Regulation Mechanisms of the Glutamate Transporter in the Response of Pacific Oyster upon High-Temperature Stress
Abstract
:1. Introduction
2. Results
2.1. Characterization and Expression Patterns of the Glutamate Transporter Family Genes in C. gigas
2.2. Phylogenetic Analysis and Chromosomal Localization of the Glutamate Transporter Family in C. gigas
2.3. Spatiotemporal Expression Characteristics of Glutamate Transporters in C. gigas
2.4. Expression of Glutamate Transporters in C. gigas Under High-Temperature Stress
2.5. Mechanism of CgEAAT3 Response to High-Temperature Stress
3. Discussion
4. Materials and Methods
4.1. Identification and Functional Annotation of the Glutamate Transporter Family Genes in C. gigas
4.2. Chromosomal Distribution and Phylogenetic Analysis of the Glutamate Transporter Family in C. gigas
4.3. Spatiotemporal Expression Profiling
4.4. CgEAAT3 Pathway Enrichment and Network Analysis
4.5. Experimental Materials and High-Temperature Stress Treatment
4.6. Expression of Glutamate Transporters in C. Gigas Under High-Temperature Stress
4.7. Total RNA Extraction and qRT-PCR
4.8. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Young, V.R.; Ajami, A.M. Glutamate: An Amino Acid of Particular Distinction. J. Nutr. 2000, 130, 892S–900S. [Google Scholar] [CrossRef] [PubMed]
- Rose, C.R.; Ziemens, D.; Untiet, V.; Fahlke, C. Molecular and cellular physiology of sodium-dependent glutamate transporters. Brain Res. Bull. 2018, 136, 3–16. [Google Scholar] [CrossRef] [PubMed]
- Cuellar-Santoyo, A.O.; Ruiz-Rodríguez, V.M.; Mares-Barbosa, T.B.; Patrón-Soberano, A.; Howe, A.G.; Portales-Pérez, D.P.; Graf, A.M.; Estrada-Sánchez, A.M. Revealing the contribution of astrocytes to glutamatergic neuronal transmission. Front. Cell. Neurosci. 2023, 16, 1037641. [Google Scholar] [CrossRef] [PubMed]
- Sheng, L.; Luo, Q.; Chen, L. Amino Acid Solute Carrier Transporters in Inflammation and Autoimmunity. Drug Metab. Dispos. 2022, 50, 1228–1237. [Google Scholar] [CrossRef] [PubMed]
- Pietrancosta, N.; Djibo, M.; Daumas, S.; El Mestikawy, S.; Erickson, J.D. Molecular, Structural, Functional, and Pharmacological Sites for Vesicular Glutamate Transporter Regulation. Mol. Neurobiol. 2020, 57, 3118–3142. [Google Scholar] [CrossRef] [PubMed]
- Robert, S.M.; Buckingham, S.C.; Campbell, S.L.; Robel, S.; Holt, K.T.; Ogunrinu-Babarinde, T.; Warren, P.P.; White, D.M.; Reid, M.A.; Eschbacher, J.M.; et al. SLC7A11 expression is associated with seizures and predicts poor survival in patients with malignant glioma. Sci. Transl. Med. 2015, 7, 289ra86. [Google Scholar] [CrossRef]
- Rodríguez-Campuzano, A.G.; Ortega, A. Glutamate transporters: Critical components of glutamatergic transmission. Neuropharmacology 2021, 192, 108602. [Google Scholar] [CrossRef]
- Green, J.L.; dos Santos, W.F.; Fontana, A.C.K. Role of glutamate excitotoxicity and glutamate transporter EAAT2 in epilepsy: Opportunities for novel therapeutics development. Biochem. Pharmacol. 2021, 193, 114786. [Google Scholar] [CrossRef]
- Wang, M.; Witvliet, D.; Wu, M.; Kang, L.; Shao, Z. Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling. PLOS Genet. 2021, 17, e1009295. [Google Scholar] [CrossRef]
- Ingold, I.; Berndt, C.; Schmitt, S.; Doll, S.; Poschmann, G.; Buday, K.; Roveri, A.; Peng, X.; Porto Freitas, F.P.; Seibt, T.; et al. Selenium Utilization by GPX4 Is Required to Prevent Hydroperoxide-Induced Ferroptosis. Cell 2018, 172, 409–422.e21. [Google Scholar] [CrossRef]
