Caprylic Acid Inhibits High Mobility Group Box-1-Induced Mitochondrial Damage in Myocardial Tubes
Abstract
1. Introduction
2. Results
2.1. Effects of MCFAs in a CT26 Mouse Cachexia Model

2.2. Effects of Inflammatory Cytokines on Myocardial Tube Differentiation in Cardiomyoblasts
2.3. Effects of C8 and βHBA on HMGB1-Induced Myocardial Tube Damage
2.4. Effects of C8 and βHBA on HMGB1-Induced Myocardial Tube Quality Control
2.5. Effects of C8 and βHBA on Mitochondrial Maturity
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Reagents
4.3. Cell Treatment
4.4. Animals
4.5. Histological Analysis
4.6. Protein Extraction
4.7. Enzyme-Linked Immunosorbent Assay (ELISA) and Colorimetric Assay
4.8. Western Blotting
4.9. Reverse-Transcription Polymerase Chain Reaction (RT-PCR)
4.10. Mitochondrial Imaging
4.11. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Paillaud, E.; Caillet, P.; Campillo, B.; Bories, P.N. Increased risk of alteration of nutritional status in hospitalized elderly patients with advanced cancer. J. Nutr. Health Aging 2006, 10, 91–95. [Google Scholar] [PubMed]
- Mamidanna, R.; Nachiappan, S.; Bottle, A.; Aylin, P.; Faiz, O. Defining the timing and causes of death amongst patients undergoing colorectal resection in England. Color. Dis. 2016, 18, 586–593. [Google Scholar] [CrossRef] [PubMed]
- Ausoni, S.; Calamelli, S.; Saccà, S.; Azzarello, G. How progressive cancer endangers the heart: An intriguing and underestimated problem. Cancer Metastasis Rev. 2020, 39, 535–552. [Google Scholar] [CrossRef] [PubMed]
- Fearon, K.C.; Voss, A.C.; Hustead, D.S. Definition of cancer cachexia: Effect of weight loss, reduced food intake, and systemic inflammation on functional status and prognosis. Am. J. Clin. Nutr. 2006, 83, 1345–1350. [Google Scholar] [CrossRef] [PubMed]
- Florido, R.; Daya, N.R.; Ndumele, C.E.; Koton, S.; Russell, S.D.; Prizment, A.; Blumenthal, R.S.; Matsushita, K.; Mok, Y.; Felix, A.S.; et al. Cardiovascular Disease Risk Among Cancer Survivors: The Atherosclerosis Risk In Communities (ARIC) Study. J. Am. Coll. Cardiol. 2022, 80, 22–32. [Google Scholar] [CrossRef] [PubMed]
- Murphy, K.T. The pathogenesis and treatment of cardiac atrophy in cancer cachexia. Am. J. Physiol. Heart Circ. Physiol. 2016, 310, H466–H477. [Google Scholar] [CrossRef] [PubMed]
- Bellinger, A.M.; Arteaga, C.L.; Force, T.; Humphreys, B.D.; Demetri, G.D.; Druker, B.J.; Moslehi, J.J. Cardio-Oncology: How New Targeted Cancer Therapies and Precision Medicine Can Inform Cardiovascular Discovery. Circulation 2015, 132, 2248–2258. [Google Scholar] [CrossRef] [PubMed]
- Asnani, A.; Moslehi, J.J.; Adhikari, B.B.; Baik, A.H.; Beyer, A.M.; de Boer, R.A.; Ghigo, A.; Grumbach, I.M.; Jain, S.; Zhu, H. Preclinical Models of Cancer Therapy-Associated Cardiovascular Toxicity: A Scientific Statement From the American Heart Association. Circ. Res. 2021, 129, e21–e34. [Google Scholar] [CrossRef] [PubMed]
