Functional Interdependence of Anoctamins May Influence Conclusions from Overexpression Studies
Abstract
1. Introduction
2. Results
2.1. Complete Knockout of ANO6 Versus Acute Knockdown of ANO6: Differences in [Ca2+]i Signaling and Activation of CFTR
2.2. The Function of Anoctamins Is Influenced by ANO6
2.3. The Effects of Anoctamins on [Ca2+]i Signals Depends on Expression of ANO6
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Transfection
4.2. RT-PCR
4.3. Validation of Deletion in Exon5 of ANO6
4.4. Measurement of [Ca2+]i Concentrations
4.5. Patch Clamp
4.6. Flow Cytometry
4.7. Western Blotting
4.8. Biotinylation
4.9. Chemicals and Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Suzuki, J.; Umeda, M.; Sims, P.J.; Nagata, S. Calcium-dependent phospholipid scrambling by TMEM16F. Nature 2010, 468, 834–838. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Kim, A.; David, T.; Palmer, D.; Jin, T.; Tien, J.; Huang, F.; Cheng, T.; Coughlin, S.R.; Jan, Y.N.; et al. TMEM16F Forms a Ca2+-Activated Cation Channel Required for Lipid Scrambling in Platelets during Blood Coagulation. Cell 2012, 151, 111–122. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Schreiber, R.; Kunzelmann, K. Anoctamins are a family of Ca2+ activated Cl− channels. J. Cell Sci. 2012, 125, 4991–4998. [Google Scholar] [CrossRef] [PubMed]
- Pedemonte, N.; Galietta, L.J. Structure and Function of TMEM16 Proteins (Anoctamins). Physiol. Rev. 2014, 94, 419–459. [Google Scholar] [CrossRef]
- Cabrita, I.; Benedetto, R.; Fonseca, A.; Wanitchakool, P.; Sirianant, L.; Skryabin, B.V.; Schenk, L.K.; Pavenstadt, H.; Schreiber, R.; Kunzelmann, K. Differential effects of anoctamins on intracellular calcium signals. FASEB J. 2017, 31, 2123–2134. [Google Scholar] [CrossRef] [PubMed]
- Centeio, R.; Cabrita, I.; Schreiber, R.; Kunzelmann, K. TMEM16A/F support exocytosis but do not inhibit Notch-mediated goblet cell metaplasia of BCi-NS1.1 human airway epithelium. Front. Physiol. 2023, 14, 1157704. [Google Scholar] [CrossRef]
- Schreiber, R.; Cabrita, I.; Kunzelmann, K. Paneth cell secretion in vivo requires expression of Tmem16a and Tmem16f. Gastro Hep Adv. 2022, 1, 1088–1098. [Google Scholar] [CrossRef]
- Deisl, C.; Hilgemann, D.W.; Syeda, R.; Fine, M. TMEM16F and dynamins control expansive plasma membrane reservoirs. Nat. Commun. 2021, 12, 4990. [Google Scholar] [CrossRef]
- Benedetto, R.; Ousingsawat, J.; Cabrita, I.; Pinto, M.; Lerias, J.; Wanitchakool, P.; Schreiber, R.; Kunzelmann, K. Plasma membrane localized TMEM16 Proteins are Indispensable for expression of CFTR. J. Mol. Med. 2019, 97, 711–722. [Google Scholar] [CrossRef]
- Yang, Y.D.; Cho, H.; Koo, J.Y.; Tak, M.H.; Cho, Y.; Shim, W.S.; Park, S.P.; Lee, J.; Lee, B.; Kim, B.M.; et al. TMEM16A confers receptor-activated calcium-dependent chloride conductance. Nature 2008, 455, 1210–1215. [Google Scholar] [CrossRef]
- Jin, X.; Shah, S.; Liu, Y.; Zhang, H.; Lees, M.; Fu, Z.; Lippiat, J.D.; Beech, D.J.; Sivaprasadarao, A.; Baldwin, S.A.; et al. Activation of the Cl- Channel ANO1 by Localized Calcium Signals in Nociceptive Sensory Neurons Requires Coupling with the IP3 Receptor. Sci. Signal 2013, 6, ra73. [Google Scholar] [CrossRef] [PubMed]
- Ousingsawat, J.; Martins, J.R.; Schreiber, R.; Rock, J.R.; Harfe, B.D.; Kunzelmann, K. Loss of TMEM16A causes a defect in epithelial Ca2+ dependent chloride transport. J. Biol. Chem. 2009, 284, 28698–28703. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, R.; Uliyakina, I.; Kongsuphol, P.; Warth, R.; Mirza, M.; Martins, J.R.; Kunzelmann, K. Expression and Function of Epithelial Anoctamins. J. Biol. Chem. 2010, 285, 7838–7845. [Google Scholar] [CrossRef] [PubMed]
