Knockout of the Tnfa Gene Decreases Influenza Virus-Induced Histological Reactions in Laboratory Mice
Abstract
1. Introduction
2. Results
2.1. Genotypes of the Knockout Mouse Strain
2.2. Viral RNA Replication Is Enhanced in Knockout Mice
2.3. Deficiency of TNF-α Reduces Tissue Disturbance in Mice
3. Discussion
4. Materials and Methods
4.1. CRISPR System Design and Preparation of Components for Microinjections
4.2. Generation of Tnfa Knockout Mice
4.3. Tnfa Gene Expression Analysis
4.4. H1N1 Infection
4.5. Quantification of Viral RNA Load in Biological Samples by RT-PCR
4.6. Focus-Forming Assay
4.7. Histological Analysis
4.8. Statistical Analyses
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jang, D.; Lee, A.-H.; Shin, H.-Y.; Song, H.-R.; Park, J.-H.; Kang, T.-B.; Lee, S.-R.; Yang, S.-H. The Role of Tumor Necrosis Factor Alpha (TNF-α) in Autoimmune Disease and Current TNF-α Inhibitors in Therapeutics. Int. J. Mol. Sci. 2021, 22, 2719. [Google Scholar] [CrossRef] [Scilit]
- Waters, J.P.; Pober, J.S.; Bradley, J.R. Tumour Necrosis Factor in Infectious Disease. J. Pathol. 2013, 230, 132–147. [Google Scholar] [CrossRef] [Scilit]
- Yu, M.; Zhou, X.; Niu, L.; Lin, G.; Huang, J.; Zhou, W.; Gan, H.; Wang, J.; Jiang, X.; Yin, B.; et al. Targeting Transmembrane TNF-α Suppresses Breast Cancer Growth. Cancer Res. 2013, 73, 4061–4074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Horiuchi, T.; Mitoma, H.; Harashima, S.-I.; Tsukamoto, H.; Shimoda, T. Transmembrane TNF-: Structure, Function and Interaction with Anti-TNF Agents. Rheumatology 2010, 49, 1215–1228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradley, J. TNF-Mediated Inflammatory Disease. J. Pathol. 2008, 214, 149–160. [Google Scholar] [CrossRef] [Scilit]
- Xu, G.; Shi, Y. Apoptosis Signaling Pathways and Lymphocyte Homeostasis. Cell Res. 2007, 17, 759–771. [Google Scholar] [CrossRef] [Scilit]
- Ramshaw, I.A.; Ramsay, A.J.; Karupiah, G.; Rolph, M.S.; Mahalingam, S.; Ruby, J.C. Cytokines and Immunity to Viral Infections. Immunol. Rev. 1997, 159, 119–135. [Google Scholar] [CrossRef] [Scilit]
- Kota, S.; Sabbah, A.; Chang, T.H.; Harnack, R.; Xiang, Y.; Meng, X.; Bose, S. Role of Human β-Defensin-2 during Tumor Necrosis Factor-α/NF-ΚB-Mediated Innate Antiviral Response against Human Respiratory Syncytial Virus. J. Biol. Chem. 2008, 283, 22417–22429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, A.; Abbas, W.; Herbein, G. TNF and TNF Receptor Superfamily Members in HIV Infection: New Cellular Targets for Therapy? Mediat. Inflamm. 2013, 2013, 484378. [Google Scholar] [CrossRef] [Scilit]
- Gu, Y.; Zuo, X.; Zhang, S.; Ouyang, Z.; Jiang, S.; Wang, F.; Wang, G. The Mechanism behind Influenza Virus Cytokine Storm. Viruses 2021, 13, 1362. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Jie, X.; Liang, X.; Chen, Z.; Xie, P.; Pan, X.; Zhou, B.; Li, J. Sinensetin Suppresses Influenza a Virus-Triggered Inflammation through Inhibition of NF-ΚB and MAPKs Signalings. BMC Complement. Med. Ther. 2020, 20, 135. [Google Scholar] [CrossRef] [Scilit]
- Jhan, M.-K.; HuangFu, W.-C.; Chen, Y.-F.; Kao, J.-C.; Tsai, T.-T.; Ho, M.-R.; Shen, T.-J.; Tseng, P.-C.; Wang, Y.-T.; Lin, C.-F. Anti-TNF-α Restricts Dengue Virus-Induced Neuropathy. J. Leukoc. Biol. 2018, 104, 961–968. [Google Scholar] [CrossRef] [Scilit]
- Satria, R.D.; Huang, T.-W.; Jhan, M.-K.; Shen, T.-J.; Tseng, P.-C.; Wang, Y.-T.; Yang, Z.-Y.; Hsing, C.-H.; Lin, C.-F. Increased TNF-α Initiates Cytoplasmic Vacuolization in Whole Blood Coculture with Dengue Virus. J. Immunol. Res. 2021, 2021, 6654617. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gallitano, S.M.; McDermott, L.; Brar, K.; Lowenstein, E. Use of Tumor Necrosis Factor (TNF) Inhibitors in Patients with HIV/AIDS. J. Am. Acad. Dermatol. 2016, 74, 974–980. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheung, T.K.W.; Poon, L.L.M. Biology of Influenza A Virus. Ann. N. Y. Acad. Sci. 2007, 1102, 1–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- International Committee on Taxonomy of Viruses: ICTV. Available online: https://ictv.global/ (accessed on 18 November 2023).