- Fujii, K.; Fujiwara-Tani, R.; Nukaga, S.; Ohmori, H.; Luo, Y.; Nishida, R.; Sasaki, T.; Miyagawa, Y.; Nakashima, C.; Kawahara, I.; et al. Involvement of Ferroptosis Induction and Oxidative Phosphorylation Inhibition in the Anticancer-Drug-Induced Myocardial Injury: Ameliorative Role of Pterostilbene. Int. J. Mol. Sci. 2024, 25, 3015. [Google Scholar] [CrossRef]
- Ye, T.; Yang, W.; Gao, T.; Yu, X.; Chen, T.; Yang, Y.; Guo, J.; Li, Q.; Li, H.; Yang, L. Trastuzumab-induced cardiomyopathy via ferroptosis-mediated mitochondrial dysfunction. Free Radic. Biol. Med. 2023, 206, 143–161. [Google Scholar] [CrossRef]
- Nukaga, S.; Mori, T.; Miyagawa, Y.; Fujiwara-Tani, R.; Sasaki, T.; Fujii, K.; Mori, S.; Goto, K.; Kishi, S.; Nakashima, C.; et al. Combined administration of lauric acid and glucose improved cancer-derived cardiac atrophy in a mouse cachexia model. Cancer Sci. 2020, 111, 4605–4615. [Google Scholar] [CrossRef]
- Ohmori, H.; Fujiwara-Tani, R.; Nukaga, S.; Nishida, R.; Fujii, K.; Mori, S.; Ogata, R.; Ikemoto, A.; Sasaki, R.; Kishi, S.; et al. Investigation of cancer-induced myocardial damage in autopsy cases-A comparison of cases with and without chemotherapy. Pathol. Int. 2024, 74, 234–238. [Google Scholar] [CrossRef]
- Tzika, A.A.; Fontes-Oliveira, C.C.; Shestov, A.A.; Constantinou, C.; Psychogios, N.; Righi, V.; Mintzopoulos, D.; Busquets, S.; Lopez-Soriano, F.J.; Milot, S.; et al. Skeletal muscle mitochondrial uncoupling in a murine cancer cachexia model. Int. J. Oncol. 2013, 43, 886–894. [Google Scholar] [CrossRef]
- Fermoselle, C.; García-Arumí, E.; Puig-Vilanova, E.; Andreu, A.L.; Urtreger, A.J.; de Kier Joffé, E.D.; Tejedor, A.; Puente-Maestu, L.; Barreiro, E. Mitochondrial dysfunction and therapeutic approaches in respiratory and limb muscles of cancer cachectic mice. Exp. Physiol. 2013, 98, 1349–1365. [Google Scholar] [CrossRef]
- Kasprzak, A. The Role of Tumor Microenvironment Cells in Colorectal Cancer (CRC) Cachexia. Int. J. Mol. Sci. 2021, 22, 1565. [Google Scholar] [CrossRef]
- Ohmori, H.; Kawahara, I.; Mori, T.; Nukaga, S.; Luo, Y.; Kishi, S.; Fujiwara-Tani, R.; Mori, S.; Goto, K.; Sasaki, T.; et al. Evaluation of Parameters for Cancer-Induced Sarcopenia in Patients Autopsied after Death from Colorectal Cancer. Pathobiology 2019, 86, 306–314. [Google Scholar] [CrossRef]
- Ohmori, H.; Luo, Y.; Kuniyasu, H. Non-histone nuclear factor HMGB1 as a therapeutic target in colorectal cancer. Expert Opin. Ther. Targets 2011, 15, 183–193. [Google Scholar] [CrossRef]
- Xu, Z.; Jin, Y.; Gao, Z.; Zeng, Y.; Du, J.; Yan, H.; Chen, X.; Ping, L.; Lin, N.; Yang, B.; et al. Autophagic degradation of CCN2 (cellular communication network factor 2) causes cardiotoxicity of sunitinib. Autophagy 2022, 18, 1152–1173. [Google Scholar]