- Pietra, G.; Dibattista, M.; Menini, A.; Reisert, J.; Boccaccio, A. The Ca2+-activated Cl- channel TMEM16B regulates action potential firing and axonal targeting in olfactory sensory neurons. J. Gen. Physiol. 2016, 148, 293–311. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zhang, Z.; Xiao, S.; Tien, J.; Le, S.; Le, T.; Jan, L.Y.; Yang, H. Inferior Olivary TMEM16B Mediates Cerebellar Motor Learning. Neuron 2017, 95, 1103–1111.e4. [Google Scholar] [CrossRef]
- Jha, A.; Chung, W.Y.; Vachel, L.; Maleth, J.; Lake, S.; Zhang, G.; Ahuja, M.; Muallem, S. Anoctamin 8 tethers endoplasmic reticulum and plasma membrane for assembly of Ca2+ signaling complexes at the ER/PM compartment. EMBO J. 2020, 38, e101452. [Google Scholar] [CrossRef]
- Lin, W.Y.; Chung, W.Y.; Muallem, S. The tether function of the anoctamins. Cell Calcium 2024, 121, 102875. [Google Scholar] [CrossRef]
- Kim, H.; Kim, H.; Nguyen, L.T.; Ha, T.; Lim, S.; Kim, K.; Kim, S.H.; Han, K.; Hyeon, S.J.; Ryu, H.; et al. Amplification of olfactory signals by Anoctamin 9 is important for mammalian olfaction. Prog. Neurobiol. 2022, 219, 102369. [Google Scholar] [CrossRef]
- Kunzelmann, K.; Ousingsawat, J.; Schreiber, R. Intracellular anoctamins. Cell Calcium 2024, submitted.
- Schiavi, S.C.; Abdelkader, N.; Reber, S.; Pennington, S.; Narayana, R.; McPherson, J.M.; Smith, A.E.; Hoppe, H.t.; Cheng, S.H. Biosynthetic and growth abnormalities are associated with high-level expression of CFTR in heterologous cells. Am. J. Physiol. 1996, 270, C341–C351. [Google Scholar] [CrossRef]
- Grubb, S.; Poulsen, K.A.; Juul, C.A.; Kyed, T.; Klausen, T.K.; Larsen, E.H.; Hoffmann, E.K. TMEM16F (Anoctamin 6), an anion channel of delayed Ca2+ activation. J. Gen. Physiol. 2013, 141, 585–600. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Kim, H.; Lee, J.; Lee, B.; Kim, H.R.; Jung, J.; Lee, M.O.; Oh, U. Anoctamin 9/TMEM16J is a cation channel activated by cAMP/PKA signal. Cell Calcium 2018, 71, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Sirianant, L.; Ousingsawat, J.; Wanitchakool, P.; Schreiber, R.; Kunzelmann, K. Cellular Volume regulation by Anoctamin 6:Ca2+, phospholipase A2,osmosensing. Pflügers Arch 2016, 468, 335–349. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, T.; Iehara, T.; Sato, K.; Fujii, T.; Sakai, H.; Okada, Y. TMEM16F is a component of a Ca2+-activated Cl- channel but not a volume-sensitive outwardly rectifying Cl- channel. Am. J. Physiol. Cell Physiol. 2013, 304, C748–C759. [Google Scholar] [CrossRef]
- Benedetto, R.; Ousingsawat, J.; Wanitchakool, P.; Zhang, Y.; Holtzman, M.J.; Amaral, M.; Rock, J.R.; Schreiber, R.; Kunzelmann, K. Epithelial Chloride Transport by CFTR Requires TMEM16A. Sci. Rep. 2017, 7, 12397. [Google Scholar] [CrossRef]
- Billet, A.; Hanrahan, J.W. The secret life of CFTR as a calcium-activated chloride channel. J. Physiol. 2013, 591, 5273–5278. [Google Scholar] [CrossRef]
- Kunzelmann, K.; Ousingsawat, J.; Kraus, A.; Park, J.H.; Marquardt, T.; Schreiber, R.; Buchholz, B. Pathogenic Relationships in Cystic Fibrosis and Renal Diseases: CFTR, SLC26A9 and Anoctamins. Int. J. Mol. Sci. 2023, 24, 13278. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, R.; Talbi, K.; Ousingsawat, J.; Kunzelmann, K. A TMEM16J variant leads to dysregulated cytosolic calcium which may lead to renal disease. FASEB J. 2023, 37, e22683. [Google Scholar] [CrossRef]
