Characteristics of a Novel Zearalenone Lactone Hydrolase ZHRnZ and Its Thermostability Modification
Abstract
1. Introduction
2. Results and Discussion
2.1. Bioinformatics Analysis of ZHRnZ and Its Molecular Docking with ZEN
2.2. Gene Cloning, Expression and Purification of ZHRnZ
2.3. Enzymatic Properties of Recombinant ZHRnZ
2.4. Single Point Mutation Improves the Thermostability of ZHRnZ
2.5. The Enzymatic Kinetic Parameters of WT, E122Q and E122R
3. Materials and Methods
3.1. Plasmids, Strains and Chemicals
3.2. Bioinformatics Analysis and Molecular Docking
3.3. Gene Cloning, Expression and Purification of Recombinant ZHRnZ
3.4. Enzymatic Activity Assay
3.5. Enzymatic Characteristics of Recombinant ZHRnZ
3.6. Single Point Mutation of ZHRnZ
3.7. The Kinetic Parameters of Enzymatic Reactions of Recombinant ZHRnZ, E122Q and E122R
3.8. Determination of ZEN
3.9. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lahjouji, T.; Bertaccini, A.; Neves, M.; Puel, S.; Oswald, I.P.; Soler, L. Acute Exposure to Zearalenone Disturbs Intestinal Homeostasis by Modulating the Wnt/β-Catenin Signaling Pathway. Toxins 2020, 12, 113. [Google Scholar] [CrossRef] [PubMed]
- Fruhauf, S.; Novak, B.; Nagl, V.; Hackl, M.; Hartinger, D.; Rainer, V.; Labudová, S.; Adam, G.; Aleschko, M.; Moll, W.-D.; et al. Biotransformation of the Mycotoxin Zearalenone to Its Metabolites Hydrolyzed Zearalenone (HZEN) and Decarboxylated Hydrolyzed Zearalenone (DHZEN) Diminishes Its Estrogenicity In Vitro and In Vivo. Toxins 2019, 11, 481. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Fu, W.; Zhao, X.; Chang, X.; Liu, H.; Zhou, L.; Li, J.; Cheng, R.; Wu, X.; Li, X.; et al. Zearalenone Disturbs the Reproductive-Immune Axis in Pigs: The Role of Gut Microbial Metabolites. Microbiome 2022, 10, 234. [Google Scholar] [CrossRef] [PubMed]
- Abid-Essefi, S.; Ouanes, Z.; Hassen, W.; Baudrimont, I.; Creppy, E.; Bacha, H. Cytotoxicity, Inhibition of DNA and Protein Syntheses and Oxidative Damage in Cultured Cells Exposed to Zearalenone. Toxicol. In Vitro 2004, 18, 467–474. [Google Scholar] [CrossRef]
- Zhu, L.; Yuhan, J.; Huang, K.; He, X.; Liang, Z.; Xu, W. Multidimensional Analysis of the Epigenetic Alterations in Toxicities Induced by Mycotoxins. Food Chem. Toxicol. 2021, 153, 112251. [Google Scholar] [CrossRef]
- Hagler, W.M.; Mirocha, C.J.; Pathre, S.V.; Behrens, J.C. Identification of the Naturally Occurring Isomer of Zearalenol Produced by Fusarium Roseum “Gibbosum” in Rice Culture. Appl. Environ. Microbiol. 1979, 37, 849–853. [Google Scholar] [CrossRef]
- Smaoui, S.; D’Amore, T.; Tarapoulouzi, M.; Agriopoulou, S.; Varzakas, T. Aflatoxins Contamination in Feed Commodities: From Occurrence and Toxicity to Recent Advances in Analytical Methods and Detoxification. Microorganisms 2023, 11, 2614. [Google Scholar] [CrossRef]
- Liu, L.; Xie, M.; Wei, D. Biological Detoxification of Mycotoxins: Current Status and Future Advances. Int. J. Mol. Sci. 2022, 23, 1064. [Google Scholar] [CrossRef]
- Ding, S.; Lin, C.; Xiao, Q.; Feng, F.; Wang, J.; Zhang, X.; Yang, S.; Li, L.; Li, F. Effective Degradation of Zearalenone by Dye-Decolorizing Peroxidases from Pleurotus Ostreatus and Its Metabolic Pathway and Toxicity Analysis. Sci. Total Environ. 2024, 908, 168500. [Google Scholar] [CrossRef]
