Amifostine and Melatonin Prevent Acute Salivary Gland Dysfunction 10 Days After Radiation Through Anti-Ferroptosis and Anti-Ferritinophagy Effects
Abstract
1. Introduction
2. Results
2.1. Gross and Histology of Tissue After Radiation
2.2. Anti-Ferroptotic Effect of Amifostine and Melatonin After Radiation Exposure
2.3. Anti-Inflammatory and Anti-Fibrosis Effects of Amifostine and Melatonin After Radiation Exposure
2.4. Preventive Effect on Submandibular Gland Dysfunction
2.5. Ferritinophagy
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Tissue Extract Preparation
4.3. Staining and Immunohistochemical Analysis
4.4. Quantitation of Redox Status and Ferroptosis Response
4.5. Quantitative Real-Time PCR
4.6. Western Blotting
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hakim, S.G.; Benedek, G.A.; Su, Y.X.; Jacobsen, H.C.; Klinger, M.; Dendorfer, A.; Hemmelmann, C.; Meller, B.; Nadrowitz, R.; Rades, D.; et al. Radioprotective effect of lidocaine on function and ultrastructure of salivary glands receiving fractionated radiation. Int. J. Radiat. Oncol. Biol. Phys. 2012, 82, e623–e630. [Google Scholar] [CrossRef] [PubMed]
- Berk, L.B.; Shivnani, A.T.; Small, W., Jr. Pathophysiology and management of radiation-induced xerostomia. J. Support. Oncol. 2005, 3, 191–200. [Google Scholar] [PubMed]
- Chen, G.; Han, Y.; Zhang, H.; Tu, W.; Zhang, S. Radiotherapy-induced digestive injury: Diagnosis, treatment and mechanisms. Front. Oncol. 2021, 11, 757973. [Google Scholar] [CrossRef] [PubMed]
- Fujisawa, T.; Takeda, K.; Ichijo, H. ASK family proteins in stress response and disease. Mol. Biotechnol. 2007, 37, 13–18. [Google Scholar] [CrossRef] [PubMed]
- Smoluk, G.D.; Fahey, R.C.; Ward, J.F. Equilibrium dialysis studies of the binding of radioprotector compounds to DNA. Radiat. Res. 1986, 107, 194–204. [Google Scholar] [CrossRef]
- McDonald, S.; Meyerowitz, C.; Smudzin, T.; Rubin, P. Preliminary results of a pilot study using WR-2721 before fractionated irradiation of the head and neck to reduce salivary gland dysfunction. Int. J. Radiat. Oncol. Biol. Phys. 1994, 29, 747–754. [Google Scholar] [CrossRef]
- Sarhaddi, D.; Tchanque-Fossuo, C.N.; Poushanchi, B.; Donneys, A.; Deshpande, S.S.; Weiss, D.M.; Buchman, S.R. Amifostine protects vascularity and improves union in a model of irradiated mandibular fracture healing. Plast. Reconstr. Surg. 2013, 132, 1542–1549. [Google Scholar] [CrossRef]
- Hosseinimehr, S.J. Trends in the development of radioprotective agents. Drug Discov. Today 2007, 12, 794–805. [Google Scholar] [CrossRef]
- Zhang, T.; Liu, C.; Ma, S.; Gao, Y.; Wang, R. Protective effect and mechanism of action of rosmarinic acid on radiation-induced parotid gland injury in rats. Dose Response 2020, 18, 1559325820907782. [Google Scholar] [CrossRef]
- Zhang, J.; Cui, L.; Xu, M.; Zheng, Y. Restoring the secretory function of irradiation-damaged salivary gland by administrating deferoxamine in mice. PLoS ONE 2014, 9, e113721. [Google Scholar] [CrossRef]
- Zhang, J.; Li, K.; Zhang, Q.; Zhu, Z.; Huang, G.; Tian, H. Polycysteine as a new type of radio-protector ameliorated tissue injury through inhibiting ferroptosis in mice. Cell Death Dis. 2021, 12, 195. [Google Scholar] [CrossRef] [PubMed]
- Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef]
- Wang, Y.; Yang, J.; Yi, J. Redox sensing by proteins: Oxidative modifications on cysteines and the consequent events. Antioxid. Redox Signal 2012, 16, 649–657. [Google Scholar] [CrossRef] [PubMed]
