Sulforaphane Effects on Neuronal-like Cells and Peripheral Blood Mononuclear Cells Exposed to 2.45 GHz Electromagnetic Radiation
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Cell Culture Conditions
4.2. PBMC Culture Conditions
4.3. Experimental Design
4.4. Cell Viability Assay
4.5. Intracellular ROS Assessment
4.6. Mitochondrial Transmembrane Potential (Δψm) Assessment
4.7. NAD+/NADH Ratio
4.8. Real-Time PCR Analysis
4.9. Western Blotting
4.10. Caspase-3 Activity
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Balikci, K.; Cem Ozcan, I.; Turgut-Balik, D.; Balik, H.H. A survey study on some neurological symptoms and sensations experienced by long term users of mobile phones. Pathol. Biol. 2005, 53, 30–34. [Google Scholar] [CrossRef] [PubMed]
- Kundi, M.; Mild, K.; Hardell, L.; Mattsson, M.O. Mobile telephones and cancer—A review of epidemiological evidence. J. Toxicol. Environ. Health B Crit. Rev. 2004, 7, 351–384. [Google Scholar] [CrossRef] [PubMed]
- Lonn, S.; Ahlbom, A.; Hall, P.; Feychting, M. Mobile phone use and the risk of acoustic neuroma. Epidemiology 2004, 15, 653–659. [Google Scholar] [CrossRef] [PubMed]
- Yadav, H.; Sharma, R.S.; Singh, R. Immunotoxicity of radiofrequency radiation. Environ. Pollut. 2022, 309, 119793. [Google Scholar] [CrossRef] [PubMed]
- Blank, M.; Goodman, R. Electromagnetic fields stress living cells. Pathophysiology 2009, 16, 71–78. [Google Scholar] [CrossRef] [PubMed]
- Friedman, J.; Kraus, S.; Hauptman, Y.; Schiff, Y.; Seger, R. Mechanism of short-term ERK activation by electromagnetic fields at mobile phone frequencies. Biochem. J. 2007, 405, 559–568. [Google Scholar] [CrossRef] [PubMed]
- Henschenmacher, B.; Bitsch, A.; de Las Heras Gala, T.; Forman, H.J.; Fragoulis, A.; Ghezzi, P.; Kellner, R.; Koch, W.; Kuhne, J.; Sachno, D.; et al. The effect of radiofrequency electromagnetic fields (RF-EMF) on biomarkers of oxidative stress in vivo and in vitro: A protocol for a systematic review. Environ. Int. 2022, 158, 106932. [Google Scholar] [CrossRef]
- Schuermann, D.; Mevissen, M. Manmade Electromagnetic Fields and Oxidative Stress-Biological Effects and Consequences for Health. Int. J. Mol. Sci. 2021, 22, 3772. [Google Scholar] [CrossRef]
- Cadet, J.; Davies, K.J.A.; Medeiros, M.H.; Di Mascio, P.; Wagner, J.R. Formation and repair of oxidatively generated damage in cellular DNA. Free Radic. Biol. Med. 2017, 107, 13–34. [Google Scholar] [CrossRef]
- Bertuccio, M.P.; Acri, G.; Ientile, R.; Caccamo, D.; Curro, M. The Exposure to 2.45 GHz Electromagnetic Radiation Induced Different Cell Responses in Neuron-like Cells and Peripheral Blood Mononuclear Cells. Biomedicines 2023, 11, 3129. [Google Scholar] [CrossRef]
- Bhartiya, P.; Mumtaz, S.; Lim, J.S.; Kaushik, N.; Lamichhane, P.; Nguyen, L.N.; Jang, J.H.; Yoon, S.H.; Choi, J.J.; Kaushik, N.K.; et al. Pulsed 3.5 GHz high power microwaves irradiation on physiological solution and their biological evaluation on human cell lines. Sci. Rep. 2021, 11, 8475. [Google Scholar] [CrossRef]
- Rana, J.N.; Mumtaz, S.; Choi, E.H.; Han, I. ROS production in response to high-power microwave pulses induces p53 activation and DNA damage in brain cells: Radiosensitivity and biological dosimetry evaluation. Front. Cell Dev. Biol. 2023, 11, 1067861. [Google Scholar] [CrossRef]
