The Interplay of Nitric Oxide and Nitrosative Modifications in Maize: Implications for Aphid Herbivory and Drought Stress
Abstract
1. Introduction
2. Results
2.1. The Impact of Aphid Infestation, Drought, and the Combined Stresses on the Contents of Nitric Oxide (NO) and Peroxynitrite Anion (ONOO−) in Z. mays Seedlings
2.2. Stress-Stimulated Changes in the Level of Selected Nitrosative Modifications of mRNA, DNA, and Proteins in the Maize Plants
2.3. Stress-Induced Alternations in the Expression Patterns of nos-ip and nr1 Genes in the Maize Seedlings
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Aphids
4.3. Experimental Design
4.4. Determination of Nitric Oxide (NO) and Peroxynitrite Anion (ONOO−)
4.5. Isolation and Purification of Genomic DNA (gDNA), Total RNA, and mRNA
4.6. Measurement of 8-Nitroguanine (8-NG) Amount in mRNA and gDNA
4.7. Determination of Protein 3-Nitrotyrosine (3-NT)
4.8. Gene Expression Quantification
4.9. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dohleman, F.G.; Barten, T.J.; Helland, N.; Dahal, S.; Arrizia, J.L.; Gehlhar, S.; Foresman, C.; Mack, D.; Gillespie, K.; Archontoulis, S.; et al. Benefitting Productivity and the Environment: Current and Future Maize Cropping Systems Improve Yield While Reducing Nitrate Load. J. Environ. Qual. 2024, 53, 187–197. [Google Scholar] [CrossRef] [PubMed]
- Cagnola, J.I.; D’Andrea, K.E.; Rotili, D.H.; Mercau, J.L.; Ploschuk, E.L.; Maddonni, G.A.; Otegui, M.E.; Casal, J.J. Eco-physiology of Maize Crops under Combined Stresses. Plant J. 2024, 117, 1856–1872. [Google Scholar] [CrossRef] [PubMed]
- Du, R.; Li, Z.; Xiang, Y.; Sun, T.; Liu, X.; Shi, H.; Li, W.; Huang, X.; Tang, Z.; Lu, J.; et al. Drip Fertigation Increases Maize Grain Yield by Affecting Phenology, Grain Filling Process, Biomass Accumulation and Translocation: A 4-Year Field Trial. Plants 2024, 13, 1903. [Google Scholar] [CrossRef] [PubMed]
- Servin-Balderas, I.; Wetser, K.; Buisman, C.; Hamelers, B. Implications in the Production of Defossilized Methanol: A Study on Carbon Sources. J. Environ. Manag. 2024, 354, 120304. [Google Scholar] [CrossRef] [PubMed]
- Sowiński, J. Intercropping Maize (Zea mays L.) and Field Beans (Vicia faba L.) for Forage, Increases Protein Production. Sci. Rep. 2024, 14, 16419. [Google Scholar] [CrossRef]
- Zhao, C.; Liu, B.; Piao, S.; Wang, X.; Lobell, D.B.; Huang, Y.; Huang, M.; Yao, Y.; Bassu, S.; Ciais, P.; et al. Temperature Increase Reduces Global Yields of Major Crops in Four Independent Estimates. Proc. Natl. Acad. Sci. USA 2017, 114, 9326–9331. [Google Scholar] [CrossRef]
- Batiru, G.; Lübberstedt, T. Polyploidy in Maize: From Evolution to Breeding. Theor. Appl. Genet. 2024, 137, 182. [Google Scholar] [CrossRef]
- Yu, H.; Liu, B.; Yang, Q.; Yang, Q.; Li, W.; Fu, F. Maize ZmLAZ1-3 Gene Negatively Regulates Drought Tolerance in Transgenic Arabidopsis. BMC Plant Biol. 2024, 24, 246. [Google Scholar] [CrossRef]
- Gao, L.; Jiang, H.; Li, M.; Wang, D.; Xiang, H.; Zeng, R.; Chen, L.; Zhang, X.; Zuo, J.; Yang, S.; et al. Genetic and Lipidomic Analyses Reveal the Key Role of Lipid Metabolism for Cold Tolerance in Maize. J. Genet. Genomics 2024, 51, 326–337. [Google Scholar] [CrossRef]