- Yang, X.; Li, F.; Ning, H.; Zhang, W.; Niu, D.; Shi, Z.; Chai, S.; Shan, A. Screening of Pig-Derived Zearalenone-Degrading Bacteria through the Zearalenone Challenge Model, and Their Degradation Characteristics. Toxins 2022, 14, 224. [Google Scholar] [CrossRef]
- Sun, X.; He, X.; Xue, K.S.; Li, Y.; Xu, D.; Qian, H. Biological Detoxification of Zearalenone by Aspergillus Niger Strain FS10. Food Chem. Toxicol. 2014, 72, 76–82. [Google Scholar] [CrossRef]
- Guo, Y.; Wang, Y.; Liu, Y.; Ma, Q.; Ji, C.; Zhao, L. Detoxification of the Mycoestrogen Zearalenone by Bacillus Licheniformis Spore CotA Laccase and Application of Immobilized Laccase in Contaminated Corn Meal. LWT 2022, 163, 113548. [Google Scholar] [CrossRef]
- Guo, Y.; Wang, Y.; Tang, Y.; Ma, Q.; Ji, C.; Zhao, L. Combined in Silico Investigation and in Vitro Characterization of the Zearalenone Detoxification Potential of Dye-Decolorizing Peroxidase from Bacillus Subtilis 168. Food Control 2023, 146, 109549. [Google Scholar] [CrossRef]
- Kakeya, H.; Takahashi-Ando, N.; Kimura, M.; Onose, R.; Yamaguchi, I.; Osada, H. Biotransformation of the Mycotoxin, Zearalenone, to a Non-Estrogenic Compound by a Fungal Strain of Clonostachys Sp. Biosci. Biotechnol. Biochem. 2002, 66, 2723–2726. [Google Scholar] [CrossRef]
- Vekiru, E.; Fruhauf, S.; Hametner, C.; Schatzmayr, G.; Krska, R.; Moll, W.D.; Schuhmacher, R. Isolation and Characterisation of Enzymatic Zearalenone Hydrolysis Reaction Products. World Mycotoxin J. 2016, 9, 353–364. [Google Scholar] [CrossRef]
- Gao, H.; Lu, D.; Xing, M.; Xu, Q.; Xue, F. Excavation, Expression, and Functional Analysis of a Novel Zearalenone-Degrading Enzyme. Folia Microbiol. (Praha) 2022, 67, 633–640. [Google Scholar] [CrossRef]
- Hu, J.; Wang, G.; Hou, M.; Du, S.; Han, J.; Yu, Y.; Gao, H.; He, D.; Shi, J.; Lee, Y.-W.; et al. New Hydrolase from Aeromicrobium Sp. HA for the Biodegradation of Zearalenone: Identification, Mechanism, and Application. J. Agric. Food Chem. 2023, 71, 2411–2420. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Xu, W.; Wu, H.; Zhang, W.; Mu, W. Identification of a Potent Enzyme for the Detoxification of Zearalenone. J. Agric. Food Chem. 2020, 68, 376–383. [Google Scholar] [CrossRef]
- Zhang, Y.; Ouyang, B.; Zhang, W.; Guang, C.; Xu, W.; Mu, W. An Overview of Chemical, Physical and Biological Methods for Zearalenone Elimination: Recent Advances and Future Prospective. Food Control 2023, 154, 110011. [Google Scholar] [CrossRef]
- Qiu, Y.; Xu, H.; Ji, Q.; Xu, R.; Zhu, M.; Dang, Y.; Shi, X.; Zhang, L.; Xia, Y. Mutation, Food-Grade Expression, and Characterization of a Lactonase for Zearalenone Degradation. Appl. Microbiol. Biotechnol. 2023, 107, 5107–5118. [Google Scholar] [CrossRef]
- Fang, Y.; Huang, Z.; Xu, W.; Wang, C.; Sun, Y.; Zhang, W.; Guang, C.; Mu, W. Efficient Elimination of Zearalenone at High Processing Temperatures by a Robust Mutant of Gliocladium Roseum Zearalenone Lactonase. Food Control 2022, 142, 109222. [Google Scholar] [CrossRef]