- Luo, Y.; Yoneda, J.; Ohmori, H.; Sasaki, T.; Shimbo, K.; Eto, S.; Kato, Y.; Miyano, H.; Kobayashi, T.; Sasahira, T.; et al. Cancer usurps skeletal muscle as an energy repository. Cancer Res. 2014, 74, 330–340. [Google Scholar] [CrossRef]
- Raucci, A.; Di Maggio, S.; Scavello, F.; D’Ambrosio, A.; Bianchi, M.E.; Capogrossi, M.C. The Janus face of HMGB1 in heart disease: A necessary update. Cell. Mol. Life Sci. 2019, 76, 211–229. [Google Scholar] [CrossRef]
- Li, R.; Barker, A.R.; Vlachopoulos, D.; Paris, D.; Schindera, C.; Belle, F.N.; Revuelta Iniesta, R. The Role of Diet in the Cardiovascular Health of Childhood Cancer Survivors—A Systematic Review. Nutrients 2024, 16, 1315. [Google Scholar] [CrossRef]
- Zhang, X.Y.; Yang, K.L.; Li, Y.; Zhao, Y.; Jiang, K.W.; Wang, Q.; Liu, X.N. Can Dietary Nutrients Prevent Cancer Chemotherapy-Induced Cardiotoxicity? An Evidence Mapping of Human Studies and Animal Models. Front. Cardiovasc. Med. 2022, 9, 921609. [Google Scholar] [CrossRef]
- Mori, T.; Ohmori, H.; Luo, Y.; Mori, S.; Miyagawa, Y.; Nukaga, S.; Goto, K.; Fujiwara-Tani, R.; Kishi, S.; Sasaki, T.; et al. Giving combined medium-chain fatty acids and glucose protects against cancer-associated skeletal muscle atrophy. Cancer Sci. 2019, 110, 3391–3399. [Google Scholar] [CrossRef]
- Butler-Browne, G.S.; Barbet, J.P.; Thornell, L.E. Myosin heavy and light chain expression during human skeletal muscle development and precocious muscle maturation induced by thyroid hormone. Anat. Embryol. 1990, 181, 513–522. [Google Scholar] [CrossRef]
- Yazaki, Y.; Mochinaga, S.; Raben, M.S. Fractionation of the light chains from rat and rabbit cardiac myosin. Biochim. Biophys. Acta 1973, 328, 464–469. [Google Scholar] [CrossRef]
- Dunn, E.; Zhang, B.; Sahota, V.K.; Augustin, H. Potential benefits of medium chain fatty acids in aging and neurodegenerative disease. Front. Aging Neurosci. 2023, 15, 1230467. [Google Scholar] [CrossRef]
- Fan, L.; Zhu, X.; Chen, Q.; Huang, X.; Steinwandel, M.D.; Shrubsole, M.J.; Dai, Q. Dietary medium-chain fatty acids and risk of incident colorectal cancer in a predominantly low-income population: A report from the Southern Community Cohort Study. Am. J. Clin. Nutr. 2024, 119, 7–17. [Google Scholar] [CrossRef]
- Roopashree, P.G.; Shetty, S.S.; Shetty, V.V.; Nalilu, S.K. Medium-Chain Fatty Acids and Breast Cancer Risk by Receptor and Pathological Subtypes. Nutrients 2022, 14, 5351. [Google Scholar] [CrossRef]
- Wang, D.; Chen, J.; Sun, H.; Chen, W.; Yang, X. MCFA alleviate H2O2-induced oxidative stress in AML12 cells via the ERK1/2/Nrf2 pathway. Lipids 2022, 57, 153–162. [Google Scholar] [CrossRef]