- Elsayed, S.M.; Hassanein, O.M.; Hassan, N.H.A. Influenza A (H1N1) Virus Infection and TNF-308, IL6, and IL8 Polymorphisms in Egyptian Population: A Case–Control Study. J. Basic Appl. Zool. 2019, 80, 61. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Chen, X.-Y.; Gu, W.-M.; Qian, H.-M.; Tian, Y.; Tang, J.; Cheng, T. A Meta-Analysis of Tumor Necrosis Factor (TNF) Gene Polymorphism and Susceptibility to Influenza A (H1N1). Comput. Biol. Chem. 2020, 89, 107385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gu, Y.; Hsu, A.C.-Y.; Pang, Z.; Pan, H.; Zuo, X.; Wang, G.; Zheng, J.; Wang, F. Role of the Innate Cytokine Storm Induced by the Influenza A Virus. Viral Immunol. 2019, 32, 244–251. [Google Scholar] [CrossRef] [Scilit]
- Rodrigue-Gervais, I.G.; Labbé, K.; Dagenais, M.; Dupaul-Chicoine, J.; Champagne, C.; Morizot, A.; Skeldon, A.; Brincks, E.L.; Vidal, S.M.; Griffith, T.S.; et al. Cellular Inhibitor of Apoptosis Protein CIAP2 Protects against Pulmonary Tissue Necrosis during Influenza Virus Infection to Promote Host Survival. Cell Host Microbe 2014, 15, 23–35. [Google Scholar] [CrossRef] [Scilit]
- Perrone, L.A.; Szretter, K.J.; Katz, J.M.; Mizgerd, J.P.; Tumpey, T.M. Mice Lacking Both TNF and IL-1 Receptors Exhibit Reduced Lung Inflammation and Delay in Onset of Death Following Infection with a Highly Virulent H5N1 Virus. J. Infect. Dis. 2010, 202, 1161–1170. [Google Scholar] [CrossRef] [Scilit]
- Damjanovic, D.; Divangahi, M.; Kugathasan, K.; Small, C.-L.; Zganiacz, A.; Brown, E.G.; Hogaboam, C.M.; Gauldie, J.; Xing, Z. Negative Regulation of Lung Inflammation and Immunopathology by TNF-α during Acute Influenza Infection. Am. J. Pathol. 2011, 179, 2963–2976. [Google Scholar] [CrossRef] [Scilit]
- Shi, X.; Zhou, W.; Huang, H.; Zhu, H.; Zhou, P.; Zhu, H.; Ju, D. Inhibition of the Inflammatory Cytokine Tumor Necrosis Factor-Alpha with Etanercept Provides Protection against Lethal H1N1 Influenza Infection in Mice. Crit. Care 2013, 17, R301. [Google Scholar] [CrossRef] [Scilit]
- Guo, L.; Wang, Y.-C.; Mei, J.-J.; Ning, R.-T.; Wang, J.-J.; Li, J.-Q.; Wang, X.; Zheng, H.-W.; Fan, H.-T.; Liu, L.-D. Pulmonary Immune Cells and Inflammatory Cytokine Dysregulation Are Associated with Mortality of IL-1R1-/-Mice Infected with Influenza Virus (H1N1). Zool. Res. 2017, 38, 146–154. [Google Scholar] [CrossRef] [Scilit]
- Hsu, P.D.; Scott, D.A.; Weinstein, J.A.; Ran, F.A.; Konermann, S.; Agarwala, V.; Li, Y.; Fine, E.J.; Wu, X.; Shalem, O.; et al. DNA Targeting Specificity of RNA-Guided Cas9 Nucleases. Nat. Biotechnol. 2013, 31, 827–832. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takeo, T.; Nakagata, N. In Vitro Fertilization in Mice. Cold Spring Harb. Protoc. 2018, 2018, pdb.prot094524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kulikov, A.V.; Naumenko, V.S.; Voronova, I.P.; Tikhonova, M.A.; Popova, N.K. Quantitative RT-PCR Assay of 5-HT1A and 5-HT2A Serotonin Receptor MRNAs Using Genomic DNA as an External Standard. J. Neurosci. Methods 2005, 141, 97–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naumenko, V.S.; Osipova, D.V.; Kostina, E.V.; Kulikov, A.V. Utilization of a Two-Standard System in Real-Time PCR for Quantification of Gene Expression in the Brain. J. Neurosci. Methods 2008, 170, 197–203. [Google Scholar] [CrossRef] [Scilit]
