Characterization and Functional Analysis of the 17-Beta Hydroxysteroid Dehydrogenase 2 (hsd17b2) Gene during Sex Reversal in the Ricefield Eel (Monopterus albus)
Abstract
:1. Introduction
2. Results
2.1. Identification of hsd17b2 cDNA in Ricefield Eel
2.2. Expression Profiles of Mahsd17b2 mRNA in Ricefield Eel Tissues
2.3. The Cellular Localization of hsd17b2 mRNA in Gonads
2.4. The hsd17b2 mRNA Expression in Gonads Regulated by Sex Hormone
3. Materials and Methods
3.1. Animals and Ethics Statements
3.2. RNA Extraction and cDNA Synthesis
3.3. Cloning of the hsd17b2 cDNA Fragment
3.4. Sequence Analysis
3.5. Gene Expression Analysis by RT-qPCR
3.6. Chemical in Situ Hybridization (CISH)
3.7. Hormonal Treatment on Gonadal Tissues
4. Discussion
4.1. Mahsd17b2 Gene Belongs to the 17-Beta Hydroxysteroid Dehydrogenase 2 Family
4.2. Mahsd17b2 mRNA Expressed in Ovaries at the Early Stage
4.3. The Role of Mahsd17b2 in Maintaining the Balance of Sex Hormones in Ricefield Eel Gonads
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviation
aa | Amino Acid |
BV | Blood Vessels |
cDNA | Complementary DNA |
DIG | Digoxin |
DO | Degenerated Oocytes |
E2 | 17β-estradiol |
E2I | Estradiol Inhibitor (Tamoxifen) |
FC | Follicular Cell |
GL | Gonadal Lamellas |
HPG | Hypothalamic Pituitary Gonadal |
Hsd17b2 | 17-Beta Hydroxysteroid Dehydrogenase 2 |
MT | Melatonin |
AI | Androgen Inhibitor (Flutamide) |
MC | Mesenchyme Cluster |
NJ | Neighbor-Joining |
OT1 | Ovotestis at the Early Stage |
OT2 | Ovotestis at the Middle Stage |
Ov1 | Ovaries from Juvenile Fish |
Ov2 | Ovaries from Young Fish |
Ov3 | Ovaries from Adult Fish |
Ovo-early | Ovary at the Early Stage |
Ovo-medium | Ovary at the Developed Stage |
Ovo-tes-early | Ovotestis at the Early Stage |
Ovo-tes-late | Ovotestis at the Late Stage |
RT-PCR | Reverse Transcription Polymerase Chain Reaction |
RT-qPCR | Real-Time quantitative Polymerase Chain Reaction |
Sc1 | Primary Spermatocyte |
Sc2 | Secondary Spermatocyte |
SDRs | Short-Chain Dehydrogenases/Reductases |
Spm | Spermatids |
Sp | Sperm |
T | testosterone |
Te | Testis |
Zar1 | Zygote Arrest-1 |
References
- Kallberg, Y.; Oppermann, U.; Jörnvall, H.; Persson, B. Short-chain dehydrogenases/reductases (SDRs). Eur. J. Biochem. 2002, 269, 4409–4417. [Google Scholar] [CrossRef]
- Peltoketo, H.; Luu-The, V.; Simard, J.; Adamski, J. 17beta-hydroxysteroid dehydrogenase (HSD)/17-ketosteroid reductase (KSR) family; nomenclature and main characteristics of the 17HSD/KSR enzymes. J. Mol. Endocrinol. 1999, 23, 1–11. [Google Scholar] [CrossRef]
- Boucher, E.; Provost, P.; Plante, J.; Tremblay, Y. Androgen receptor and 17beta-HSD type 2 regulation in neonatal mouse lung development. Mol. Cell Endocrinol. 2009, 311, 109–119. [Google Scholar] [CrossRef] [PubMed]
- Labrie, F.; Luu-The, V.; Lin, S.; Simard, J.; Labrie, C.; El-Alfy, M.; Pelletier, G.; Bélanger, A. Intracrinology: Role of the family of 17 beta-hydroxysteroid dehydrogenases in human physiology and disease. J. Mol. Endocrinol. 2000, 25, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Lukacik, P.; Kavanagh, K.; Oppermann, U. Structure and function of human 17beta-hydroxysteroid dehydrogenases. Mol. Cell. Endocrinol. 2006, 248, 61–71. [Google Scholar] [CrossRef]