- Yu, X.; Tu, T.; Luo, H.; Huang, H.; Su, X.; Wang, Y.; Wang, Y.; Zhang, J.; Bai, Y.; Yao, B. Biochemical Characterization and Mutational Analysis of a Lactone Hydrolase from Phialophora Americana. J. Agric. Food Chem. 2020, 68, 2570–2577. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liu, X.; Zhang, Y.; Zhang, X.; Huang, H. Cloning and Characterization of Three Novel Enzymes Responsible for the Detoxification of Zearalenone. Toxins 2022, 14, 82. [Google Scholar] [CrossRef] [PubMed]
- Bi, K.; Zhang, W.; Xiao, Z.; Zhang, D. Characterization, Expression and Application of a Zearalenone Degrading Enzyme from Neurospora Crassa. AMB Express 2018, 8, 194. [Google Scholar] [CrossRef]
- Chen, S.; Pan, L.; Liu, S.; Pan, L.; Li, X.; Wang, B. Recombinant Expression and Surface Display of a Zearalenone Lactonohydrolase from Trichoderma Aggressivum in Escherichia Coli. Protein Expr. Purif. 2021, 187, 105933. [Google Scholar] [CrossRef]
- Shi, J.; Mwabulili, F.; Xie, Y.; Yang, Y.; Sun, S.; Li, Q.; Ma, W.; Jia, H. Characterization, Structural Analysis, and Thermal Stability Mutation of a New Zearalenone-Degrading Enzyme Mined from Bacillus Subtilis. J. Agric. Food Chem. 2024, 72, 3025–3035. [Google Scholar] [CrossRef]
- Hui, R.; Hu, X.; Liu, W.; Liu, W.; Zheng, Y.; Chen, Y.; Guo, R.-T.; Jin, J.; Chen, C.-C. Characterization and Crystal Structure of a Novel Zearalenone Hydrolase from Cladophialophora Bantiana. Acta Crystallogr. Sect. F Struct. Biol. Commun. 2017, 73, 515–519. [Google Scholar] [CrossRef]
- Wang, Z.; Luo, F.; Jiang, S.; Selvaraj, J.N.; Zhou, Y.; Zhang, G. Biochemical Characterization and Molecular Modification of a Zearalenone Hydrolyzing Enzyme Zhd11D from Phialophora Attinorum. Enzyme Microb. Technol. 2023, 170, 110286. [Google Scholar] [CrossRef]
- Wang, M.; Yin, L.; Hu, H.; Selvaraj, J.N.; Zhou, Y.; Zhang, G. Expression, Functional Analysis and Mutation of a Novel Neutral Zearalenone-Degrading Enzyme. Int. J. Biol. Macromol. 2018, 118, 1284–1292. [Google Scholar] [CrossRef]
- Peng, W.; Ko, T.-P.; Yang, Y.; Zheng, Y.; Chen, C.-C.; Zhu, Z.; Huang, C.-H.; Zeng, Y.-F.; Huang, J.-W.; Liu, J.-R.; et al. Crystal Structure and Substrate-Binding Mode of the Mycoestrogen-Detoxifying Lactonase ZHD From. RSC Adv. 2014, 4, 62321–62325. [Google Scholar] [CrossRef]
- Zhou, H.; Li, L.; Zhan, B.; Wang, S.; Li, J.; Hu, X.-J. The Trp183 Is Essential in Lactonohydrolase ZHD Detoxifying Zearalenone and Zearalenols. Biochem. Biophys. Res. Commun. 2020, 522, 986–989. [Google Scholar] [CrossRef] [PubMed]
- Massart, F.; Saggese, G. Oestrogenic Mycotoxin Exposures and Precocious Pubertal Development. Int. J. Androl. 2010, 33, 369–376. [Google Scholar] [CrossRef]
- Gari, J.; Abdella, R. Degradation of Zearalenone by Microorganisms and Enzymes. PeerJ 2023, 11, e15808. [Google Scholar] [CrossRef]
- Xing, X.; Chen, X.; You, X.; Huang, J.; Xue, D. Zearalenone Degrading Enzyme Evolution to Increase the Hydrolysis Efficiency under Acidic Conditions by the Rational Design. Food Chem. 2024, 456, 140088. [Google Scholar] [CrossRef] [PubMed]
- Fruhauf, S.; Pühringer, D.; Thamhesl, M.; Fajtl, P.; Kunz-Vekiru, E.; Höbartner-Gussl, A.; Schatzmayr, G.; Adam, G.; Damborsky, J.; Djinovic-Carugo, K.; et al. Bacterial Lactonases ZenA with Noncanonical Structural Features Hydrolyze the Mycotoxin Zearalenone. ACS Catal. 2024, 14, 3392–3410. [Google Scholar] [CrossRef] [PubMed]