- Ma, Z.; Wang, W.; Chen, X.; Gehman, K.; Yang, H.; Yang, Y. Prediction of the Global Occurrence of Maize Diseases and Estimation of Yield Loss under Climate Change. Pest Manag. Sci. 2024; Online ahead of print. [Google Scholar] [CrossRef]
- Onyekwelu, I.; Sharda, V. Root Proliferation Adaptation Strategy Improved Maize Productivity in the US Great Plains: Insights from Crop Simulation Model under Future Climate Change. Sci. Total Environ. 2024, 927, 172205. [Google Scholar] [CrossRef]
- Casu, A.; Camardo Leggieri, M.; Toscano, P.; Battilani, P. Changing Climate, Shifting Mycotoxins: A Comprehensive Review of Climate Change Impact on Mycotoxin Contamination. Compr. Rev. Food Sci. Food Saf. 2024, 23, e13323. [Google Scholar] [CrossRef] [PubMed]
- Sytykiewicz, H.; Łukasik, I.; Goławska, S.; Chrzanowski, G. Aphid-Triggered Changes in Oxidative Damage Markers of Nucleic Acids, Proteins, and Lipids in Maize (Zea mays L.) Seedlings. Int. J. Mol. Sci. 2019, 20, 3742. [Google Scholar] [CrossRef] [PubMed]
- Hayford, R.K.; Haley, O.C.; Cannon, E.K.; Portwood, J.L., 2nd; Gardiner, J.M.; Andorf, C.M.; Woodhouse, M.R. Functional Annotation and Meta-Analysis of Maize Transcriptomes Reveal Genes Involved in Biotic and Abiotic Stress. BMC Genom. 2024, 25, 533. [Google Scholar] [CrossRef] [PubMed]
- Sytykiewicz, H. Transcriptional Reprogramming of Genes Related to Ascorbate and Glutathione Biosynthesis, Turnover and Translocation in Aphid-Challenged Maize Seedlings. Biochem. Syst. Ecol. 2016, 69, 236–251. [Google Scholar] [CrossRef]
- Sytykiewicz, H. Transcriptional Responses of Catalase Genes in Maize Seedlings Exposed to Cereal Aphids’ Herbivory. Biochem. Syst. Ecol. 2015, 60, 131–142. [Google Scholar] [CrossRef]
- Hussain, H.A.; Men, S.; Hussain, S.; Zhang, Q.; Ashraf, U.; Anjum, S.A.; Ali, I.; Wang, L. Maize Tolerance against Drought and Chilling Stresses Varied with Root Morphology and Antioxidative Defense System. Plants 2020, 9, 720. [Google Scholar] [CrossRef]
- Meng, H.X.; Wang, Y.Z.; Yao, X.L.; Xie, X.R.; Dong, S.; Yuan, X.; Li, X.; Gao, L.; Yang, G.; Chu, X.; et al. Reactive Oxygen Species (ROS) Modulate Nitrogen Signaling Using Temporal Transcriptome Analysis in Foxtail Millet. Plant Mol. Biol. 2024, 114, 37. [Google Scholar] [CrossRef]
- Samanta, S.; Seth, C.S.; Roychoudhury, A. The Molecular Paradigm of Reactive Oxygen Species (ROS) and Reactive Nitrogen Species (RNS) with Different Phytohormone Signaling Pathways During Drought Stress in Plants. Plant Physiol. Biochem. 2024, 206, 108259. [Google Scholar] [CrossRef]
- Liu, Y.; Hou, P.; Zhang, W.; Xing, J.; Lv, T.; Zhang, C.; Wang, R.; Zhao, J. Drought Resistance of Nine Maize Cultivars Released from the 1970s through the 2010s in China. Field Crops Res. 2023, 302, 109065. [Google Scholar] [CrossRef]
- Sheoran, S.; Kaur, Y.; Kumar, S.; Shukla, S.; Rakshit, S.; Kumar, R. Recent Advances for Drought Stress Tolerance in Maize (Zea mays L.): Present Status and Future Prospects. Front Plant Sci. 2022, 13, 872566. [Google Scholar] [CrossRef]
- Gu, L.; Chen, X.; Hou, Y.; Cao, Y.; Wang, H.; Zhu, B.; Du, X.; Wang, H. ZmWRKY30 Modulates Drought Tolerance in Maize by Influencing Myo-Inositol and Reactive Oxygen Species Homeostasis. Physiol. Plant. 2024, 176, e14423. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Zhang, Y.; Tang, C.; Shen, Q.; Fu, J.; Wang, Q. Maize Transcription Factor ZmHsf28 Positively Regulates Plant Drought Tolerance. Int. J. Mol. Sci. 2023, 24, 8079. [Google Scholar] [CrossRef] [PubMed]
