additionally, evidence suggests that SIGMAR1 may modulate the tumor microenvironment, influencing factors such as angiogenesis and immune evasion [
5,
6].
Recently, it was also demonstrated that
SIGMAR1 modulates the programmed death-ligand 1 (
PD-L1) expression by autophagy [
7]. Notably,
PD-L1 is a critical immune checkpoint protein that binds to programmed death 1 (PD-1) on T cells, leading to tumor immune escape and, consequently, increased immunosuppression, cancer aggressiveness, and drug resistance [
8]. Curiously, in the last decade the potential function of
SIGMAR1 in cancer has gained increasing interest as a potential new biomarker, as previously demonstrated in breast cancer [
9], colorectal cancer [
10], and prostate cancer [
11]. Nevertheless, the impact of SIGMAR1 on oral cancer is largely unknown.
In our study, we observed that SIGMAR1 overexpression was linked to unfavorable survival rates and was positively correlated with PD-L1 overexpression in human oral cancer samples. Importantly, the inhibition of SIGMAR1 led to a reduction in PD-L1 abundance at both the total protein and surface expression levels. Consequently, this inhibition decreased chemoresistance to cisplatin and promoted apoptosis in human OC cells. Overall, our study provides valuable insights into the role of SIGMAR1 in oral cancer pathogenesis and suggests that SIGMAR1-targeted interventions could represent a promising avenue for future clinical trials and therapeutic development in the field of oral cancer treatment.
3. Discussion
In this study, we aimed to investigate the impact of
SIGMAR1 knockdown in OC cells.
SIGMAR1 is acknowledged as a ubiquitously expressed multifunctional inter-organelle signaling chaperone protein, which plays diverse roles in cellular survival [
5]. Notably, any deregulation of
SIGMAR1 expression is associated with tissue instability and can lead to tumorigenesis [
6,
12]. To our surprise, the role of
SIGMAR1 in oral cancer (OC) biology has not been explored to date. Here, we identified
SIGMAR1 overexpressed in our cohort of human OC samples. The overexpression of
SIGMAR1 has also been demonstrated in breast cancer and colorectal cancer [
9,
10,
13,
14]; this is consistent with our results. Notably, the overexpression of this gene was also associated with poor survival rates for patients.
Previously, it was demonstrated that
SIGMAR1 receptors are involved in the immunomodulatory process (immunity and inflammation) and cancer progression [
6]. In fact, cancer development is also due to several alterations, including escape from immunosurveillance [
15]. In this regard, we hypothesize that
SIGMAR1 may play significant roles in tumor-mediated immune escape, which is a crucial strategy for tumor survival, by inducing
PD-L1 expression. Beyond that, the high expression of
PD-L1 in tumor cells contributes to tumor immune evasion, drug resistance [
16], and poor survival rates in oral cancer [
17]. Additionally, elucidating these cross-talks between
SIGMAR1 and the tumor cellular microenvironment could significantly accelerate the identification of novel immunological biomarkers for oral cancer treatment.
Firstly, we observed that
SIGMAR1 mRNA expression was positively correlated with the high expression levels of
PD-L1. Conversely, our results also suggest that
SIGMAR1 is a positive regulator of
PD-L1 expression in human OC because the
SIGMAR1 silencing decreases the abundance of
PD-L1, at both the total protein and surface expression levels in vitro. Although few studies in the literature demonstrate other mechanisms by which
SIGMAR1 can modulate
PD-L1 expression,
SIGMAR1 may influence
PD-L1 expression indirectly through cross-talk with immune cells in the tumor microenvironment, such as tumor-associated macrophages or T cells, which can secrete cytokines or other factors that regulate
PD-L1 expression in cancer cells. On the other hand, our data were consistent with those of a previous study which revealed that the
SIGMAR1 inhibitor decreased cell surface
PD-L1 expression and suppressed the functional interaction of
PD-1 and
PD-L1 in a coculture of T cells and breast and prostate cancer cells [
7].