- Klaewkla, M.; Pichyangkura, R.; Chunsrivirot, S. Computational Design of Oligosaccharide-Producing Levansucrase from Bacillus Licheniformis RN-01 to Increase Its Stability at High Temperature. J. Phys. Chem. B 2021, 125, 5766–5774. [Google Scholar] [CrossRef]
Enzyme | Source | Optimal Temperature (°C)/pH | Thermostability | References |
---|---|---|---|---|
ZHD_LD | Exophiala spinifera | 50/7.0–10.0 | NR a | [16] |
ZenH | Aeromicrobium sp. HA | 55/7.0 | Lost activity at 40 °C for 2 min | [17] |
ZENG | Gliocladium roseum | 38/7.0 | Retained 20% residual activity at 48 °C for 7 min, 10% at 53 °C for 2 min | [18] |
H134L/S136L | Gliocladium roseum | NR | Retained 50% residual activity at 48 °C for 7 min, 50% at 53 °C for 2 min | [18] |
H134F/S136F | Gliocladium roseum | NR | Retained 70% residual activity at 48 °C for 7 min, 44% at 53 °C for 2 min | [18] |
S162P/S220R | Gliocladium roseum | NR | Retained 90% residual activity at 55 °C for 10 min | [21] |
ZHD607 | Phialophora americana | 35/8.0 | Retained 56% residual activity at 40 °C for 10 min, 20% for 30 min | [22] |
TRI | Trichoderma aggressivum | 40/9.5 | Retained 25% residual activity at 50 °C for 10 min, 20% at 65 °C for 2 min | [23] |
ZENC | Neurospora crassa | 45/8.0 | Lost activity at 60 °C for 1 min | [24] |
ZHD-P | Trichoderma agressivum | 45/7.5–9.0 | Remained activity at 25–40 °C for 1 h, retained 40% residual activity at 45 °C for 1 h | [25] |
ZENY | Bacillus subtilis YT-4 | 37/8.0 | Retained 50% residual activity at 45 °C for 10 min, 40% at 50 °C for 10 min | [26] |
NΔ11 | Bacillus subtilis YT-4 | NR | Retained 63% residual activity at 45 °C for 10 min, 45% at 50 °C for 10 min | [26] |
N5V | Bacillus subtilis YT-4 | NR | Retained 77% residual activity at 45 °C for 10 min, 50% at 50 °C for 10 min | [26] |
CbZHD | Cladophialophora batiana | 35/8.0 | Retained 40% residual activity at 40 °C for 2 min | [27] |
Zhd11D | Phialophora attinorum | 35/8.0 | Retained 40% residual activity at 40 °C for 20 min, 15% for 60 min | [28] |
S1-Zhd11D | Phialophora attinorum | 35/8.0 | Retained 75% residual activity at 40 °C for 20 min, 35% for 60 min | [28] |
Zhd518 | Rhinocladiella mackenziei | 40/8.0 | Remained activity at 20–40 °C for 30 min, retained 25% residual activity at 45 °C for 10 min | [29] |
ZHRnZ | Rosellinia necatrix | 45/9.0 | Retained 42% residual activity at 40 °C for 5 min, lost activity at 50 °C for 2 min | this study |
E122Q | Rosellinia necatrix | NR | Retained 79% residual activity at 40 °C for 15 min, 44% at 50 °C for 2 min | this study |
E122R | Rosellinia necatrix | NR | Retained 29% residual activity at 50 °C for 2 min, 13% at 60 °C for 1 min | this study |
Mutation | Mutation Energy | Effect of Mutation |
---|---|---|
A:GLU122 > ARG | −0.77 | STABILIZING |
A:GLU122 > CYS | −1.47 | STABILIZING |
A:GLU122 > GLN | −1.3 | STABILIZING |
A:GLU122 > HIS | −1.05 | STABILIZING |
A:GLU122 > ILE | −1.69 | STABILIZING |
A:GLU122 > LEU | −0.97 | STABILIZING |
A:GLU122 > LYS | −0.68 | STABILIZING |
A:GLU122 > MET | −0.96 | STABILIZING |
A:GLU122 > PHE | −1.1 | STABILIZING |
A:GLU122 > SER | −0.99 | STABILIZING |
A:GLU122 > THR | −1.28 | STABILIZING |
A:GLU122 > TRP | −1.72 | STABILIZING |
A:GLU122 > TYR | −0.91 | STABILIZING |