- Aagesen, A.M.; Häse, C.C. Seasonal effects of heat shock on bacterial populations, including artificial Vibrio parahaemolyticus exposure, in the Pacific oyster, Crassostrea gigas. Food Microbiol. 2014, 38, 93–103. [Google Scholar] [CrossRef] [PubMed]
- Malham, S.K.; Cotter, E.; O’Keeffe, S.; Lynch, S.; Culloty, S.C.; King, J.W.; Latchford, J.W.; Beaumont, A.R. Summer mortality of the Pacific oyster, Crassostrea gigas, in the Irish Sea: The influence of temperature and nutrients on health and survival. Aquaculture 2008, 287, 128–138. [Google Scholar] [CrossRef]
- Viergutz, C.; Linn, C.; Weitere, M. Intra- and interannual variability surpasses direct temperature effects on the clearance rates of the invasive clam Corbicula fluminea. Mar. Biol. 2012, 159, 2379–2387. [Google Scholar] [CrossRef]
- Georgoulis, I.; Papadopoulos, D.K.; Lattos, A.; Michaelidis, B.; Feidantsis, K.; Giantsis, I.A. Increased seawater temperature triggers thermal, oxidative and metabolic response of Ostrea edulis, leading to anaerobiosis. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2024, 271, 110943. [Google Scholar] [CrossRef]
- Amorim, V.; Gonçalves, O.; Capela, R.; Fernández-Boo, S.; Oliveira, M.; Dolbeth, M.; Arenas, F.; Cardoso, P. Immunological and oxidative stress responses of the bivalve Scrobicularia plana to distinct patterns of heatwaves. Fish Shellfish. Immunol. 2020, 106, 1067–1077. [Google Scholar] [CrossRef]
- Rahman, M.S.; Rahman, M.S. Elevated seasonal temperature disrupts prooxidant-antioxidant homeostasis and promotes cellular apoptosis in the American oyster, Crassostrea virginica, in the Gulf of Mexico: A field study. Cell Stress Chaperones 2021, 26, 917–936. [Google Scholar] [CrossRef]
- Masanja, F.; Yang, K.; Xu, Y.; He, G.; Liu, X.; Xu, X.; Xiaoyan, J.; Xin, L.; Mkuye, R.; Deng, Y.; et al. Impacts of marine heat extremes on bivalves. Front. Mar. Sci. 2023, 10, 1159261. [Google Scholar] [CrossRef]
- Murphy-Royal, C.; Dupuis, J.; Groc, L.; Oliet, S.H.R. Astroglial glutamate transporters in the brain: Regulating neurotransmitter homeostasis and synaptic transmission. J. Neurosci. Res. 2017, 95, 2140–2151. [Google Scholar] [CrossRef]
- Zhang, X.; Si, Y.; Zhang, L.; Wen, X.; Yang, C.; Wang, L.; Song, L. Involvement of metabotropic glutamate receptors in regulation of immune response in the Pacific oyster Crassostrea gigas. Fish Shellfish. Immunol. 2024, 151, 109709. [Google Scholar] [CrossRef]
- Yu, Y.; Newman, H.; Shen, L.; Sharma, D.; Hu, G.; Mirando, A.J.; Zhang, H.; Knudsen, E.; Zhang, G.-F.; Hilton, M.J.; et al. Glutamine Metabolism Regulates Proliferation and Lineage Allocation in Skeletal Stem Cells. Cell Metab. 2019, 29, 966–978.e4. [Google Scholar] [CrossRef]
- Amilhon, B.; Lepicard, E.; Renoir, T.; Mongeau, R.; Popa, D.; Poirel, O.; Miot, S.; Gras, C.; Gardier, A.M.; Gallego, J.; et al. VGLUT3 (Vesicular Glutamate Transporter Type 3) Contribution to the Regulation of Serotonergic Transmission and Anxiety. J. Neurosci. 2010, 30, 2198–2210. [Google Scholar] [CrossRef] [PubMed]
- Sokolnikova, Y. Endobiotic microalgae in molluscan life. Fish. Aquat. Sci. 2022, 25, 499–516. [Google Scholar] [CrossRef]
- Bayne, B.L. Biology of Oysters; Academic Press: London, UK, 2017. [Google Scholar]