- Mumtaz, S.; Bhartiya, P.; Kaushik, N.; Adhikari, M.; Lamichhane, P.; Lee, S.J.; Kaushik, N.K.; Choi, E.H. Pulsed high-power microwaves do not impair the functions of skin normal and cancer cells in vitro: A short-term biological evaluation. J. Adv. Res. 2020, 22, 47–55. [Google Scholar] [CrossRef] [PubMed]
- Mumtaz, S.; Rana, J.N.; Choi, E.H.; Han, I. Microwave Radiation and the Brain: Mechanisms, Current Status, and Future Prospects. Int. J. Mol. Sci. 2022, 23, 9288. [Google Scholar] [CrossRef]
- Ceyhan, A.M.; Akkaya, V.B.; Gulecol, S.C.; Ceyhan, B.M.; Ozguner, F.; Chen, W. Protective effects of beta-glucan against oxidative injury induced by 2.45-GHz electromagnetic radiation in the skin tissue of rats. Arch. Dermatol. Res. 2012, 304, 521–527. [Google Scholar] [CrossRef] [PubMed]
- Salah, M.B.; Abdelmelek, H.; Abderraba, M. Effects of olive leave extract on metabolic disorders and oxidative stress induced by 2.45 GHz WIFI signals. Environ. Toxicol. Pharmacol. 2013, 36, 826–834. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.J.; Rhee, S.J. Green tea catechins protect rats from microwave-induced oxidative damage to heart tissue. J. Med. Food 2004, 7, 299–304. [Google Scholar] [CrossRef]
- Visalli, G.; Facciola, A.; Bertuccio, M.P.; Picerno, I.; Di Pietro, A. In vitro assessment of the indirect antioxidant activity of Sulforaphane in redox imbalance vanadium-induced. Nat. Prod. Res. 2017, 31, 2612–2620. [Google Scholar] [CrossRef] [PubMed]
- Baralic, K.; Zivanovic, J.; Maric, D.; Bozic, D.; Grahovac, L.; Antonijevic Miljakovic, E.; Curcic, M.; Buha Djordjevic, A.; Bulat, Z.; Antonijevic, B.; et al. Sulforaphane-A Compound with Potential Health Benefits for Disease Prevention and Treatment: Insights from Pharmacological and Toxicological Experimental Studies. Antioxidants 2024, 13, 147. [Google Scholar] [CrossRef]
- Fimognari, C.; Hrelia, P. Sulforaphane as a promising molecule for fighting cancer. Mutat. Res. 2007, 635, 90–104. [Google Scholar] [CrossRef]
- Wang, H.; Wang, B.; Wei, J.; Zheng, Z.; Su, J.; Bian, C.; Xin, Y.; Jiang, X. Sulforaphane regulates Nrf2-mediated antioxidant activity and downregulates TGF-beta1/Smad pathways to prevent radiation-induced muscle fibrosis. Life Sci. 2022, 311, 121197. [Google Scholar] [CrossRef]
- Zhao, X.D.; Zhou, Y.T.; Lu, X.J. Sulforaphane enhances the activity of the Nrf2-ARE pathway and attenuates inflammation in OxyHb-induced rat vascular smooth muscle cells. Inflamm. Res. 2013, 62, 857–863. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Zhao, Q.; Zhang, Y.; Shi, W.; Wang, H.; Zheng, Z.; Meng, L.; Xin, Y.; Jiang, X. Sulforaphane-Mediated Nrf2 Activation Prevents Radiation-Induced Skin Injury through Inhibiting the Oxidative-Stress-Activated DNA Damage and NLRP3 Inflammasome. Antioxidants 2021, 10, 1850. [Google Scholar] [CrossRef] [PubMed]
- Ferreira de Oliveira, J.M.; Costa, M.; Pedrosa, T.; Pinto, P.; Remedios, C.; Oliveira, H.; Pimentel, F.; Almeida, L.; Santos, C. Sulforaphane induces oxidative stress and death by p53-independent mechanism: Implication of impaired glutathione recycling. PLoS ONE 2014, 9, e92980. [Google Scholar] [CrossRef]