- Miettinen, M.; Mustonen, M.; Poutanen, M.; Isomaa, V.; Vihko, R. Human 17 beta-hydroxysteroid dehydrogenase type 1 and type 2 isoenzymes have opposite activities in cultured cells and characteristic cell- and tissue-specific expression. Biochem. J. 1996, 314 Pt 3, 839–845. [Google Scholar] [CrossRef]
- Frycz, B.; Murawa, D.; Borejsza-Wysocki, M.; Marciniak, R.; Murawa, P.; Drews, M.; Jagodziński, P. Expression of 17β-hydroxysteroid dehydrogenase type 2 is associated with some clinicopathological features in gastric cancer. Biomed. Pharmacother. 2015, 70, 24–27. [Google Scholar] [CrossRef]
- Lee, Y.; He, H.; Shiue, Y.; Lee, S.; Lin, L.; Wu, T.; Chang, I.; Lee, H.; Li, C. The prognostic impact of lipid biosynthesis-associated markers, HSD17B2 and HMGCS2, in rectal cancer treated with neoadjuvant concurrent chemoradiotherapy. Tumour Biol. 2015, 36, 7675–7683. [Google Scholar] [CrossRef]
- Bulun, S.; Cheng, Y.; Pavone, M.; Yin, P.; Imir, G.; Utsunomiya, H.; Thung, S.; Xue, Q.; Marsh, E.; Tokunaga, H.; et al. 17Beta-hydroxysteroid dehydrogenase-2 deficiency and progesterone resistance in endometriosis. Semin. Reprod. Med. 2010, 28, 44–50. [Google Scholar] [CrossRef]
- Shen, Z.; Peng, Z.; Sun, Y.; Väänänen, H.; Poutanen, M. Overexpression of human hydroxysteroid (17beta) dehydrogenase 2 induces disturbance in skeletal development in young male mice. J. Bone Miner. Res. 2008, 23, 1217–1226. [Google Scholar] [CrossRef]
- Zhong, Y.; Rantakari, P.; Lamminen, T.; Toppari, J.; Poutanen, M. Transgenic male mice expressing human hydroxysteroid dehydrogenase 2 indicate a role for the enzyme independent of its action on sex steroids. Endocrinology 2007, 148, 3827–3836. [Google Scholar] [CrossRef]
- Rantakari, P.; Strauss, L.; Kiviranta, R.; Lagerbohm, H.; Paviala, J.; Holopainen, I.; Vainio, S.; Pakarinen, P.; Poutanen, M. Placenta Defects and Embryonic Lethality Resulting from Disruption of Mouse Hydroxysteroid (17-) Dehydrogenase 2 Gene. MolEndocrinol. 2008, 22, 665–675. [Google Scholar] [CrossRef]
- Loveland, J.; Giraldo-Deck, L.; Kelly, A. How inversion variants can shape neural circuitry: Insights from the three-morph mating tactics of ruffs. Front. Physiol. 2022, 13, 1011629. [Google Scholar] [CrossRef]
- Mindnich, R.; Hrabe de Angelis, M.; Adamski, J. Functional genome analysis indicates loss of 17beta-hydroxysteroid dehydrogenase type 2 enzyme in the zebrafish. J. Steroid Biochem. Mol. Biol. 2007, 103, 35–43. [Google Scholar] [CrossRef]
- Baker, M. Evolutionary analysis of 11beta-hydroxysteroid dehydrogenase-type 1, -type 2, -type 3 and 17beta-hydroxysteroid dehydrogenase-type 2 in fish. FEBS Lett. 2004, 574, 167–170. [Google Scholar] [CrossRef] [PubMed]
- Zou, C.; Wang, L.; Zou, Y.; Wu, Z.; Wang, W.; Liang, S.; Wang, L.; You, F. Characteristics and sex dimorphism of 17β-hydroxysteroid dehydrogenase family genes in the olive flounder Paralichthys olivaceus. J. Steroid Biochem. Mol. Biol. 2020, 199, 105597. [Google Scholar] [CrossRef]
