Next Article in Journal
Self-Assembling Nanoparticle Hemagglutinin Influenza Vaccines Induce High Antibody Response
Next Article in Special Issue
From Regulation to Application: The Role of Abscisic Acid in Seed and Fruit Development and Agronomic Production Strategies
Previous Article in Journal
Sickle Cell Disease and Gut Health: The Influence of Intestinal Parasites and the Microbiome on Angolan Children
Previous Article in Special Issue
Characterising Biological and Physiological Drought Signals in Diverse Parents of a Wheat Mapping Population
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of Sorghum Paclobutrazol-Resistance Gene Family and Functional Characterization of SbPRE4 in Response to Aphid Stress

1
Institute of Millet Crops, Hebei Academy of Agriculture & Forestry Sciences/Hebei Branch of China National Sorghum Improvement Center, Shijiazhuang 050035, China
2
Hebei Plant Protection and Plant Inspection Station, Shijiazhuang 050035, China
3
Hebei Academy of Agriculture & Forestry Sciences, Shijiazhuang 050035, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2024, 25(13), 7257; https://doi.org/10.3390/ijms25137257
Submission received: 31 May 2024 / Revised: 28 June 2024 / Accepted: 28 June 2024 / Published: 1 July 2024
(This article belongs to the Special Issue Plant Hormone Signaling)

Abstract

Sorghum (Sorghum bicolor), the fifth most important cereal crop globally, serves as a staple food, animal feed, and a bioenergy source. Paclobutrazol-Resistance (PRE) genes play a pivotal role in the response to environmental stress, yet the understanding of their involvement in pest resistance remains limited. In the present study, a total of seven SbPRE genes were found within the sorghum BTx623 genome. Subsequently, their genomic location was studied, and they were distributed on four chromosomes. An analysis of cis-acting elements in SbPRE promoters revealed that various elements were associated with hormones and stress responses. Expression pattern analysis showed differentially tissue-specific expression profiles among SbPRE genes. The expression of some SbPRE genes can be induced by abiotic stress and aphid treatments. Furthermore, through phytohormones and transgenic analyses, we demonstrated that SbPRE4 improves sorghum resistance to aphids by accumulating jasmonic acids (JAs) in transgenic Arabidopsis, giving insights into the molecular and biological function of atypical basic helix-loop-helix (bHLH) transcription factors in sorghum pest resistance.