- Liu, Z.; Li, M.; Yi, Q.; Wang, L.; Song, L. The Neuroendocrine-Immune Regulation in Response to Environmental Stress in Marine Bivalves. Front. Physiol. 2018, 9, 1456. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Wang, L.; Zhou, Z.; Sun, Y.; Wang, M.; Wang, H.; Hou, Z.; Gao, D.; Gao, Q.; Song, L. The simple neuroendocrine-immune regulatory network in oyster Crassostrea gigas mediates complex functions. Sci. Rep. 2016, 6, 26396. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Wang, L.; Qiu, L.; Zhang, H. Bivalve immunity. Invertebr. Immun. 2010, 44–65. [Google Scholar] [CrossRef]
- Holmseth, S.; Dehnes, Y.; Huang, Y.H.; Follin-Arbelet, V.V.; Grutle, N.J.; Mylonakou, M.N.; Plachez, C.; Zhou, Y.; Furness, D.N.; Bergles, D.E.; et al. The Density of EAAC1 (EAAT3) Glutamate Transporters Expressed by Neurons in the Mammalian CNS. J. Neurosci. 2012, 32, 6000–6013. [Google Scholar] [CrossRef]
- Wallén-Mackenzie, Å.; Wootz, H.; Englund, H. Genetic inactivation of the vesicular glutamate transporter 2 (VGLUT2) in the mouse: What have we learnt about functional glutamatergic neurotransmission? Upsala J. Med. Sci. 2010, 115, 11–20. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Nahar, K.; Fujita, M. Extreme temperature responses, oxidative stress and antioxidant defense in plants. Abiotic Stress-Plant Responses Appl. Agric. 2013, 13, 169–205. [Google Scholar] [CrossRef]
- Emami, N.K.; Jung, U.; Voy, B.; Dridi, S. Radical Response: Effects of Heat Stress-Induced Oxidative Stress on Lipid Metabolism in the Avian Liver. Antioxidants 2020, 10, 35. [Google Scholar] [CrossRef]
- Seibt, T.M.; Proneth, B.; Conrad, M. Role of GPX4 in ferroptosis and its pharmacological implication. Free. Radic. Biol. Med. 2018, 133, 144–152. [Google Scholar] [CrossRef]
- Dalet, A.; Bonsacquet, J.; Gaboyard-Niay, S.; Calin-Jageman, I.; Chidavaenzi, R.L.; Venteo, S.; Desmadryl, G.; Goldberg, J.M.; Lysakowski, A.; Chabbert, C. Glutamate Transporters EAAT4 and EAAT5 Are Expressed in Vestibular Hair Cells and Calyx Endings. PLoS ONE 2012, 7, e46261. [Google Scholar] [CrossRef] [PubMed]
- Lukasiewcz, P.D.; Bligard, G.W.; DeBrecht, J.D. EAAT5 Glutamate Transporter-Mediated Inhibition in the Vertebrate Retina. Front. Cell. Neurosci. 2021, 15, 662859. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.; Ismat, F.; Jiao, L.; Baldwin, J.M.; Sharples, D.J.; Baldwin, S.A.; Patching, S.G. Characterisation of the DAACS Family Escherichia coli Glutamate/Aspartate-Proton Symporter GltP Using Computational, Chemical, Biochemical and Biophysical Methods. J. Membr. Biol. 2016, 250, 145–162. [Google Scholar] [CrossRef] [PubMed]
- Quistgaard, E.M.; Löw, C.; Guettou, F.; Nordlund, P. Understanding transport by the major facilitator superfamily (MFS): Structures pave the way. Nat. Rev. Mol. Cell Biol. 2016, 17, 123–132. [Google Scholar] [CrossRef] [PubMed]
- Shigeri, Y.; Shimamoto, K. [Pharmacology of excitatory amino acid transporters (EAATs and VGLUTs)]. Folia Pharmacol. Jpn. 2003, 122, 253–264. [Google Scholar] [CrossRef]
- Liu, W.; Xie, Y.; Ma, J.; Luo, X.; Nie, P.; Zuo, Z.; Lahrmann, U.; Zhao, Q.; Zheng, Y.; Zhao, Y.; et al. IBS: An illustrator for the presentation and visualization of biological sequences. Bioinformatics 2015, 31, 3359–3361. [Google Scholar] [CrossRef]
- Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef]
- Zhang, G.; Fang, X.; Guo, X.; Li, L.; Luo, R.; Xu, F.; Yang, P.; Zhang, L.; Wang, X.; Qi, H.; et al. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 2012, 490, 49–54. [Google Scholar] [CrossRef]
- Kumar, L.; Futschik, M.E. Mfuzz: A software package for soft clustering of microarray data. Bioinformation 2007, 2, 5–7. [Google Scholar] [CrossRef]