- Charlot, A.; Morel, L.; Bringolf, A.; Georg, I.; Charles, A.L.; Goupilleau, F.; Geny, B.; Zoll, J. Octanoic Acid-Enrichment Diet Improves Endurance Capacity and Reprograms Mitochondrial Biogenesis in Skeletal Muscle of Mice. Nutrients 2022, 14, 2721. [Google Scholar] [CrossRef]
- Fushimi, T.; Izumi, Y.; Takahashi, M.; Hata, K.; Murano, Y.; Bamba, T. Dynamic Metabolome Analysis Reveals the Metabolic Fate of Medium-Chain Fatty Acids in AML12 Cells. J. Agric. Food Chem. 2020, 68, 11997–12010. [Google Scholar] [CrossRef] [PubMed]
- Stride, N.; Larsen, S.; Treebak, J.T.; Hansen, C.N.; Hey-Mogensen, M.; Speerschneider, T.; Jensen, T.E.; Jeppesen, J.; Wojtaszewski, J.F.; Richter, E.A.; et al. 5′-AMP Activated Protein Kinase is Involved in the Regulation of Myocardial β-Oxidative Capacity in Mice. Front. Physiol. 2012, 3, 33. [Google Scholar] [CrossRef] [PubMed]
- Soni, S.; Tabatabaei Dakhili, S.A.; Ussher, J.R.; Dyck, J.R.B. The therapeutic potential of ketones in cardiometabolic disease: Impact on heart and skeletal muscle. Am. J. Physiol. Cell Physiol. 2024, 326, C551–C566. [Google Scholar] [CrossRef] [PubMed]
- Aziz, F.; Tripolt, N.J.; Pferschy, P.N.; Scharnagl, H.; Abdellatif, M.; Oulhaj, A.; Benedikt, M.; Kolesnik, E.; von Lewinski, D.; Sourij, H. Ketone body levels and its associations with cardiac markers following an acute myocardial infarction: A post hoc analysis of the EMMY trial. Cardiovasc. Diabetol. 2024, 23, 145. [Google Scholar] [CrossRef] [PubMed]
- Chu, Y.; Hua, Y.; He, L.; He, J.; Chen, Y.; Yang, J.; Mahmoud, I.; Zeng, F.; Zeng, X.; Benavides, G.A.; et al. β-hydroxybutyrate administered at reperfusion reduces infarct size and preserves cardiac function by improving mitochondrial function through autophagy in male mice. J. Mol. Cell. Cardiol. 2024, 186, 31–44. [Google Scholar] [CrossRef] [PubMed]
- Gómora-García, J.C.; Montiel, T.; Hüttenrauch, M.; Salcido-Gómez, A.; García-Velázquez, L.; Ramiro-Cortés, Y.; Gomora, J.C.; Castro-Obregón, S.; Massieu, L. Effect of the Ketone Body, D-β-Hydroxybutyrate, on Sirtuin2-Mediated Regulation of Mitochondrial Quality Control and the Autophagy-Lysosomal Pathway. Cells 2023, 12, 486. [Google Scholar] [CrossRef]
- Thai, P.N.; Seidlmayer, L.K.; Miller, C.; Ferrero, M.; Dorn, G.W., II; Schaefer, S.; Bers, D.M.; Dedkova, E.N. Mitochondrial Quality Control in Aging and Heart Failure: Influence of Ketone Bodies and Mitofusin-Stabilizing Peptides. Front. Physiol. 2019, 10, 382. [Google Scholar] [CrossRef] [PubMed]
- Augustin, K.; Khabbush, A.; Williams, S.; Eaton, S.; Orford, M.; Cross, J.H.; Heales, S.J.R.; Walker, M.C.; Williams, R.S.B. Mechanisms of action for the medium-chain triglyceride ketogenic diet in neurological and metabolic disorders. Lancet Neurol. 2018, 17, 84–93. [Google Scholar] [CrossRef]