1. Introduction

Sorghum (Sorghum bicolor) is the fifth cereal crop in terms of total production worldwide, providing a staple food source for over half a billion people in Africa and Asia, a nutritional supplement for livestock, and a biofuel resource for industrial use [1]. It also contributes to the production of industrial materials such as alcohol [2]. Previous studies indicate that sorghum stems can contain approximately 20% sugar under stress conditions, a component directly convertible to biofuel [2]. The resilience of various sorghum germplasms to both biotic and abiotic stresses further enhance its value [3]. Consequently, sorghum presents as an optimal energy crop for cultivation on nutrient-deficient soils, promising to improve the productivity of agriculture. However, its stable production is seriously threatened by the sorghum aphid (Melanaphis sacchari) [4]. The aphid can feed on the entire reproductive period of sorghum. They tend to directly cluster and parasitize on the stems and underside of leaves, and in severe cases, they can cover the entire sorghum plant. While sucking the sap from the sieve tubes, sorghum aphids also secrete ‘honeydew’, which covers the leaves, reduces plant photosynthesis, and affects metabolic reactions. Affected plants will show a loss of green color in leaves, and stems become fragile, making them more prone to lodging. Additionally, the sorghum aphid can also transmit viruses such as maize red stripe, sugarcane mosaic, and sugarcane yellow leaf viruses, leading to reduced sorghum yield and lower quality [5].
The bHLH is one of the most important transcription factor (TF) families in plants [6], containing a basic DNA-binding domain and a highly conserved helix–loop–helix domain [7,8]. Based on their DNA-binding capability, bHLH proteins can be divided into DNA-binding bHLH (typical bHLH) and non-DNA-binding bHLH (atypical HLH) [8]. Atypical bHLH proteins lack the basic region necessary for DNA binding, yet their HLH domain can engage with typical bHLH proteins to modulate downstream genes [9,10].
The PRE proteins are classified as atypical bHLH transcription factors and have been implicated in the regulation of plant growth and development. Additionally, they have been shown to participate in responses to plant hormones and environmental stimuli, such as temperature and light [9,10,11,12,13,14]. Arabidopsis thaliana has six PRE genes that display a range of functions in the development of plants. PRE1/BANQUO1/(BNQ1)/bHLH136, firstly identified as PRE transcription factor, influenced processes such as seed germination, stem/leaf elongation, flowering, and fruit development through GA signaling [9,14,15,16]. Similarly, other PRE proteins such as PRE3, PRE4, and PRE6 play roles in various physiological processes, including plant hormones signaling, light response, and organ elongation [13,17]. Furthermore, the regulation of PRE genes by transcription factors such as BRASSINAZOLE-RESISTANT1 (BZR1) and phytochrome-interacting factor 4 (PIF4) underscores their involvement in multiple signaling pathways and developmental processes in plants [11,16].
Previous research has focused on the function of PRE genes in plant growth, development, and abiotic stress tolerance. To elucidate the roles of PRE genes in sorghum aphid stress response, seven PRE members in sorghum were identified by homologous sequence alignment. Additionally, this study characterized the SbPRE gene family using bioinformatics and molecular biology techniques, including an analysis of genetic structure, promoter regions, and expression patterns. The results indicated that SbPRE genes, especially SbPRE4, are involved in the aphid stress response, and this study establishes the foundation for further investigations into the biological and molecular functions of SbPRE genes.

2. Results

2.1. Identification and Characterization of the PRE Gene Family in the Sorghum Genome

According to Fan et al. [18], the sorghum genome contains 174 bHLH genes. To identify sorghum PRE members in this study, BLASTp analysis was performed utilizing Arabidopsis thaliana PRE protein sequences. Through this analysis, seven SbPRE members were screened out in the BTx623 genome and assigned the names SbPRE1, SbPRE2, SbPRE3, SbPRE4, SbPRE5, SbPRE6, and SbPRE7 according to their sequence similarity with A. thaliana PRE genes. (Table 1). The CDS lengths and protein lengths of the seven identified SbPRE genes varied from 261 to 1080 bp and 87 to 360 amino acids, respectively (Table 1). The N-terminal regions of all SbPRE proteins were found to contain the highly conserved bHLH domain (Table 1, Figure 1). The molecular weight of the SbPRE proteins were predicted to range from 9690.97 (SbPRE5) to 37,275.27 (SbPRE3) Da. Furthermore, the predicted isoelectric points (pI values) of these proteins varied between 6.35 (SbPRE3) and 9.48 (SbPRE2) based on sequence analysis.