- MacArthur Clark, J.A.; Sun, D. Guidelines for the ethical review of laboratory animal welfare People’s Republic of China National Standard GB/T 35892-2018 [Issued 6 February 2018 Effective from 1 September 2018]. Anim. Models Exp. Med. 2020, 3, 103–113. [Google Scholar] [CrossRef]
Gene Name | Gene ID | cDNA Length (bp) | ORF Length (bp) | Exons No. | Introns No. | Amino Acid No. | Molecular Weight (kDa) | Theoretical PI | AlpHa No. | Beta No. | Colins No. | Turn No. | GRAVY of PD |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
EAAT1 | LOC105330890 | 2298 | 1563 | 10 | 9 | 520 | 56.16 | 6.97 | 21 | 31 | 33 | 27 | 0.500 |
EAAT2 | LOC105335486 | 3700 | 1713 | 10 | 9 | 570 | 62.80 | 5.30 | 30 | 38 | 36 | 32 | 0.342 |
EAAT3 | LOC105332706 | 2720 | 1707 | 8 | 7 | 568 | 61.46 | 5.25 | 26 | 31 | 29 | 28 | 0.548 |
VGLUT1 | LOC105331066 | 3556 | 1887 | 12 | 11 | 628 | 69.61 | 6.17 | 21 | 40 | 50 | 50 | 0.129 |
VGLUT2 | LOC105342017 | 2003 | 1689 | 13 | 12 | 562 | 62.50 | 6.02 | 23 | 42 | 44 | 51 | 0.145 |
VGLUT3 | LOC105324413 | 1962 | 1467 | 13 | 12 | 488 | 53.14 | 8.87 | 23 | 34 | 32 | 35 | 0.564 |
Gene | H. sapiens | M. musculus | D. rerio | X. tropicalis | G. gallus | S. pistillata | D. magna | S. purpuratus | P. vulgata |
---|---|---|---|---|---|---|---|---|---|
EAAT1 | 53.80% | 52.58% | 53.70% | 50.10% | 53.65% | 40.15% | 50.1% | 47.66% | 52.04% |
EAAT2 | 55.22% | 52.11% | 55.34% | 56.34% | 54.9% | 41.29% | / | 51.73% | 60.18% |
EAAT3 | 46.73% | 49.50% | 44.87% | 48.76% | 48.16% | 47.65% | 47.02% | 58.7% | / |
VGLUT1 | 60.63% | 60.63% | / | 51.63% | / | 35.53% | 56.43% | 58.24% | 39.49% |
VGLUT2 | 33.33% | 33.60% | 32.44% | 32.92% | 33.88% | 33.65% | 33.61% | / | 33.41% |
VGLUT3 | 34.58% | 35.32% | 36.78% | 32.99% | 34.24% | / | / | / | / |
Primer Name | Sequence (5′–3′) | Product Length (bp) | Application |
---|---|---|---|
CgEAAT3-RT-F | AATTGGCGAGAAAGGAAGG | 120 | RT-PCR |
CgEAAT3-RT-R | GCGGCGATAAGAAAGGCT | ||
CgGPX4-RT-F | AAAGTATGCTGAGGAGAAGGGGCT | 273 | RT-PCR |
CgGPX4-RT-R | CTTTTCACTGGCTTCCCTTCTTTG | ||
CgEF-RT-F | AGTCACCAAGGCTGCACAGAAAG | 201 | RT-PCR |
CgEF-RT-R | TCCGACGTATTTCTTTGCGATGT | ||
CgEAAT3-Fi | CCCAAGCTTATGACAACAGTTGCACCCAA | 498 | RNA interference |
CgEAAT3-Ri | CTAGCTAGCGTCCACGTTGTTTCGTTCCT | ||
EGFP-F | CCCAAGCTTACGTAAACGGCCACAAGTTC | 495 | RNA interference |
EGFP-R | CTAGCTAGCTGTTCTGCTGGTAGTGGTCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, X.; Wen, X.; Si, Y.; Li, D.; Yang, C.; Wang, L.; Song, L. Regulation Mechanisms of the Glutamate Transporter in the Response of Pacific Oyster upon High-Temperature Stress. Int. J. Mol. Sci. 2024, 25, 11342. https://doi.org/10.3390/ijms252111342
Zhang X, Wen X, Si Y, Li D, Yang C, Wang L, Song L. Regulation Mechanisms of the Glutamate Transporter in the Response of Pacific Oyster upon High-Temperature Stress. International Journal of Molecular Sciences. 2024; 25(21):11342. https://doi.org/10.3390/ijms252111342
Chicago/Turabian StyleZhang, Xueshu, Xue Wen, Yiran Si, Deliang Li, Chuanyan Yang, Lingling Wang, and Linsheng Song. 2024. "Regulation Mechanisms of the Glutamate Transporter in the Response of Pacific Oyster upon High-Temperature Stress" International Journal of Molecular Sciences 25, no. 21: 11342. https://doi.org/10.3390/ijms252111342
APA StyleZhang, X., Wen, X., Si, Y., Li, D., Yang, C., Wang, L., & Song, L. (2024). Regulation Mechanisms of the Glutamate Transporter in the Response of Pacific Oyster upon High-Temperature Stress. International Journal of Molecular Sciences, 25(21), 11342. https://doi.org/10.3390/ijms252111342