- Turianova, L.; Lachova, V.; Svetlikova, D.; Kostrabova, A.; Betakova, T. Comparison of Cytokine Profiles Induced by Nonlethal and Lethal Doses of Influenza A Virus in Mice. Exp. Ther. Med. 2019, 18, 4397–4405. [Google Scholar] [CrossRef] [Scilit]
- Gudymo, A.; Onkhonova, G.; Danilenko, A.; Susloparov, I.; Danilchenko, N.; Kosenko, M.; Moiseeva, A.; Kolosova, N.; Svyatchenko, S.; Marchenko, V.; et al. Quantitative Assessment of Airborne Transmission of Human and Animal Influenza Viruses in the Ferret Model. Atmosphere 2023, 14, 471. [Google Scholar] [CrossRef] [Scilit]
- Dolskiy, A.A.; Gudymo, A.S.; Taranov, O.S.; Grishchenko, I.V.; Shitik, E.M.; Prokopov, D.Y.; Soldatov, V.O.; Sobolevskaya, E.V.; Bodnev, S.A.; Danilchenko, N.V.; et al. The Tissue Distribution of SARS-CoV-2 in Transgenic Mice With Inducible Ubiquitous Expression of hACE2. Front. Mol. Biosci. 2022, 8, 821506. [Google Scholar] [CrossRef] [Scilit]

| Name | Sequence 5′-3′ | Reference |
|---|---|---|
| sgRNA | gAGAAAGCATGATCCGCGACG(TGG) | NC_000083.7 |
| Tnf-F | CCCTCCTAACCCGTTTTGCT | NC_000083.7 |
| Tnf-R | TTCCTTGATGCCTGGGTGTC | NC_000083.7 |
| Polr2a-F | TGTGACAACTCCATACAATGC | NM_001291068.1 |
| Polr2a-R | CTCTCTTAGTGAATTTGCGTACT | NM_001291068.1 |
| Tnf-exp-F | AGCCGATGGGTTGTACCTTG | NM_001278601.1 |
| Tnf-exp-R | GGTTGACTTTCTCCTGGTATGAGA | NM_001278601.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Savenkova, D.A.; Gudymo, A.S.; Korablev, A.N.; Taranov, O.S.; Bazovkina, D.V.; Danilchenko, N.V.; Perfilyeva, O.N.; Ivleva, E.K.; Moiseeva, A.A.; Bulanovich, Y.A.; et al. Knockout of the Tnfa Gene Decreases Influenza Virus-Induced Histological Reactions in Laboratory Mice. Int. J. Mol. Sci. 2024, 25, 1156. https://doi.org/10.3390/ijms25021156
Savenkova DA, Gudymo AS, Korablev AN, Taranov OS, Bazovkina DV, Danilchenko NV, Perfilyeva ON, Ivleva EK, Moiseeva AA, Bulanovich YA, et al. Knockout of the Tnfa Gene Decreases Influenza Virus-Induced Histological Reactions in Laboratory Mice. International Journal of Molecular Sciences. 2024; 25(2):1156. https://doi.org/10.3390/ijms25021156
Chicago/Turabian StyleSavenkova, Darya A., Andrey S. Gudymo, Alexey N. Korablev, Oleg S. Taranov, Darya V. Bazovkina, Nataliya V. Danilchenko, Olga N. Perfilyeva, Elena K. Ivleva, Anastasiya A. Moiseeva, Yulia A. Bulanovich, and et al. 2024. "Knockout of the Tnfa Gene Decreases Influenza Virus-Induced Histological Reactions in Laboratory Mice" International Journal of Molecular Sciences 25, no. 2: 1156. https://doi.org/10.3390/ijms25021156
APA StyleSavenkova, D. A., Gudymo, A. S., Korablev, A. N., Taranov, O. S., Bazovkina, D. V., Danilchenko, N. V., Perfilyeva, O. N., Ivleva, E. K., Moiseeva, A. A., Bulanovich, Y. A., Roshchina, E. V., Serova, I. A., Battulin, N. R., Kulikova, E. A., & Yudkin, D. V. (2024). Knockout of the Tnfa Gene Decreases Influenza Virus-Induced Histological Reactions in Laboratory Mice. International Journal of Molecular Sciences, 25(2), 1156. https://doi.org/10.3390/ijms25021156