2.2. Chromosome Localization, Gene Structure, and Genetic Evolution Analysis of the SbPRE Genes

Genomic location data, retrieved from the Phytozome v13 database, facilitated the mapping of SbPRE genes onto four distinct chromosomes. Chromosome 4 and chromosome 5 individually harbor one SbPRE gene, while chromosome 6 hosts SbPRE1 and SbPRE2, and chromosome 1 contains SbPRE4, SbPRE5, and SbPRE6 (Figure 2A). Details regarding the IDs and genomic coordinates of these SbPRE genes are presented in Table 1.
To identify the distinctions among SbPRE gene architectures, the numbers of exons and introns were analyzed. The results showed that SbPRE1, SbPRE4, SbPRE5, and SbPRE6 contain two exons and one intron, which were similar to the architecture of MdPRE genes [19], while SbPRE2, SbPRE3, and SbPRE7 contain five, six, and one exon(s), respectively, (Figure 2B), indicating the functional differentiation of the SbPRE gene during evolution.
Phylogenetic analysis is crucial for elucidating the evolutionary relationships among crop species. A phylogenetic tree was generated through the utilization of seven PRE proteins from sorghum (Sorghum bicolor), five PRE proteins from Arabidopsis (Arabidopsis thaliana), and three PRE proteins from rice (Oryza sativa) in conjunction with eight PRE proteins in cotton (Gossypium hirsutum). The resultant phylogenetic tree showed that SbPRE1 was closely related to Os_Q7X742, SbPRE4 was more closely related to Os_Q0DUR2, and SbPRE6 was closely related to Os_Q338G6 (Figure 3), which suggested SbPREs might have a similar biological function to their homologs. However, SbPRE2, SbPRE3, and SbPRE5, SbPRE7, were clustered into independent groups, respectively, (Figure 3), indicating that they might modulate the important agronomy traits related to sorghum evolution and domestication.

2.3. Expression Patterns of SbPREs across Sorghum Tissues

For the initial exploration of temporal and spatial expression profiles of SbPRE genes across sorghum tissues, the levels of SbPRE expression were evaluated in root, shoot, leaf, seedling, 1–2 cm inflorescence, pollen, embryo, endosperm, and pericarp using public data (Figure 4) [20]. The results showed that the SbPRE genes were expressed in most tissues. SbPRE2, SbPRE3, and SbPRE7 exhibited high expression levels in root, shoot, leaf, inflorescence, and seed organs, suggesting their significant roles during growth and developmental processes. SbPRE1 and SbPRE6 demonstrated peak expression in root. Interestingly, SbPRE4 and SbPRE5 displayed a substantial up-regulation in inflorescence. Particularly, SbPRE4 also showed predominant expression in pollen and seed organs, indicating their likely involvement in the reproductive growth stage.

2.4. Analysis of Cis-Elements in SbPREs Promoter

The expression and function of genes are influenced by cis-regulatory elements present in their promoter regions. In this study, cis-acting elements within the 2 kb promoter sequences upstream of SbPRE genes were examined to identify elements associated with environmental stresses and hormone responses using the PlantCARE database [21] (Figure 5A). A total of 81 cis-elements were predicted and categorized into eight distinct types: (1) auxin-responsive elements such as the TGA-element and AuxRR-core; (2) defense and stress response-related TC-rich repeats; (3) elements linked to gibberellin (GA) responses including the TATC-box, P-box, and GARE-motif; (4) low-temperature responsive LTR elements; (5) salicylic acid (SA)-responsive TCA-element; (6) ABA-responsive ABRE transcriptional factor; (7) anaerobic and anoxic response-inducing ARE and GC-motif elements; and (8) methyl-jasmonic acid (MeJA) response-associated CGTCA- and TGACG-motifs. Notably, each SbPRE gene promoter harbored a minimum of two types of these cis-elements, with the MeJA responsive element being the most prevalent element identified. All of the above suggested that SbPRE genes might play vital roles in sorghum adaption to environmental challenges.

2.5. SbPRE Genes Expression under Abotic and Aphid Stress

In order to identify the roles of SbPREs in response to abiotic stress (heat, salt, and drought) and biotic stress (aphid), RNA-Seq data under heat, salt, drought, and aphid stress treatment [22], ref. [23] were reanalyzed using Tbtools. Notably, under three abiotic stress conditions, SbPRE1, SbPRE6, and SbPRE7 exhibited down-regulation, whereas SbPRE2 and SbPRE4 demonstrated up-regulation at different time points. SbPRE3 and SbPRE5 showed induced expression in response to heat and drought stress (Figure 6A). Under aphid stress, SbPRE1 was down-regulated at the 10th and 15th day after aphid inoculation in both BCK60 (aphid-susceptible material) and RTx2783 (aphid-resistant material). SbPRE2 showed the opposite expression pattern in susceptible (BCK60) and resistant (RTx2783) lines. After 15-day aphid inoculation, SbPRE3 and SbPRE3 exhibited obvious up-regulation in BCK60. It is notable that under aphid treatment, SbPRE4 exhibited higher expression in the resistant line of RTx2783 compared to BCK60 (Figure 6B). The induced expression patterns suggest a potential role for SbPREs in stress adaptation mechanisms in sorghum.