In this regard, we suggest that the overexpression of
SIGMAR1 is probably a key contributor to chemoresistance and, consequently, tumor cell survival, due the fact that we also observed that the knockdown of
SIGMAR1 decreased chemoresistance to cisplatin and increased apoptosis in human OC cells. Interestingly, our results were consistent with those of an earlier study that also observed that
SIGMAR1 silencing increased the sorafenib sensitivity of hepatocellular carcinoma cells in vitro and in vivo [
18]. Notably, our study has two significant limitations: it does not investigate the potential impact of
SIGMAR1 on the sensitivity or resistance to other commonly used oral cancer treatments, and the small number of analyzed samples in our validation study may affect the generalizability of our findings. Future studies should focus on this aspect to better understand the broader implications of
SIGMAR1 expression and functionality in therapeutic contexts beyond the scope of our current research. In this connection, further research is needed to elucidate the specific molecular mechanisms by which
SIGMAR1 modulates
PD-L1 expression and its implications for oral cancer progression and immunotherapy response.
Beyond suggesting potential immunomodulatory roles for SIGMAR1 in oral cancer, which are reflective of its poorer prognosis, our study provides novel evidence indicating that SIGMAR1 acts as a positive regulator of PD-L1 expression, thereby exacerbating chemoresistance in human oral cancer. However, future studies should prioritize elucidating the molecular mechanisms and consequences of SIGMAR1 silencing on PD-L1 modulation in vivo. Such efforts are crucial for facilitating the development of potential SIGMAR1-targeted interventions, which could be integral for future immunotherapy trials. By transitioning from laboratory discoveries to clinical application, these interventions hold promise as they may directly benefit patients at the bedside.
4. Materials and Methods
4.1. Sample and Biological Specimens
This study comprised 26 fresh-frozen samples from patients (38–90 years old) diagnosed with OC and their corresponding surgical margins obtained from surgery between 2017 and 2019 at the Instituto do Cancer do Estado de São Paulo (ICESP), Hospital das Clínicas, University of São Paulo Medical School (HCFMUSP), Brazil. This study was approved by the Human Research Ethics Committee of FCFRP-USP and ICESP/HCFMUSP (CEP/FCFRP; CAAE: 90532418.6.0000.5403, ICESP/HCFMUSP CAAE: 90532418.6.3002.0065), and informed consent was obtained from all the patients included. The baseline patient characteristics of the discovery cohort are summarized in
Supplementary Table S1. Unfortunately, socio-demographic data were not obtained for the duration of the current study.
4.2. Data Source Availability
From the R2: Genomics Analysis and Visualization Platform (
http://r2.amc.nl), we downloaded the
SIGMAR1 expression values of the 502 oral cancer tissues and 44 adjacent non-tumor tissues (TCGA data, accessed on 10 January 2024). The raw data used in the study for the analyses of TCGA samples are displayed in
Supplementary Table S2.
4.3. Cell Lines and Culture Conditions
The OC cell lines (HN12 and SCC9), Human Embryonic Kidney 293T cells (HEK293T), and human oral keratinocytes (derived from non-tumor tissue) spontaneously immortalized (NOK-SI) were used. All the cells were maintained in DMEM/F12 medium (Gibco™, Thermo Fisher®, Carlsbad, CA, USA), supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin and kept in a humid atmosphere containing 5% CO2 at 37 °C.