- da Silva, R.C.; Oliveira, H.C.; Igamberdiev, A.U.; Stasolla, C.; Gaspar, M. Interplay Between Nitric Oxide and Inorganic Nitrogen Sources in Root Development and Abiotic Stress Responses. J. Plant Physiol. 2024, 297, 154241. [Google Scholar] [CrossRef] [PubMed]
- Łukasik, I.; Sytykiewicz, H.; Goławska, S. Effect of the Cereal Aphid Infestation on The Oxidative Damages of Protein in the Maize (Zea mays L.). Acta Sci. Pol. Hortorum Cultus 2021, 20, 81–89. [Google Scholar] [CrossRef]
- Singh, A.; Kumar, A.; Yadav, S.; Singh, I.K. Reactive Oxygen Species-Mediated Signaling During Abiotic Stress. Plant Gene 2019, 18, 100173. [Google Scholar] [CrossRef]
- Abbas, T.; Rizwan, M.; Ali, S.; Adrees, M.; Mahmood, A.; Zia-ur-Rehman, M.; Ibrahim, M.; Arshad, M.; Qayyum, M.F. Biochar Application Increased the Growth and Yield and Reduced Cadmium in Drought Stressed Wheat Grown in an Aged Contaminated Soil. Ecotoxicol. Environ. Saf. 2018, 148, 825–833. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Nahar, K.; Rahman, A.; Inafuku, M.; Oku, H.; Fujita, M. Exogenous Nitric Oxide Donor and Arginine Provide Protection Against Short-Term Drought Stress in Wheat Seedlings. Physiol. Mol. Biol. Plants 2018, 24, 993–1004. [Google Scholar] [CrossRef]
- Qiao, W.; Li, C.; Fan, L.-M. Cross-talk between Nitric Oxide and Hydrogen Peroxide in Plant Responses to Abiotic Stresses. Environ. Exp. Bot. 2014, 100, 84–93. [Google Scholar] [CrossRef]
- Yamasaki, H.; Ogura, M.P.; Kingjoe, K.A.; Cohen, M.F. d-Cysteine-Induced Rapid Root Abscission in the Water Fern Azolla Pinnata: Implications for the Linkage between d-Amino Acid and Reactive Sulfur Species (RSS) in Plant Environmental Responses. Antioxidants 2019, 8, 411. [Google Scholar] [CrossRef]
- Del Río, L.A.; López-Huertas, E. ROS Generation in Peroxisomes and its Role in Cell Signaling. Plant Cell Physiol. 2016, 57, 1364–1376. [Google Scholar] [CrossRef]
- Izbiańska, K.; Floryszak-Wieczorek, J.; Gajewska, J.; Meller, B.; Kuźnicki, D.; Arasimowicz-Jelonek, M. RNA and mRNA Nitration as a Novel Metabolic Link in Potato Immune Response to Phytophthora infestans. Front. Plant Sci. 2018, 9, 672. [Google Scholar] [CrossRef] [PubMed]
- Mai, V.C.; Drzewiecka, K.; Jeleń, H.; Narożna, D.; Rucińska-Sobkowiak, R.; Kęsy, J.; Floryszak-Wieczorek, J.; Gabryś, B.; Morkunas, I. Differential Induction of Pisum Sativum Defense Signaling Molecules in Response to Pea Aphid Infestation. Plant Sci. 2014, 221–222, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Chmielowska-Bąk, J.; Arasimowicz-Jelonek, M.; Deckert, J. In Search of the mRNA Modification Landscape in Plants. BMC Plant Biol. 2019, 19, 421. [Google Scholar] [CrossRef] [PubMed]
- Yamasaki, H.; Sakihama, Y. Simultaneous Production of Nitric Oxide and Peroxynitrite by Plant Nitrate Reductase: In Vitro Evidence for the NR-Dependent Formation of Active Nitrogen Species. FEBS Lett. 2000, 468, 89–92. [Google Scholar] [CrossRef] [PubMed]
- Allagulova, C.R.; Lubyanova, A.R.; Avalbaev, A.M. Multiple Ways of Nitric Oxide Production in Plants and Its Functional Activity under Abiotic Stress Conditions. Int. J. Mol. Sci. 2023, 24, 11637. [Google Scholar] [CrossRef]