- Latunde-Dada, G.O. Ferroptosis: Role of lipid peroxidation, iron and ferritinophagy. Biochim. Biophys. Acta. Gen. Subj. 2017, 1861, 1893–1900. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.G.; Freeman, A.R.; Roos, D.E.; Milner, A.D.; Borg, M.F. Randomized double-blind trial of amifostine versus placebo for radiation-induced xerostomia in patients with head and neck cancer. J. Med. Imaging Radiat. Oncol. 2019, 63, 142–150. [Google Scholar] [CrossRef] [PubMed]
- Mercadante, V.; Jensen, S.B.; Smith, D.K.; Bohlke, K.; Bauman, J.; Brennan, M.T.; Coppes, R.P.; Jessen, N.; Malhotra, N.K.; Murphy, B.; et al. Salivary Gland Hypofunction and/or Xerostomia Induced by Nonsurgical Cancer Therapies: ISOO/MASCC/ASCO Guideline. J. Clin. Oncol. 2021, 39, 2825–2843. [Google Scholar] [CrossRef]
- Zhang, H.M.; Zhang, Y. Melatonin: A well-documented antioxidant with conditional pro-oxidant actions. J. Pineal Res. 2014, 57, 131–146. [Google Scholar] [CrossRef]
- Cakmak Karaer, I.; Simsek, G.; Yildiz, A.; Vardi, N.; Polat, A.; Tanbek, K.; Gurocak, S.; Parlakpinar, H. Melatonin’s protective effect on the salivary gland against ionized radiation damage in rats. J. Oral. Pathol. Med. 2016, 45, 444–449. [Google Scholar] [CrossRef]
- Mi, Y.; Wei, C.; Sun, L.; Liu, H.; Zhang, J.; Luo, J.; Yu, X.; He, J.; Ge, H.; Liu, P. Melatonin inhibits ferroptosis and delays age-related cataract by regulating SIRT6/p-Nrf2/GPX4 and SIRT6/NCOA4/FTH1 pathways. Biomed. Pharmacother. 2023, 157, 114048. [Google Scholar] [CrossRef]
- Ren, J.; Zhu, T.; Wang, Z.; Lu, L.; Fan, S. Amelioration of gamma irradiation-induced salivary gland damage in mice using melatonin. J. Pineal Res. 2023, 75, e12897. [Google Scholar] [CrossRef]
- Nagler, R.; Marmary, Y.; Fox, P.C.; Baum, B.J.; Har-El, R.; Chevion, M. Irradiation-induced damage to the salivary glands: The role of redox-active iron and copper. Radiat. Res. 1997, 147, 468–476. [Google Scholar] [CrossRef] [PubMed]
- Nagler, R.M. The enigmatic mechanism of irradiation-induced damage to the major salivary glands. Oral. Dis. 2002, 8, 141–146. [Google Scholar] [CrossRef] [PubMed]
- Ajoolabady, A.; Aslkhodapasandhokmabad, H.; Libby, P.; Tuomilehto, J.; Lip, G.Y.H.; Penninger, J.M.; Richardson, D.R.; Tang, D.; Zhou, H.; Wang, S.; et al. Ferritinophagy and ferroptosis in the management of metabolic diseases. Trends Endocrinol. Metab. 2021, 32, P444–P462. [Google Scholar] [CrossRef]
- Zhou, H.; Zhou, Y.L.; Mao, J.A.; Tang, L.F.; Xu, J.; Wang, Z.X.; He, Y.; Li, M. NCOA4-mediated ferritinophagy is involved in ionizing radiation-induced ferroptosis of intestinal epithelial cells. Redox Biol. 2022, 55, 102413. [Google Scholar] [CrossRef]
- Kwon, H.K.; Kim, J.M.; Shin, S.C.; Sung, E.S.; Kim, H.S.; Park, G.C.; Cheon, Y.I.; Lee, J.C.; Lee, B.J. The mechanism of submandibular gland dysfunction after menopause may be associated with the ferroptosis. Aging 2020, 12, 21376–21390. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.M.; Shin, S.C.; Cheon, Y.I.; Kim, H.S.; Park, G.C.; Kim, H.K.; Han, J.; Seol, J.E.; Vasileva, E.A.; Mishchenko, N.P.; et al. Effect of echinochrome A on submandibular gland dysfunction in ovariectomized rats. Mar. Drugs. 2022, 20, 729. [Google Scholar] [CrossRef] [PubMed]
- Cheon, Y.I.; Kim, J.M.; Shin, S.C.; Kim, H.S.; Lee, J.C.; Park, G.C.; Sung, E.S.; Lee, M.; Lee, B.J. Effect of deferoxamine and ferrostatin-1 on salivary gland dysfunction in ovariectomized rats. Aging 2023, 15, 2418–2432. [Google Scholar] [CrossRef]
- Chaves, P.; Garrido, M.; Oliver, J.; Pérez-Ruiz, E.; Isabel Barragan, I.; Rueda-Domínguez, A. Preclinical models in head and neck squamous cell carcinoma. Br. J. Cancer 2023, 128, 1819–1827. [Google Scholar] [CrossRef]