4.4. Lentivirus-Mediated Short Hairpin RNA (shRNA) Knockdown of Gene Expression
Silencing of SIGMAR1 was performed using the shRNA vector TRCN0000291305, NM_005866. Target Sequence: GACTTCCTCACCCTCTTCTAT, and their respective control Scramble_shRNA—Target Sequence: CCTAAGGTTAAGTCGCCCTCG. Both were acquired from Sigma-Aldrich (St. Louis, MO, USA) and contained a gene for puromycin resistance. Plasmids were expanded in LB medium supplemented with 100 μg/mL of ampicillin and purified using the QIAprep Spin Miniprep Kit protocol (Qiagen Company, Hilden, Germany, #Cat. 27,104), following the manufacturer’s instructions. To analyze the yield and purity of the plasmids, the NanoDrop Spectrophotometer device (Thermo Scientific, Waltham, MA, USA) was used. Lentiviral particles were produced by co-transfection of the trans-lentiviral packaging mix with an shRNA transfer vector into HEK 293T packaging cells (OpenBiosystems, Huntsville, AL, USA). For cell infection, viral supernatants were supplemented with 6 μg/mL polybrene and incubated with the cells for 24 h. Then, the transduced cells were selected with puromycin (0.5 μg/mL) for 5 days.
4.5. RNA Extraction, cDNA Synthesis, and Quantitative Real-Time PCR (qRT-PCR)
Total RNA was extracted from an in-house cohort of 26 OC tissues and their corresponding surgical margins, using the AllPrep DNA/RNA/Protein Mini kit (QIAGEN, Hilden, Germany), following the manufacturer’s specifications. RNA concentrations were determined using an ND-1000 spectrophotometer device (NanoDrop 1000 Technologies, Wilmington, DE, USA). The reverse transcription reaction for the synthesis of complementary DNA strands (cDNA) was performed using 100 ng of total RNA and the High-Capacity kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. Relative mRNA expression levels were measured by quantitative PCR using the GoTaq
® qPCR Master Mix (Promega) kit. The reactions were performed on RealPlex4 (Eppendorf), using the internal control:
GAPDH. The data were analyzed using the 2
−ΔΔCT method [
19]. The experiments were carried out in triplicate. The primer sequences used in this study, along with their respective thermal cycling conditions, are detailed in
Table 1. This table provides an easy reference for all the primers and their specific conditions used during the experiments.
4.6. Western Blot
The cells lines were lysed on ice in lysis buffer containing freshly added protease inhibitor cocktail (Roche Diagnostics, Branchburg, NJ, USA). Protein extracts (30 μg) were size-fractionated by SDS-PAGE, and the proteins were immunoblotted with anti-SIGMAR1 (dilution 1:1000, cat. no. #HPA018002, Cell Signaling Technology, Danvers, MA, USA) and anti-PDL1 (dilution 1:1000, cat. no. #13684S, Cell Signaling). Posteriorly, they were normalized with anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin. All the antibodies were diluted according to the manufacturer’s instructions, and HRP-conjugated goat anti-rabbit (Santa Cruz Biotechnology, Santa Cruz, CA, USA) was used as a secondary antibody. The results were visualized using an enhanced chemiluminescence detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA), and the relative quantification of the protein level was determined using ImageJ® software (National Institutes of Health, Bethesda, MD, USA). The experiments were carried out in triplicate.
4.7. Confocal Microscopy
The cells were seeded on glass coverslips in 24-well plates and fixed with cold methanol for 10 min. In addition, phosphate-buffered saline buffer containing 0.5% (v/v) Triton X-100 and 3% (w/v) bovine serum albumin (BSA) was used for blocking for 30 min. The primary antibodies for PD-L1 (#13684S, Cell signaling) were incubated overnight at 4 °C. After incubation with secondary antibody conjugated to AlexaFluor R 488 (dilution 1:1000, #1028736, Invitrogen, Waltham, MA, USA) or DyLight R 650 (dilution 1:1000, #SA-510089, Thermo Scientific, Waltham, MA, USA) for 1 h, the cells were stained with DAPI (D9542, Sigma-Aldrich, St. Louis, MO, USA). A Leica TCS SP8 confocal microscope (Leica Microsystems, Wetzlar, Germany) was used to obtain the images using the 63× objective. Five random fields were captured and ImageJ® software (National Institutes of Health) was used to quantify fluorescence intensity.