- Phillips, K.; Majola, A.; Gokul, A.; Keyster, M.; Ludidi, N.; Egbichi, I. Inhibition of NOS-like Activity in Maize Alters the Expression of Genes Involved in H2O2 Scavenging and Glycine Betaine Biosynthesis. Sci Rep. 2018, 8, 12628. [Google Scholar] [CrossRef]
- Khator, K.; Parihar, S.; Jasik, J.; Shekhawat, G.S. Nitric Oxide in Plants: An Insight on Redox Activity and Responses Toward Abiotic Stress Signaling. Plant Signal. Behav. 2024, 19, 2298053. [Google Scholar] [CrossRef]
- Wani, K.I.; Naeem, M.; Castroverde, C.D.M.; Kalaji, H.M.; Albaqami, M.; Aftab, T. Molecular Mechanisms of Nitric Oxide (NO) Signaling and Reactive Oxygen Species (ROS) Homeostasis during Abiotic Stresses in Plants. Int. J. Mol. Sci. 2021, 22, 9656. [Google Scholar] [CrossRef]
- Shang, J.-X.; Li, X.; Li, C.; Zhao, L. The Role of Nitric Oxide in Plant Responses to Salt Stress. Int. J. Mol. Sci. 2022, 23, 6167. [Google Scholar] [CrossRef]
- Sytykiewicz, H.; Czerniewicz, P.; Sprawka, I.; Krzyżanowski, R. Chlorophyll Content of Aphid-Infested Seedling Leaves of Fifteen Maize Genotypes. Acta Biol. Cracov. Ser. Bot. 2013, 55, 51–60. [Google Scholar] [CrossRef]
- Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Sytykiewicz, H.; Łukasik, I.; Goławska, S.; Sprawka, I.; Goławski, A.; Sławianowska, J.; Kmieć, K. Expression of Thioredoxin/Thioredoxin Reductase System Genes in Aphid-Challenged Maize Seedlings. Int. J. Mol. Sci. 2020, 21, 6296. [Google Scholar] [CrossRef] [PubMed]






| Tested Gene | GenBank Reference Sequence | GenBank Gene ID | Sequences of Primers and TaqMan Fluorescent Probes |
|---|---|---|---|
| nos-ip (encoding nitric oxide synthase-interacting protein) | NM_001146776.2 | LOC100272289 | F: AGCGTTCTCTGTGTCTGTTC R: TTTTACCTATCTCAACGCCCC P: CCTCGGTTTCCTGAAGCACCTGG |
| nr1 (encoding nitrate reductase 1) | NM_001305856.1 | LOC542278 | F: CCATCAACAGCATTACCACAC R: CACACCAGCCATGTCTCG P: TCCAGCGTCACCTCCACCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sytykiewicz, H.; Czerniewicz, P.; Ruszczyńska, M.; Kmieć, K. The Interplay of Nitric Oxide and Nitrosative Modifications in Maize: Implications for Aphid Herbivory and Drought Stress. Int. J. Mol. Sci. 2024, 25, 11280. https://doi.org/10.3390/ijms252011280
Sytykiewicz H, Czerniewicz P, Ruszczyńska M, Kmieć K. The Interplay of Nitric Oxide and Nitrosative Modifications in Maize: Implications for Aphid Herbivory and Drought Stress. International Journal of Molecular Sciences. 2024; 25(20):11280. https://doi.org/10.3390/ijms252011280
Chicago/Turabian StyleSytykiewicz, Hubert, Paweł Czerniewicz, Magdalena Ruszczyńska, and Katarzyna Kmieć. 2024. "The Interplay of Nitric Oxide and Nitrosative Modifications in Maize: Implications for Aphid Herbivory and Drought Stress" International Journal of Molecular Sciences 25, no. 20: 11280. https://doi.org/10.3390/ijms252011280
APA StyleSytykiewicz, H., Czerniewicz, P., Ruszczyńska, M., & Kmieć, K. (2024). The Interplay of Nitric Oxide and Nitrosative Modifications in Maize: Implications for Aphid Herbivory and Drought Stress. International Journal of Molecular Sciences, 25(20), 11280. https://doi.org/10.3390/ijms252011280