- Nakamura, S.; Matsui, A.; Akabane, S.; Tamura, Y.; Hatano, A.; Miyano, Y.; Omote, H.; Kajikawa, M.; Maenaka, K.; Moriyama, Y.; et al. The mitochondrial inner membrane protein LETM1 modulates cristae organization through its LETM domain. Commun. Biol. 2020, 3, 99. [Google Scholar] [CrossRef]
- Caron, C.; Bertolin, G. Cristae shaping and dynamics in mitochondrial function. J. Cell Sci. 2024, 137, jcs260986. [Google Scholar] [CrossRef]
- Dias, H.F.; Kühtreiber, W.M.; Nelson, K.J.; Ng, N.C.; Zheng, H.; Faustman, D.L. Epigenetic changes related to glucose metabolism in type 1 diabetes after BCG vaccinations: A vital role for KDM2B. Vaccine 2022, 40, 1540–1554. [Google Scholar] [CrossRef] [PubMed]
- Kelley, N.; Jeltema, D.; Duan, Y.; He, Y. The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int. J. Mol. Sci. 2019, 20, 3328. [Google Scholar] [CrossRef]
- Skopelja-Gardner, S.; An, J.; Elkon, K.B. Role of the cGAS-STING pathway in systemic and organ-specific diseases. Nat. Rev. Nephrol. 2022, 18, 558–572. [Google Scholar] [CrossRef]
- Kiyonaga, N.; Moriyama, T.; Kanmura, Y. Effects of dexmedetomidine on lipopolysaccharide-induced acute kidney injury in rats and mitochondrial function in cell culture. Biomed. Pharmacother. 2020, 125, 109912. [Google Scholar] [CrossRef]
- Remels, A.H.; Gosker, H.R.; Schrauwen, P.; Hommelberg, P.P.; Sliwinski, P.; Polkey, M.; Galdiz, J.; Wouters, E.F.; Langen, R.C.; Schols, A.M. TNF-alpha impairs regulation of muscle oxidative phenotype: Implications for cachexia? FASEB J. 2010, 24, 5052–5062. [Google Scholar] [PubMed]
- Tanaka, K.; Tanaka, M.; Takegaki, J.; Fujino, H. Preventive effects of electrical stimulation on inflammation-induced muscle mitochondrial dysfunction. Acta Histochem. 2016, 118, 464–470. [Google Scholar] [CrossRef]
- Zhang, X.; Xue, C.; Xu, Q.; Zhang, Y.; Li, H.; Li, F.; Liu, Y.; Guo, C. Caprylic acid suppresses inflammation via TLR4/NF-κB signaling and improves atherosclerosis in ApoE-deficient mice. Nutr. Metab. 2019, 16, 40. [Google Scholar] [CrossRef]
- Takagi, T.; Fujiwara-Tani, R.; Mori, S.; Kishi, S.; Nishiguchi, Y.; Sasaki, T.; Ogata, R.; Ikemoto, A.; Sasaki, R.; Ohmori, H.; et al. Lauric Acid Overcomes Hypoxia-Induced Gemcitabine Chemoresistance in Pancreatic Ductal Adenocarcinoma. Int. J. Mol. Sci. 2023, 24, 7506. [Google Scholar] [CrossRef]
- Wang, H.; Lu, J.; Chen, X.; Schwalbe, M.; Gorka, J.E.; Mandel, J.A.; Wang, J.; Goetzman, E.S.; Ranganathan, S.; Dobrowolski, S.F.; et al. Acquired deficiency of peroxisomal dicarboxylic acid catabolism is a metabolic vulnerability in hepatoblastoma. J. Biol. Chem. 2021, 296, 100283. [Google Scholar] [CrossRef]
- Fauser, J.K.; Matthews, G.M.; Cummins, A.G.; Howarth, G.S. Induction of apoptosis by the medium-chain length fatty acid lauric acid in colon cancer cells due to induction of oxidative stress. Chemotherapy 2013, 59, 214–224. [Google Scholar] [CrossRef]