- Calabrese, V.; Cornelius, C.; Dinkova-Kostova, A.T.; Iavicoli, I.; Di Paola, R.; Koverech, A.; Cuzzocrea, S.; Rizzarelli, E.; Calabrese, E.J. Cellular stress responses, hormetic phytochemicals and vitagenes in aging and longevity. Biochim. Biophys. Acta 2012, 1822, 753–783. [Google Scholar] [CrossRef] [PubMed]
- Gong, Z.; Xue, L.; Li, H.; Fan, S.; van Hasselt, C.A.; Li, D.; Zeng, X.; Tong, M.C.F.; Chen, G.G. Targeting Nrf2 to treat thyroid cancer. Biomed. Pharmacother. 2024, 173, 116324. [Google Scholar] [CrossRef] [PubMed]
- Tossetta, G.; Fantone, S.; Marzioni, D.; Mazzucchelli, R. Cellular Modulators of the NRF2/KEAP1 Signaling Pathway in Prostate Cancer. Front. Biosci. (Landmark Ed.) 2023, 28, 143. [Google Scholar] [CrossRef] [PubMed]
- Adinolfi, S.; Patinen, T.; Jawahar Deen, A.; Pitkanen, S.; Harkonen, J.; Kansanen, E.; Kublbeck, J.; Levonen, A.L. The KEAP1-NRF2 pathway: Targets for therapy and role in cancer. Redox Biol. 2023, 63, 102726. [Google Scholar] [CrossRef] [PubMed]
- Kaiser, A.E.; Baniasadi, M.; Giansiracusa, D.; Giansiracusa, M.; Garcia, M.; Fryda, Z.; Wong, T.L.; Bishayee, A. Sulforaphane: A Broccoli Bioactive Phytocompound with Cancer Preventive Potential. Cancers 2021, 13, 4796. [Google Scholar] [CrossRef]
- Liu, P.; Wang, W.; Zhou, Z.; Smith, A.J.O.; Bowater, R.P.; Wormstone, I.M.; Chen, Y.; Bao, Y. Chemopreventive Activities of Sulforaphane and Its Metabolites in Human Hepatoma HepG2 Cells. Nutrients 2018, 10, 585. [Google Scholar] [CrossRef]
- Wang, Y.; Wu, H.; Dong, N.; Su, X.; Duan, M.; Wei, Y.; Wei, J.; Liu, G.; Peng, Q.; Zhao, Y. Sulforaphane induces S-phase arrest and apoptosis via p53-dependent manner in gastric cancer cells. Sci. Rep. 2021, 11, 2504. [Google Scholar] [CrossRef] [PubMed]
- Stefi, A.L.; Margaritis, L.H.; Skouroliakou, A.S.; Vassilacopoulou, D. Mobile phone electromagnetic radiation affects Amyloid Precursor Protein and alpha-synuclein metabolism in SH-SY5Y cells. Pathophysiology 2019, 26, 203–212. [Google Scholar] [CrossRef] [PubMed]
- Kazemi, E.; Mortazavi, S.M.; Ali-Ghanbari, A.; Sharifzadeh, S.; Ranjbaran, R.; Mostafavi-Pour, Z.; Zal, F.; Haghani, M. Effect of 900 MHz Electromagnetic Radiation on the Induction of ROS in Human Peripheral Blood Mononuclear Cells. J. Biomed. Phys. Eng. 2015, 5, 105–114. [Google Scholar] [PubMed]
- Ran, Y.; Duan, N.; Gao, Z.; Liu, Y.; Liu, X.; Xue, B. Sulforaphane attenuates irradiation induced testis injury in mice. Redox Rep. 2023, 28, 2279818. [Google Scholar] [CrossRef] [PubMed]
- Hwangbo, H.; Kim, S.Y.; Lee, H.; Park, S.H.; Hong, S.H.; Park, C.; Kim, G.Y.; Leem, S.H.; Hyun, J.W.; Cheong, J.; et al. Auranofin Enhances Sulforaphane-Mediated Apoptosis in Hepatocellular Carcinoma Hep3B Cells through Inactivation of the PI3K/Akt Signaling Pathway. Biomol. Ther. 2020, 28, 443–455. [Google Scholar] [CrossRef] [PubMed]
- Jabbarzadeh Kaboli, P.; Afzalipour Khoshkbejari, M.; Mohammadi, M.; Abiri, A.; Mokhtarian, R.; Vazifemand, R.; Amanollahi, S.; Yazdi Sani, S.; Li, M.; Zhao, Y.; et al. Targets and mechanisms of sulforaphane derivatives obtained from cruciferous plants with special focus on breast cancer—Contradictory effects and future perspectives. Biomed. Pharmacother. 2020, 121, 109635. [Google Scholar] [CrossRef]
- Wang, T.H.; Chen, C.C.; Huang, K.Y.; Shih, Y.M.; Chen, C.Y. High levels of EGFR prevent sulforaphane-induced reactive oxygen species-mediated apoptosis in non-small-cell lung cancer cells. Phytomedicine 2019, 64, 152926. [Google Scholar] [CrossRef]