- Cui, H.; Zhu, H.; Ban, W.; Li, Y.; Chen, R.; Li, L.; Zhang, X.; Chen, K.; Xu, H. Characterization of two gonadal genes, zar1 and wt1b, in hermaphroditic fish Asian seabass (Lates calcarifer). Animals 2024, 14, 508. [Google Scholar] [CrossRef]
- Chan, S.; Phillips, J. The biosynthesis of steroids by the gonads of the ricefield eel Monopterus albus at various phases during natural sex reversal. Gen. Comp. Endocrinol. 1969, 12, 619–636. [Google Scholar] [CrossRef] [PubMed]
- Sheng, Y.; Chen, B.; Zhang, L.; Luo, M.; Cheng, H.; Zhou, R. Identification of dmrt genes and their up-regulation during gonad transformation in the swamp eel (Monopterus albus). Mol. Biol. Rep. 2014, 41, 1237–1245. [Google Scholar] [CrossRef]
- Yuan, H. Effects of Different Exogenous Factors on Sex Reversal of Monopterus albus. Ph.D. Thesis, Huazhong Agricultural University, Wuhan, China, 2011; pp. 35–36. (In Chinese) [Google Scholar] [CrossRef]
- Zhu, Y.; Wang, C.; Chen, X.; Guan, G. Identification of gonadal soma-derived factor involvement in Monopterus albus (protogynous rice field eel) sex change. Mol. Biol. Rep. 2016, 43, 629–637. [Google Scholar] [CrossRef] [PubMed]
- Ruksana, S.; Pandit, N.; Nakamura, M. Efficacy of exemestane, a new generation of aromatase inhibitor, on sex differentiation in a gonochoristic fish. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2010, 152, 69–74. [Google Scholar] [CrossRef]
- Sun, L.; Jiang, X.; Xie, Q.; Yuan, J.; Huang, B.; Tao, W.; Zhou, L.; Nagahama, Y.; Wang, D. Transdifferentiation of differentiated ovary into functional testis by long-term treatment of aromatase inhibitor in nile tilapia. Endocrinology 2014, 155, 1476–1488. [Google Scholar] [CrossRef] [PubMed]
- Tang, F.; Chan, S.; Lofts, B. Effect of steroid hormones on the process of natural sex reversal in the rice-field eel, Monopterus albus (zuiew). Gen. Comp. Endocrinol. 1974, 24, 227–241. [Google Scholar] [CrossRef]
- Hu, Q.; Guo, W.; Gao, Y.; Tang, R.; Li, D. Molecular cloning and characterization of amh and dax1 genes and their expression during sex inversion in rice-field eel Monopterus albus. Sci. Rep. 2015, 5, 16667. [Google Scholar] [CrossRef]
- Liu, J.; Guiguen, Y.; Liu, S. Aromatase (p450arom) and 11beta-hydroxylase (p45011beta) genes are differentially expressed during the sex change process of the protogynous rice field eel, Monopterus albus. Fish Physiol. Biochem. 2009, 35, 511–518. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zhang, W.; Yang, H.; Zhou, W.; Hu, C.; Zhang, L. Two cytochrome P450 aromatase genes in the hermaphrodite ricefield eel Monopterus albus: mRNA expression during ovarian development and sex change. J. Endorinol. 2008, 199, 317–331. [Google Scholar] [CrossRef]
- Xiao, Y.; Liu, Y. Study on the histology in sex changing from intersex to male of Monopterus albus (ZUIEW). J. Fish. China 1995, 19, 289–304. [Google Scholar]
- Xu, H.; Gui, J.; Hong, Y. Differential expression of vasa RNA and protein during spermatogenesis and oogenesis in the gibel carp (Carassius auratus gibelio), a bisexually and gynogenetically reproducing vertebrate. Dev. Dyn. 2005, 233, 872–882. [Google Scholar] [CrossRef]