- Kita, T.; Kadochi, Y.; Takahashi, K.; Fukushima, K.; Yamasaki, E.; Uemoto, T.; Hirane, M.; Fukushima, N.; Honoki, K.; Tsujiuchi, T. Diverse effects of G-protein-coupled free fatty acid receptors on the regulation of cellular functions in lung cancer cells. Exp. Cell Res. 2016, 342, 193–199. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Chinnathambi, S.; Kumar, M.; Pandian, G.N. Food Intake and Colorectal Cancer. Nutr. Cancer 2023, 75, 1710–1742. [Google Scholar] [CrossRef] [PubMed]
- Narayanan, A.; Baskaran, S.A.; Amalaradjou, M.A.; Venkitanarayanan, K. Anticarcinogenic properties of medium chain fatty acids on human colorectal, skin and breast cancer cells in vitro. Int. J. Mol. Sci. 2015, 16, 5014. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Ham, A.; Ma, T.C.; Kuo, S.H.; Kanter, E.; Kim, D.; Ko, H.S.; Quan, Y.; Sardi, S.P.; Li, A.; et al. Mitochondrial dysfunction and mitophagy defect triggered by heterozygous GBA mutations. Autophagy 2019, 15, 113–130. [Google Scholar] [CrossRef] [PubMed]
- Chazotte, B. Labeling mitochondria with MitoTracker dyes. Cold Spring Harb. Protoc. 2011, 2011, 990–992. [Google Scholar] [CrossRef] [PubMed]
- Chung, C.Y.; Duchen, M.R. A Plate Reader-Based Measurement of the Cellular ROS Production Using Dihydroethidium and MitoSOX. Methods Mol. Biol. 2022, 2497, 333–337. [Google Scholar]
- Lau, H.C.; Yuan, X.; Huang, H.; Zhang, M.; Hsueh, C.Y.; Gong, H. Fusobacterium nucleatum facilitates proliferation and autophagy by activating miR-361-3p/NUDT1 axis through oxidative stress in hypopharyngeal squamous cell carcinoma. BMC Cancer 2023, 23, 990. [Google Scholar] [CrossRef]








| Diet | ||||
|---|---|---|---|---|
| Control | C8 | C10 | C12 | |
| MCFA (%) | 0 | 2 | 2 | 2 |
| Moisture (%) | 7.95 | 7.791 | 7.791 | 7.791 |
| Crude protein (%) | 25.06 | 24.5588 | 24.5588 | 24.5588 |
| Crude fat (%) | 4.78 | 4.6844 | 4.6844 | 4.6844 |
| Crude fiber (%) | 4.91 | 4.8118 | 4.8118 | 4.8118 |
| Crude ash (%) | 6.88 | 6.7424 | 6.7424 | 6.7424 |
| Nitrogen-free extract (%) | 50.42 | 49.4116 | 49.4116 | 49.4116 |
| Energy (Kcal) | 345 | 356.1 | 356.1 | 356.1 |
| Primer Set | |||
| Gene Symbol | GenBank ID | Forward (5′–3′) | Reverse (5′–3′) |
| Myogenin | CTTCTCCCTCAGTGTGGCTG | ACCAGGAGCCCCACTTCTAT | |
| Myomesin | ACTGCTCACCGGTGGTTAAG | GTGTTCCGGGTTTTGTCAGC | |
| TroponinT | GAGCCTCGATCAGAGTCTGC | TGGAGGAGGAGGATGGTGAG | |
| β-actin | CGGAACCGCTCATTGCCGAT | ACCGAGCGTGGCTACAGCTT | |
| Antibody | |||
| Target | No | Company | |
| PGC1α | #2178S | Cell Signaling Technology, Danvers, MA, USA | |
| LETM1 | 16024-1-AP | Proteintech, Tokyo, Japan | |
| TOM20 | 11802-1-AP | Proteintech, Tokyo, Japan | |