- Xie, H.; Chun, F.K.; Rutz, J.; Blaheta, R.A. Sulforaphane Impact on Reactive Oxygen Species (ROS) in Bladder Carcinoma. Int. J. Mol. Sci. 2021, 22, 5938. [Google Scholar] [CrossRef]
- Bessler, H.; Djaldetti, M. Broccoli and human health: Immunomodulatory effect of sulforaphane in a model of colon cancer. Int. J. Food Sci. Nutr. 2018, 69, 946–953. [Google Scholar] [CrossRef]
- Chini, C.C.S.; Zeidler, J.D.; Kashyap, S.; Warner, G.; Chini, E.N. Evolving concepts in NAD(+) metabolism. Cell Metab. 2021, 33, 1076–1087. [Google Scholar] [CrossRef]
- Priya, D.K.; Gayathri, R.; Gunassekaran, G.R.; Sakthisekaran, D. Protective role of sulforaphane against oxidative stress mediated mitochondrial dysfunction induced by benzo(a)pyrene in female Swiss albino mice. Pulm. Pharmacol. Ther. 2011, 24, 110–117. [Google Scholar] [CrossRef] [PubMed]
- Holmstrom, K.M.; Kostov, R.V.; Dinkova-Kostova, A.T. The multifaceted role of Nrf2 in mitochondrial function. Curr. Opin. Toxicol. 2016, 1, 80–91. [Google Scholar] [CrossRef] [PubMed]
- Ludtmann, M.H.; Angelova, P.R.; Zhang, Y.; Abramov, A.Y.; Dinkova-Kostova, A.T. Nrf2 affects the efficiency of mitochondrial fatty acid oxidation. Biochem. J. 2014, 457, 415–424. [Google Scholar] [CrossRef] [PubMed]
- Villavicencio Tejo, F.; Quintanilla, R.A. Contribution of the Nrf2 Pathway on Oxidative Damage and Mitochondrial Failure in Parkinson and Alzheimer’s Disease. Antioxidants 2021, 10, 1069. [Google Scholar] [CrossRef] [PubMed]
- Serin, M.; Soylu, S.; Daştan, S.D.; Koç, S.; Kurt, A. Investigation of gene expression levels in thyroid tissues of rats treated with Wi-Fi electromagnetic wave (2.4–3 GHz Wi-Fi RF-EMF). J. Mol. Struct. 2023, 1288, 135741. [Google Scholar] [CrossRef]
- Hong, F.; Sekhar, K.R.; Freeman, M.L.; Liebler, D.C. Specific patterns of electrophile adduction trigger Keap1 ubiquitination and Nrf2 activation. J. Biol. Chem. 2005, 280, 31768–31775. [Google Scholar] [CrossRef]
- Kensler, T.W.; Egner, P.A.; Agyeman, A.S.; Visvanathan, K.; Groopman, J.D.; Chen, J.G.; Chen, T.Y.; Fahey, J.W.; Talalay, P. Keap1-nrf2 signaling: A target for cancer prevention by sulforaphane. Top. Curr. Chem. 2013, 329, 163–177. [Google Scholar] [CrossRef] [PubMed]
- Russo, M.; Spagnuolo, C.; Russo, G.L.; Skalicka-Wozniak, K.; Daglia, M.; Sobarzo-Sanchez, E.; Nabavi, S.F.; Nabavi, S.M. Nrf2 targeting by sulforaphane: A potential therapy for cancer treatment. Crit. Rev. Food Sci. Nutr. 2018, 58, 1391–1405. [Google Scholar] [CrossRef]
- Pan, J.; Wang, R.; Pei, Y.; Wang, D.; Wu, N.; Ji, Y.; Tang, Q.; Liu, L.; Cheng, K.; Liu, Q.; et al. Sulforaphane alleviated vascular remodeling in hypoxic pulmonary hypertension via inhibiting inflammation and oxidative stress. J. Nutr. Biochem. 2023, 111, 109182. [Google Scholar] [CrossRef]
- Schepici, G.; Bramanti, P.; Mazzon, E. Efficacy of Sulforaphane in Neurodegenerative Diseases. Int. J. Mol. Sci. 2020, 21, 8637. [Google Scholar] [CrossRef]
- Zaghlool, S.S.; Abdelaal, N.; El-Shoura, E.A.M.; Mahmoud, N.I.; Ahmed, Y.M. Restoring glomerular filtration rate by sulforaphane modulates ERK1/2/JNK/p38MAPK, IRF3/iNOS, Nrf2/HO-1 signaling pathways against folic acid-induced acute renal injury in rats. Int. Immunopharmacol. 2023, 123, 110777. [Google Scholar] [CrossRef] [PubMed]