- Miserocchi, G.; Spadazzi, C.; Calpona, S.; De Rosa, D.; Usai, A.; De Vita, A.; Liverani, C.; Cocchi, C.; Vanni, S.; Calabrese, C.; et al. Precision Medicine in Head and Neck Cancers: Genomic and Preclinical Approaches. J. Pers. Med. 2022, 12, 854. [Google Scholar] [CrossRef]
- Kim, H.K.; Woo, S.H. In vitro stem cell differentiation for salivary gland regeneration: A comprehensive review. Med. Lasers 2024, 13, 19–24. [Google Scholar] [CrossRef]
- Jung, A.Y.; Cai, X.; Thoene, K.; Obi, N.; Jaskulski, S.; Behrens, S.; Flesch-Janys, D.; Chang-Claude, J. Antioxidant supplementation and breast cancer prognosis in postmenopausal women undergoing chemotherapy and radiation therapy. Am. J. Clin. Nutr. 2019, 109, 69–78. [Google Scholar] [CrossRef] [PubMed]







| Gene | Direction | Sequence |
|---|---|---|
| TNFɑ | Forward | GGTCAACCTGCCCAAGTACT |
| NM_012675 | Reverse | CTCCAAAGTAGACCTGCCCG |
| IL-6 | Forward | ATCTGCCCTTCAGGAACAGC |
| NM_012589 | Reverse | GAAGTAGGGAAGGCAGTGGC |
| COX-II | Forward | GGTTCACCCGAGGACTGGGC |
| NM_017232 | Reverse | CGCAGGTGCTCAGGGACGTG |
| 5-LOX | Forward | ATTGTTCCCATTGCCATCCAGCTCA |
| NM_009662 | Reverse | TCGTTCTCATAGTAGATGCTCACCA |
| TGF-β1 | Forward | GACGTTCGCCATAACCAAGT |
| NM_021578 | Reverse | CTGCAGGTTCTCAATGCAAA |
| TGF-β2 | Forward | CCAATCACGCAATAGTTCTGG |
| NM_031131 | Reverse | CGCTGTATCGTATGGCGAT |
| Col1a1 | Forward | CAGGATGCAGTCCCTGAAAT |
| NM_053304 | Reverse | GAGGTGGCCTAGGTGGTGTA |
| Col1a2 | Forward | GGTCAGCACCACCGATGTC |
| NM_053356 | Reverse | CACGCCTGCCCTTCCTT |
| AQP-3 | Forward | AATTGTCTGGAGCCCACTTG |
| NM_031703 | Reverse | CAGCTTGATCCAGGGCTCTC |
| AQP-5 | Forward | CATGAACCCAGCCCGATCTT |
| NM_012779 | Reverse | AGAAGACCCAGTGAGAGGGG |
| AMY | Forward | GCAACCAAGTAGCTTTTGGCA |
| NM_001010970 | Reverse | TGCCATCGACTTTGTCTCCAG |
| IREB2 | Forward | GGGAATTCTTGGGTGGGGAG |
| NM_022863 | Reverse | AACAAACTTTCCAGCCACGC |
| NcoA4 | Forward | AGACTACGGCTCCTGCTA |
| NM_001034007 | Reverse | CTGACTAAGGTTTCCCACT |
| GAPDH | Forward | ACCCCCAATGTATCCGTTGT |
| NM_017008 | Reverse | TACTCCTTGGAGGCCATGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, J.-M.; Kim, D.-H.; Kim, W.-T.; Shin, S.-C.; Cheon, Y.-i.; Park, G.-C.; Lee, H.-W.; Lee, B.-J. Amifostine and Melatonin Prevent Acute Salivary Gland Dysfunction 10 Days After Radiation Through Anti-Ferroptosis and Anti-Ferritinophagy Effects. Int. J. Mol. Sci. 2024, 25, 11613. https://doi.org/10.3390/ijms252111613
Kim J-M, Kim D-H, Kim W-T, Shin S-C, Cheon Y-i, Park G-C, Lee H-W, Lee B-J. Amifostine and Melatonin Prevent Acute Salivary Gland Dysfunction 10 Days After Radiation Through Anti-Ferroptosis and Anti-Ferritinophagy Effects. International Journal of Molecular Sciences. 2024; 25(21):11613. https://doi.org/10.3390/ijms252111613
Chicago/Turabian StyleKim, Ji-Min, Dong-Hyun Kim, Won-Taek Kim, Sung-Chan Shin, Yong-il Cheon, Gi-Cheol Park, Hyoun-Wook Lee, and Byung-Joo Lee. 2024. "Amifostine and Melatonin Prevent Acute Salivary Gland Dysfunction 10 Days After Radiation Through Anti-Ferroptosis and Anti-Ferritinophagy Effects" International Journal of Molecular Sciences 25, no. 21: 11613. https://doi.org/10.3390/ijms252111613
APA StyleKim, J.-M., Kim, D.-H., Kim, W.-T., Shin, S.-C., Cheon, Y.-i., Park, G.-C., Lee, H.-W., & Lee, B.-J. (2024). Amifostine and Melatonin Prevent Acute Salivary Gland Dysfunction 10 Days After Radiation Through Anti-Ferroptosis and Anti-Ferritinophagy Effects. International Journal of Molecular Sciences, 25(21), 11613. https://doi.org/10.3390/ijms252111613