| PINK1 | 23274-1-AP | Proteintech, Tokyo, Japan | |
| Parkin | #4211 | Cell Signaling Technology, Danvers, MA, USA | |
| LC3 | PM036 | Medical & Biological Laboratories, Tokyo, Japan | |
| MYH6 | 22281-1-AP | Proteintech, Tokyo, Japan | |
| MYH7 | 22280-1-AP | Proteintech, Tokyo, Japan | |
| Beclin1 | 11306-1-AP | Proteintech, Tokyo, Japan | |
| β-actin | sc-47778 | Santa Cruz Biotechnologies, Santa Cruz, CA, USA | |
| ELISA | |||
| Protein | Cat No | Company | |
| TNF-α | MTA00B | R&D Systems, Inc., Minneapolis, MN, USA | |
| HMGB1 | 326078738 | Shino-Test Co., Kanagawa, Japan | |
| 4HNE | CSB-E13412m | Cusabio Biotech Co., Houston, TX, USA | |
| MYL1 | RK07660 | Abclonal, Woburn, MA, USA | |
| Detection kit | |||
| Target | Product and Cat No | Company | |
| TMRE | TMRE, 9103 | ImmunoChemistry Technologies, LLC., Minneapolis, MN, USA | |
| Mitochondria | MitoBright LT Green. 346-92061 | Dojindo Laboratories, Kumamoto, Japan | |
| Mitochondrial superoxide | MitoROS, 16052 | AAT Bioquest, Inc., Pleasanton, CA, USA | |
| Mitochondrial hydrogen peroxide | DHR123, 85100 | Cayman Chemical, Ann Arbor, MI, USA | |
| Hydroxyl radical | CellMeter, 16055 | AAT Bioquest, Inc., Pleasanton, CA, USA | |
| Lipid peroxide | Lipefluo, 1448846-35-2 | Dojindo Laboratories, Kumamoto, Japan | |
| β-Hydroxybutyrate | 700740 | R&D Systems, Incorporated, Minneapolis, MN, USA | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nukaga, S.; Fujiwara-Tani, R.; Nishida, R.; Miyagawa, Y.; Goto, K.; Kawahara, I.; Nakashima, C.; Fujii, K.; Ogata, R.; Ohmori, H.; et al. Caprylic Acid Inhibits High Mobility Group Box-1-Induced Mitochondrial Damage in Myocardial Tubes. Int. J. Mol. Sci. 2024, 25, 8081. https://doi.org/10.3390/ijms25158081
Nukaga S, Fujiwara-Tani R, Nishida R, Miyagawa Y, Goto K, Kawahara I, Nakashima C, Fujii K, Ogata R, Ohmori H, et al. Caprylic Acid Inhibits High Mobility Group Box-1-Induced Mitochondrial Damage in Myocardial Tubes. International Journal of Molecular Sciences. 2024; 25(15):8081. https://doi.org/10.3390/ijms25158081
Chicago/Turabian StyleNukaga, Shota, Rina Fujiwara-Tani, Ryoichi Nishida, Yoshihiro Miyagawa, Kei Goto, Isao Kawahara, Chie Nakashima, Kiyomu Fujii, Ruiko Ogata, Hitoshi Ohmori, and et al. 2024. "Caprylic Acid Inhibits High Mobility Group Box-1-Induced Mitochondrial Damage in Myocardial Tubes" International Journal of Molecular Sciences 25, no. 15: 8081. https://doi.org/10.3390/ijms25158081
APA StyleNukaga, S., Fujiwara-Tani, R., Nishida, R., Miyagawa, Y., Goto, K., Kawahara, I., Nakashima, C., Fujii, K., Ogata, R., Ohmori, H., & Kuniyasu, H. (2024). Caprylic Acid Inhibits High Mobility Group Box-1-Induced Mitochondrial Damage in Myocardial Tubes. International Journal of Molecular Sciences, 25(15), 8081. https://doi.org/10.3390/ijms25158081