- Kavanagh, K.; Jörnvall, H.; Persson, B.; Oppermann, U. Medium- and short-chain dehydrogenase/reductase gene and protein families: The SDR superfamily: Functional and structural diversity within a family of metabolic and regulatory enzymes. Cell. Mol. Life Sci. 2008, 65, 3895. [Google Scholar] [CrossRef]
- Wu, L.; Einstein, M.; Geissler, W.; Chan, H.; Elliston, K.; Andersson, S. Expression cloning and characterization of human 17 beta-hydroxysteroid dehydrogenase type 2, a microsomal enzyme possessing 20 alpha-hydroxysteroid dehydrogenase activity. J. Biol. Chem. 1993, 268, 12964–12969. [Google Scholar] [CrossRef]
- Akinola, L.; Poutanen, M.; Vihko, R. Cloning of rat 17 beta-hydroxysteroid dehydrogenase type 2 and characterization of tissue distribution and catalytic activity of rat type 1 and type 2 enzymes. Endocrinology 1996, 137, 1572–1579. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, D.; Gireesh-Babu, P.; Pavan-Kumar, A.; Koringa, P.; Joshi, C.; Gora, A.; Bhat, I.; Chaudhari, A. Molecular characterization and expression profiling of 17-beta-hydroxysteroid dehydrogenase 2 and spermatogenesis associated protein 2 genes in endangered catfish, Clarias magur (Hamilton, 1822). Anim. Biotechnol. 2020, 31, 93–106. [Google Scholar] [CrossRef] [PubMed]
- Casey, M.; MacDonald, P.; Andersson, S. 17 beta-Hydroxysteroid dehydrogenase type 2: Chromosomal assignment progestin regulation of gene expression in human endometrium. J. Clin. Investig. 1994, 94, 2135–2141. [Google Scholar] [CrossRef] [PubMed]
- Mustonen, M.; Poutanen, M.; Isomaa, V.; Vihko, P.; Vihko, R. Cloning of mouse 17β-hydroxysteroid dehydrogenase type 2, and analysing expression of the mRNAs for types 1, 2, 3, 4 and 5 in mouse embryos and adult tissues. Biochem. J. 1997, 325, 199–205. [Google Scholar] [CrossRef]
- Yeung, W.; Chan, S. The plasma sex steroid profiles in the freshwater, sex-reversing teleost fish, Monopterus albus (zuiew). Gen. Comp. Endocrinol. 1987, 65, 233–242. [Google Scholar] [CrossRef]
- Devlin, R.; Nagahama, Y. Sex determination and sex differentiation in fish: An overview of genetic, physiological, and environmental influences. Aquaculture 2002, 208, 191–364. [Google Scholar] [CrossRef]
- Pandian, T.; Sheela, S. Hormonal induction of sex reversal in fish. Aquaculture 1995, 138, 1–22. [Google Scholar] [CrossRef]
- Tenugu, S.; Senthilkumaran, B. Sexual plasticity in bony fishes: Analyzing morphological to molecular changes of sex reversal. Aquac. Fish. 2022, 7, 525–539. [Google Scholar] [CrossRef]
- Ogino, Y.; Miyagawa, S.; Iguchi, T. Subchapter 94B. 17,20β-Dihydroxy-4-pregnen-3-one. In Handbook of Hormone; Academic Press Cambridge: Cambridge, MA, USA, 2016; pp. 509–510. [Google Scholar] [CrossRef]
- Gao, X.; Dai, C.; Huang, S.; Tang, J.; Chen, G.; Li, J.; Zhu, Z.; Zhu, X.; Zhou, S.; Gao, Y.; et al. Functional Silencing of HSD17B2 in Prostate Cancer Promotes Disease Progression. Clin. Cancer Res. 2019, 25, 1291–1301. [Google Scholar] [CrossRef]
- Cao, Y.; Shen, M.; Jiang, Y. Melatonin reduces oxidative damage in mouse granulosa cells via restraining JNK-dependent autophagy. Reproduction 2018, 155, 307–319. [Google Scholar] [CrossRef]