- Hussain, A.; Mohsin, J.; Prabhu, S.A.; Begum, S.; Nusri Qel, A.; Harish, G.; Javed, E.; Khan, M.A.; Sharma, C. Sulforaphane inhibits growth of human breast cancer cells and augments the therapeutic index of the chemotherapeutic drug, gemcitabine. Asian Pac. J. Cancer Prev. 2013, 14, 5855–5860. [Google Scholar] [CrossRef] [PubMed]
- Condello, S.; Calabro, E.; Caccamo, D.; Curro, M.; Ferlazzo, N.; Satriano, J.; Magazu, S.; Ientile, R. Protective effects of agmatine in rotenone-induced damage of human SH-SY5Y neuroblastoma cells: Fourier transform infrared spectroscopy analysis in a model of Parkinson’s disease. Amino Acids 2012, 42, 775–781. [Google Scholar] [CrossRef] [PubMed]
- Caccamo, D.; Campisi, A.; Curro, M.; Aguennouz, M.; Li Volti, G.; Avola, R.; Ientile, R. Nuclear factor-kappab activation is associated with glutamate-evoked tissue transglutaminase up-regulation in primary astrocyte cultures. J. Neurosci. Res. 2005, 82, 858–865. [Google Scholar] [CrossRef]
- Curro, M.; Saija, C.; Trainito, A.; Trovato-Salinaro, A.; Bertuccio, M.P.; Visalli, G.; Caccamo, D.; Ientile, R. Rotenone-induced oxidative stress in THP-1 cells: Biphasic effects of baicalin. Mol. Biol. Rep. 2023, 50, 1241–1252. [Google Scholar] [CrossRef]







| SFN | 2.45 GHz Radiation Exposure | SH-SY5Y | PBMCs |
|---|---|---|---|
| W/O | - | 5.06 ± 0.7 | 1.90 ± 0.5 |
| + | 7.52 ± 0.8 * | 1.56 ± 0.3 | |
| 5 µg/mL | - | 3.74 ± 0.9 | 2.57 ± 0.4 |
| + | 4.98 ± 0.6 § | 1.61 ± 0.5 | |
| 10 µg/mL | - | 3.50 ± 0.5 # | 1.69 ± 0.5 |
| + | 5.20 ± 0.7 *, § | 1.55 ± 0.4 | |
| 25 µg/mL | - | 4.72 ± 1.0 | 1.45 ± 0.4 |
| + | 5.81 ± 1.5 | 1.37 ± 0.3 |
| Target | Primer Sequence 5′ > 3′ | |
|---|---|---|
| Forward | Reverse | |
| β-actin | TTGTTACAGGAAGTCCCTTGCC | ATGCTATCACCTCCCCTGTGTG |
| Nrf2 | CATCACCAGAACACTCAG | CTTCCACTTCAGAATCACT |
| SOD2 | TGCTGCTTGTCCAAATCAGG | CACACATCAATCCCCAGCAGT |
| BAX | GGACGAACTGGACAGTAACATGG | GCAAAGTAGAAAAGGGCGACAAC |
| BCL2 | ATCGCCCTGTGGATGACTGAG | CAGCCAGGAGAAATCAAACAGAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bertuccio, M.P.; Saija, C.; Acri, G.; Ientile, R.; Caccamo, D.; Currò, M. Sulforaphane Effects on Neuronal-like Cells and Peripheral Blood Mononuclear Cells Exposed to 2.45 GHz Electromagnetic Radiation. Int. J. Mol. Sci. 2024, 25, 7872. https://doi.org/10.3390/ijms25147872
Bertuccio MP, Saija C, Acri G, Ientile R, Caccamo D, Currò M. Sulforaphane Effects on Neuronal-like Cells and Peripheral Blood Mononuclear Cells Exposed to 2.45 GHz Electromagnetic Radiation. International Journal of Molecular Sciences. 2024; 25(14):7872. https://doi.org/10.3390/ijms25147872
Chicago/Turabian StyleBertuccio, Maria Paola, Caterina Saija, Giuseppe Acri, Riccardo Ientile, Daniela Caccamo, and Monica Currò. 2024. "Sulforaphane Effects on Neuronal-like Cells and Peripheral Blood Mononuclear Cells Exposed to 2.45 GHz Electromagnetic Radiation" International Journal of Molecular Sciences 25, no. 14: 7872. https://doi.org/10.3390/ijms25147872
APA StyleBertuccio, M. P., Saija, C., Acri, G., Ientile, R., Caccamo, D., & Currò, M. (2024). Sulforaphane Effects on Neuronal-like Cells and Peripheral Blood Mononuclear Cells Exposed to 2.45 GHz Electromagnetic Radiation. International Journal of Molecular Sciences, 25(14), 7872. https://doi.org/10.3390/ijms25147872