A:GLU122 > VAL | −1.3 | STABILIZING |
A:GLU122 > ALA | −0.39 | NEUTRAL |
A:GLU122 > ASN | −0.46 | NEUTRAL |
A:GLU122 > ASP | 0.21 | NEUTRAL |
A:GLU122 > GLU | 0.02 | NEUTRAL |
A:GLU122 > GLY | 0.25 | NEUTRAL |
A:TYR120 > CYS | 0.45 | NEUTRAL |
A:TYR120 > LEU | 0.02 | NEUTRAL |
A:TYR120 > PHE | 0.04 | NEUTRAL |
A:TYR120 > TRP | −0.2 | NEUTRAL |
A:TYR120 > TYR | 0.01 | NEUTRAL |
A:GLU122 > PRO | 3.46 | DESTABILIZING |
A:TYR120 > ALA | 1.56 | DESTABILIZING |
A:TYR120 > ARG | 1.88 | DESTABILIZING |
A:TYR120 > ASN | 1.39 | DESTABILIZING |
A:TYR120 > ASP | 2.14 | DESTABILIZING |
A:TYR120 > GLN | 1.23 | DESTABILIZING |
A:TYR120 > GLU | 2.78 | DESTABILIZING |
A:TYR120 > GLY | 2.6 | DESTABILIZING |
A:TYR120 > HIS | 0.83 | DESTABILIZING |
A:TYR120 > ILE | 0.6 | DESTABILIZING |
A:TYR120 > LYS | 1.51 | DESTABILIZING |
A:TYR120 > MET | 1.21 | DESTABILIZING |
A:TYR120 > PRO | 8.02 | DESTABILIZING |
A:TYR120 > SER | 1.69 | DESTABILIZING |
A:TYR120 > THR | 1.47 | DESTABILIZING |
A:TYR120 > VAL | 0.72 | DESTABILIZING |
Enzyme | Km (μg·mL−1) | Vmax (μg·mL−1·s−1) | Kcat (s−1) | Kcat/Km (s−1·μg−1·mL) |
---|---|---|---|---|
WT | 21.51 | 0.06051 | 0.00242 | 1.13 × 10−4 |
E122Q | 86.38 | 0.1853 | 0.00741 | 0.86 × 10−4 |
E122R | 8.123 | 0.03004 | 0.001202 | 1.48 × 10−4 |
Mutant | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
E122H | CGCAGCGCACGCGATGCGGATAACCCGCC | GGCGGGTTATCCGCATCGCGTGCGCTGCG |
E122I | GCAGCGCACGCGTATCGGATAACCCGCC | GGCGGGTTATCCGATACGCGTGCGCTGC |
E122W | GGCGGGTTATCCGTGGCGCGTGCGCTGCG | CGCAGCGCACGCGCCACGGATAACCCGCC |
E122Q | GGCGGGTTATCCGCAGCGCGTGCGCTGCGC | GCGCAGCGCACGCGCTGCGGATAACCCGCC |
E122M | GGCGGGTTATCCGATGCGCGTGCGCTGCGC | GCGCAGCGCACGCGCATCGGATAACCCGCC |
E122K | GTGGCGGGTTATCCGAAACGCGTGCGCTGC | GCAGCGCACGCGTTTCGGATAACCCGCCAC |
E122T | GGCGGGTTATCCGACCCGCGTGCGCTGCGC | GCGCAGCGCACGCGGGTCGGATAACCCGCC |
E122S | GTGGCGGGTTATCCGAGCCGCGTGCGCTGCGC | GCGCAGCGCACGCGGCTCGGATAACCCGCCAC |
E122L | GTGGCGGGTTATCCGCTGCGCGTGCGCTGCGC | GCGCAGCGCACGCGCAGCGGATAACCCGCCAC |
E122R | GTGGCGGGTTATCCGCGTCGCGTGCGCTGCGC | GCGCAGCGCACGCGACGCGGATAACCCGCCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, X.; Wang, Y.; Fang, X.; Tang, Y.; Wang, G.; Guo, Y.; Yuan, J.; Zhao, L. Characteristics of a Novel Zearalenone Lactone Hydrolase ZHRnZ and Its Thermostability Modification. Int. J. Mol. Sci. 2024, 25, 9665. https://doi.org/10.3390/ijms25179665
Liu X, Wang Y, Fang X, Tang Y, Wang G, Guo Y, Yuan J, Zhao L. Characteristics of a Novel Zearalenone Lactone Hydrolase ZHRnZ and Its Thermostability Modification. International Journal of Molecular Sciences. 2024; 25(17):9665. https://doi.org/10.3390/ijms25179665
Chicago/Turabian StyleLiu, Xinlan, Yanan Wang, Xin Fang, Yu Tang, Gaigai Wang, Yongpeng Guo, Jianmin Yuan, and Lihong Zhao. 2024. "Characteristics of a Novel Zearalenone Lactone Hydrolase ZHRnZ and Its Thermostability Modification" International Journal of Molecular Sciences 25, no. 17: 9665. https://doi.org/10.3390/ijms25179665
APA StyleLiu, X., Wang, Y., Fang, X., Tang, Y., Wang, G., Guo, Y., Yuan, J., & Zhao, L. (2024). Characteristics of a Novel Zearalenone Lactone Hydrolase ZHRnZ and Its Thermostability Modification. International Journal of Molecular Sciences, 25(17), 9665. https://doi.org/10.3390/ijms25179665