- Li, S.; Li, W.; Jiang, S.; Jing, Y.; Xiao, L.; Yu, Y.; Liu, Y.; Li, Y.; Wang, D.; Li, J.; et al. Mechanisms of sex differentiation and sex reversal in hermaphrodite fish as revealed by the Epinephelus coioides genome. Mol. Ecol. Resour. 2023, 23, 920–932. [Google Scholar] [CrossRef] [PubMed]
- Shi, Q.; Lin, H.; Deng, B. Effects of exogenous melatonin on gonadal development and secretion of gonadal hormones in the ricefield eel (Monopterus albus). Acta Zool 1998, 44, 435–442. [Google Scholar] [CrossRef]
Primer | Nucleotide Sequence | Tm (°C) | Product Length (bp) | Purpose |
---|---|---|---|---|
Hsd17b2-F1 | 5′-TACACTGTGTGACCATGGAAATC-3′ | 53.5 | 1237 | For CDS cloning |
Hsd17b2-R1 | 5′-AACAGTCTCAGGACATTTTAGAGC-3′ | 54.0 | ||
Hsd17b2-F2 | 5′-GCAGAACAGAGTGGTGCTGA-3′ | 53.8 | 241 | For RT-PCR and RT-qPCR |
Hsd17b2-R2 | 5′-CAAACCCCAGAGACCTGCGT-3′ | 55.9 | ||
EF1α -F | 5′-CGCTGCTGTTTCCTTCGTCC-3′ | 59.7 | 102 | |
EF1α -R | 5′-TTGCGTTCAATCTTCCATCCC-3′ | 55.5 | ||
Zar1-F1 | 5′- GTGTGCGCTTTCAGTTCCTG-3′ | 54.5 | 163 | |
Zar1-R1 | 5′-ACACGGTACGGGTTGAAGTC-3′ | 58.8 | ||
T7 promoter F | 5′-TAATACGACTCACTATAGGG-3′ | 46.6 | 1315 | For RNA Probe synthesis |
Hsd17b2-R3 | 5′-AACAGTCTCAGGACATTTTAGAGC-3′ | 54.0 | ||
T7 promoter F | 5′-TAATACGACTCACTATAGGG-3′ | 46.6 | 807 | |
Zar1-R2 | 5′- AACGTGGCGTTGTGTTGTTG -3′ | 57.0 | ||
Hsd17b2-F3 | 5′-TACACTGTGTGACCATGGAAATC-3′ | 53.5 | 1336 | |
SP6 promoter R | 5′-ATTTAGGTGACACTATAGAAT-3′ | 44.0 | ||
Zar1-F2 | 5′-AATCCCAAACTCACCCCGAG-3′ | 57.5 | 828 | |
SP6 promoter R | 5′-ATTTAGGTGACACTATAGAAT-3′ | 44.0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, R.; Zhu, H.; Zhang, X.; Li, L.; Xu, J.; Tan, Z.; Su, J.; Feng, K.; Chen, K.; Xu, H. Characterization and Functional Analysis of the 17-Beta Hydroxysteroid Dehydrogenase 2 (hsd17b2) Gene during Sex Reversal in the Ricefield Eel (Monopterus albus). Int. J. Mol. Sci. 2024, 25, 9063. https://doi.org/10.3390/ijms25169063
Chen R, Zhu H, Zhang X, Li L, Xu J, Tan Z, Su J, Feng K, Chen K, Xu H. Characterization and Functional Analysis of the 17-Beta Hydroxysteroid Dehydrogenase 2 (hsd17b2) Gene during Sex Reversal in the Ricefield Eel (Monopterus albus). International Journal of Molecular Sciences. 2024; 25(16):9063. https://doi.org/10.3390/ijms25169063
Chicago/Turabian StyleChen, Ruyi, Haoyu Zhu, Xiaoling Zhang, Lingli Li, Jinglin Xu, Zhimin Tan, Jialin Su, Ke Feng, Kaili Chen, and Hongyan Xu. 2024. "Characterization and Functional Analysis of the 17-Beta Hydroxysteroid Dehydrogenase 2 (hsd17b2) Gene during Sex Reversal in the Ricefield Eel (Monopterus albus)" International Journal of Molecular Sciences 25, no. 16: 9063. https://doi.org/10.3390/ijms25169063
APA StyleChen, R., Zhu, H., Zhang, X., Li, L., Xu, J., Tan, Z., Su, J., Feng, K., Chen, K., & Xu, H. (2024). Characterization and Functional Analysis of the 17-Beta Hydroxysteroid Dehydrogenase 2 (hsd17b2) Gene during Sex Reversal in the Ricefield Eel (Monopterus albus). International Journal of Molecular Sciences, 25(16), 9063. https://doi.org/10.3390/ijms25169063