- Kunzelmann, K.; Cabrita, I.; Wanitchakool, P.; Ousingsawat, J.; Sirianant, L.; Benedetto, R.; Schreiber, R. Modulating Ca2+ signals: A common theme for TMEM16, Ist2, and TMC. Pflügers Arch 2016, 468, 475–490. [Google Scholar] [CrossRef]
- Ousingsawat, J.; Talbi, K.; Gómez-Martín, H.; Koy, A.; Fernández-Jaén, A.; Tekgül, H.; Serdaroğlu, E.; Schreiber, R.; Ortigoza-Escobar, J.D.; Kunzelmann, K. Broadening the clinical spectrum: Molecular mechanisms and new phenotypes of ANO3-dystonia. Brain 2023, 147, 1982–1995. [Google Scholar] [CrossRef]
- Schreiber, R.; Ousingsawat, J.; Kunzelmann, K. The anoctamins: Structure and function. Cell Calcium 2024, 120, 102885. [Google Scholar] [CrossRef] [PubMed]
- Bricogne, C.; Fine, M.; Pereira, P.M.; Sung, J.; Tijani, M.; Wang, Y.; Henriques, R.; Collins, M.K.; Hilgemann, D. TMEM16F activation by Ca2+ triggers plasma membrane expansion and directs PD-1 trafficking. Sci. Rep. 2019, 9, 619. [Google Scholar] [CrossRef] [PubMed]
- Mattheij, N.J.; Braun, A.; van Kruchten, R.; Castoldi, E.; Pircher, J.; Baaten, C.C.; Wulling, M.; Kuijpers, M.J.; Kohler, R.; Poole, A.W.; et al. Survival protein anoctamin-6 controls multiple platelet responses including phospholipid scrambling, swelling, and protein cleavage. FASEB J. 2015, 30, 727–737. [Google Scholar] [CrossRef]
- Ehlen, H.W.; Chinenkova, M.; Moser, M.; Munter, H.M.; Krause, Y.; Gross, S.; Brachvogel, B.; Wuelling, M.; Kornak, U.; Vortkamp, A. Inactivation of Anoctamin-6/Tmem16f, a regulator of phosphatidylserine scrambling in osteoblasts, leads to decreased mineral deposition in skeletal tissues. J. Bone Miner. Res. 2012, 28, 246–259. [Google Scholar] [CrossRef]
- Ousingsawat, J.; Wanitchakool, P.; Schreiber, R.; Wuelling, M.; Vortkamp, A.; Kunzelmann, K. Anoctamin 6 controls bone mineralization by activating the calcium transporter NCX1. J. Biol. Chem. 2015, 290, 6270–6280. [Google Scholar] [CrossRef]
- Ousingsawat, J.; Wanitchakool, P.; Kmit, A.; Romao, A.M.; Jantarajit, W.; Schreiber, S.; Kunzelmann, K. Anoctamin 6 mediates effects essential for innate immunity downstream of P2X7-receptors in macrophages. Nat. Commun. 2015, 6, 6245. [Google Scholar] [CrossRef] [PubMed]
- Petkovic, M.; Oses-Prieto, J.; Burlingame, A.; Jan, L.Y.; Jan, Y.N. TMEM16K is an interorganelle regulator of endosomal sorting. Nat. Commun. 2020, 11, 3298. [Google Scholar] [CrossRef]
- Sommer, A.; Kordowski, F.; Buch, J.; Maretzky, T.; Evers, A.; Andra, J.; Dusterhoft, S.; Michalek, M.; Lorenzen, I.; Somasundaram, P.; et al. Phosphatidylserine exposure is required for ADAM17 sheddase function. Nat. Commun. 2016, 7, 11523. [Google Scholar] [CrossRef]
- Tuomivaara, S.T.; Teo, C.F.; Jan, Y.N.; Wiita, A.P.; Jan, L.Y. SLAPSHOT reveals rapid dynamics of extracellularly exposed proteome in response to calcium-activated plasma membrane phospholipid scrambling. Commun. Biol. 2024, 7, 1060. [Google Scholar] [CrossRef]
- Ousingsawat, J.; Schreiber, R.; Kunzelmann, K. TMEM16F/Anoctamin 6 in Ferroptotic Cell Death. Cancers 2019, 11, 625. [Google Scholar] [CrossRef]
- Lerias, J.; Pinto, M.; Benedetto, R.; Schreiber, R.; Amaral, M.; Aureli, M.; Kunzelmann, K. Compartmentalized crosstalk of CFTR and TMEM16A (ANO1) through EPAC1 and ADCY1. Cell. Signal. 2018, 44, 10–19. [Google Scholar] [CrossRef] [PubMed]