4.8. Flow Cytometry
A total of 200.000 cells/well were fixed in 4% paraformaldehyde diluted in PBS and permeabilized in PBS containing 1% fetal bovine serum (FBS), 0.2% saponin, and 0.1% sodium azide. The monoclonal antibody PD-L1 (#13684S, Cell signaling) was added, and the cells were incubated for 20 min at 4 °C. After the staining, the cells were washed and fixed in 1% paraformaldehyde diluted in phosphate buffer saline (PBS) and further analyzed in Guava easyCyte 8HT. The data were visualized in t-Distributed Stochastic Neighbor Embedding (t-SNE) density plots generated in FCS express 6 (De Novo software, version 7.18.0015, Pasadena, CA, USA). The experiments were carried out in triplicate.
4.9. Cell Viability Assay
Viable cells were quantified using the reagent Alamar Blue (ThermoFisher Scientific, Rockford, IL, USA) according to the manufacturer’s instructions. Briefly, 6 × 103 cells were plated in 96-well plates. The cells were treated with cisplatin at different concentrations (5 µM, 10 µM, 15 µM, 20 µM, and 30 µM) for 72 h, and the results were obtained through the SpectraMax® L Microplate Reader device. Each condition was made in quadruplicate, and the absorbance of 540 and 630 nm was measured using the Epoch 2 Microplate Spectrophotometer (BioTek Instruments Inc., Winooski, VT, USA). The results were determined by the mean of three independent tests. Furthermore, the concentration of cisplatin that inhibited 50% of cell viability (IC50) was determined using the CalcuSyn Software, version 2.0 (Biosoft, Cambridge, UK).
4.10. Apoptosis Detection
In total, 17.5 × 104 cells were plated and treated for 72 h with cisplatin at a dose of 14.57 µM to HN12 cells. The detection of cell death was performed by labeling apoptotic cells with Annexin V (APC) (BD Biosciences Pharmingen, San Jose, CA, USA) and propidium iodide (PI). The cells were trypsinized and centrifuged at 1200× g for 5 min at 4 °C, washed with ice-cold PBS 1×, and then resuspended in 200 µL of 1× binding buffer (BD Biosciences Pharmingen, San Jose, CA, USA) with 5 µL of annexin-V and 50 µL of a solution of PI (50 μM) and incubated for 15 min, protected from light, at room temperature. The cells were analyzed by BD FACSCalibur TM flow cytometer (BD Biosciences, San Jose, CA, USA). The results were shown as the mean from each condition analyzed in triplicate. The data were analyzed using FlowJo 8.7 software.
4.11. Molecular Docking
Molecular dynamics was applied to investigate the potential interaction between SIGMAR1 and PD-L1 in a protein–protein interaction. Thus, molecular docking assays were performed using the ClusPro server (
https://cluspro.org), which is a widely used tool for protein–protein docking [
20]. The results for the regions of interactions among the proteins and their respective complexed ligands were arranged in an increasing energy order (from most negative to most positive) for the purpose of determining the finest interaction profiles. We also used PyMOL v2.5 as a molecular visualization system.
4.12. Statistical Analysis
Graph Prism 5.0 (GraphPad Software, San Diego, CA USA) was used for statistical analyses. The measurement data were presented as mean ± standard deviation (SD). The independent sample t-test and the paired sample t-test were used. The receiver operating characteristic (ROC) curve was used to assess the prognostic precision of SIGMAR1 and PD-L1. The sensitivity and specificity were measured by the corresponding area under the ROC curve (AUC). The p-value < 0.05 indicates statistical significance. The correlations between the SIGMAR1 and PD-L1 mRNA levels and SIGMAR1 with the expression and abundance scores of the immune cells were evaluated by Spearman’s correlation. To better visualize the profile expression of SIGMAR1 and PD-L1 in our cohort of human OC samples, we generated a heatmap using the Complex Heatmap package. The p-values were considered statistically significant if they were p < 0.05.