- Cabrita, I.; Benedetto, R.; Schreiber, R.; Kunzelmann, K. Niclosamide repurposed for the treatment of inflammatory airway disease. JCI Insight 2019, 8, 128414. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, J.; Fujii, T.; Imao, T.; Ishihara, K.; Kuba, H.; Nagata, S. Calcium-dependent Phospholipid Scramblase Activity of TMEM16 Family Members. J. Biol. Chem. 2013, 288, 13305–13316. [Google Scholar] [CrossRef]
- Tsuji, T.; Cheng, J.; Tatematsu, T.; Ebata, A.; Kamikawa, H.; Fujita, A.; Gyobu, S.; Segawa, K.; Arai, H.; Taguchi, T.; et al. Predominant localization of phosphatidylserine at the cytoplasmic leaflet of the ER, and its TMEM16K-dependent redistribution. Proc. Natl. Acad. Sci. USA 2019, 116, 13368–13373. [Google Scholar] [CrossRef] [PubMed]
- Gyobu, S.; Ishihara, K.; Suzuki, J.; Segawa, K.; Nagata, S. Characterization of the scrambling domain of the TMEM16 family. Proc. Natl. Acad. Sci. USA 2017, 114, 6274–6279. [Google Scholar] [CrossRef]
- Bushell, S.R.; Pike, A.C.W.; Falzone, M.E.; Rorsman, N.J.G.; Ta, C.M.; Corey, R.A.; Newport, T.D.; Christianson, J.C.; Scofano, L.F.; Shintre, C.A.; et al. The structural basis of lipid scrambling and inactivation in the endoplasmic reticulum scramblase TMEM16K. Nat. Commun. 2019, 10, 3956. [Google Scholar] [CrossRef]
Gene Accession Number | Primer | Size (bp) |
---|---|---|
human ANO1 NM_018043 | s: 5′- CGACTACGTGTACATTTTCCG as: 5′- GATTCCGATGTCTTTGGCTC | 445 |
human ANO2 NM_001278596 | s: 5′- GTCTCAAGATGCCAGGTCCC as: 5′- CTGCCTCCTGCTTTGATCTC | 553 |
human ANO3 NM_001313726 | s: 5′- CTTCCCTCTTCCAGTCAAC as: 5′- AAACATGATATCGGGGCTTG | 461 |
human ANO4 NM_001286615 | s: 5′- CGGAAGATTTACAGGACACCC as: 5′- GATAACAGAGAGAATTCCAATGC | 505 |
human ANO5 NM_213599 | s: 5′- GAATGGGACCTGGTGGAC as: 5′- GAGTTTGTCCGAGCTTTTCG | 713 |
human T ANO6 NM_001025356 | s: 5′- GGAGTTTTGGAAGCGACGC as: 5′- GTATTTCTGGATTGGGTCTG | 325 |
human ANO7 NM_001370694 | s: 5′- CTCGGGAGTGACAACCAGG as: 5′- CAAAGTGGGCACATCTCGAAG | 470 |
human ANO8 NM_020959 | s: 5´- GGAGGACCAG CCAATCATC as: 5´- TCCATGTCATTGAGCCAG | 705 |
human ANO9 NM_001012302 | s: 5′- GCAGCCAGTTGATGAAATC as: 5′- GCTGCGTAGGTAGGAGTGC | 472 |
human ANO10 NM_018075 | s: 5′- GTGAAGAGGAAGGTGCAGG as: 5′- GCCACTGCGAAACTGAGAAG | 769 |
human GAPDH NM_001289726 | s: 5′-GTATTGGGCGCCTGGTCAC as: 5′-CTCCTGGAAGATGGTGATGG | 200 |
Exon 5, ANO6 | s: 5′- GTATTTGTAAAAGTACACGCACC as: 5′- GAGGATGAGCCCATTCTCTG | 463 404 |
Exon5, ANO6, Sequencing | s: 5′- CAAATGGAGGAGGAGGAGGA as: 5′- GAGGATGAGCCCATTCTCTG | 796 |
Sequencing Primer | s: 5′- CAAATGGAGGAGGAGGAGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ousingsawat, J.; Schreiber, R.; Kunzelmann, K. Functional Interdependence of Anoctamins May Influence Conclusions from Overexpression Studies. Int. J. Mol. Sci. 2024, 25, 9998. https://doi.org/10.3390/ijms25189998
Ousingsawat J, Schreiber R, Kunzelmann K. Functional Interdependence of Anoctamins May Influence Conclusions from Overexpression Studies. International Journal of Molecular Sciences. 2024; 25(18):9998. https://doi.org/10.3390/ijms25189998
Chicago/Turabian StyleOusingsawat, Jiraporn, Rainer Schreiber, and Karl Kunzelmann. 2024. "Functional Interdependence of Anoctamins May Influence Conclusions from Overexpression Studies" International Journal of Molecular Sciences 25, no. 18: 9998. https://doi.org/10.3390/ijms25189998
APA StyleOusingsawat, J., Schreiber, R., & Kunzelmann, K. (2024). Functional Interdependence of Anoctamins May Influence Conclusions from Overexpression Studies. International Journal of Molecular Sciences, 25(18), 9998. https://doi.org/10.3390/ijms25189998