2.6. Overexpressing SbPRE4 Enhanced Aphid Resistance of Arabidopsis Thaliana by Accumulating JAs

In order to assess the potential aphid resistance conferred by the heterologous expression of SbPRE4 in Arabidopsis, we generated SbPRE4 over-expression (OE) stable transgenic lines by transforming p35S::SbPRE4 into Arabidopsis thaliana (Col-0). Homozygous plants from three independent transformed lines (OE 5-7, OE 8-7, and OE 9-4) were obtained, and the expression of SbPRE4 was validated using qRT-PCR (Figure 7B). An evaluation of M. persicae proliferation revealed a significant decrease in aphid densities in these three transgenic lines compared to Col-0 (Figure 7A,C). These findings provide additional evidence supporting the proposition that improved SbPRE4 expression can effectively reduce the aphid population.
Jasmonic acids contribute to plant tolerance to aphids [24]. We measured the content of JA, OPDA, JA-Ile, and H2JA in Col-0 and the transgenic lines. The results demonstrate that SbPRE4 transgenic lines exhibited elevated levels of JA at each time point analyzed in comparison to the control (Figure 7D). Similarly, OPDA, H2JA, and JA-Ile levels increased along with aphid infestation (Figure 7D). JA biosynthesis genes (Figure 7E) up-regulation was also observed in SbPRE4 OE lines, thus confirming the role of this gene in regulating JA biosynthesis. Subsequently, we treated the sorghum aphid-susceptible line 7B and Col-0 with 0.1 μM exogenous JA during aphid infestation; there was a significant decrease in the aphid number compared with the control (Figure 8A,B). These results suggest that SbPRE4 enhanced plant aphid resistance via enhancing JA concentration.

3. Discussion

Paclobutrazol-Resistance (PRE) genes represent a class of genes encoding proteins that counteract the growth regulator paclobutrazol by inhibiting GA synthesis. PRE belongs to an atypical bHLH subfamily [11]. Despite the crucial roles PREs play in plant hormonal signaling and stress response, their presence and functional characteristics in sorghum remain unknown. This research conducted a comprehensive investigation and functional characterization of the SbPRE gene family utilizing bioinformatics tools and plant genetic modification biotechnologies. By integrating these findings with established functional studies in other species, this study offers insights for future investigations into sorghum PRE genes and paves the way for the identification of SbPRE genes associated with key resistant traits.
Research on the PRE genes has been conducted in various major crops such as Oryza sativa, Gossypium hirsutum, Helianthus annuus, and Triticum aestivum [25]. In sorghum, seven PRE genes were identified, indicating the conservation of this gene family across plant species. The gene structure and functional domains of SbPREs were elucidated through sequence analysis (Figure 1 and Figure 2B). It is known that the bHLH family is divided into DNA-binding bHLH (typical bHLH) and non-DNA-binding bHLH (atypical HLH). The SbPRE proteins belong to atypical bHLH transcription factors, which lack the DNA binding domain (Table 1 and Figure 1); therefore, they do not function as transcription factors. However, they can negatively regulate other bHLH transcription factors by forming heterodimers with them through the C-terminal HLH region, regulating gene expression.
RNA-seq data revealed that a significant role of SbPREs during growth and developmental processes, including SbPRE2, SbPRE3, SbPRE4, and SbPRE7 exhibited high expression levels in root, shoot, leaf, inflorescence, and seed organs (Figure 4). The findings aligned with previous investigations across diverse plant tissues. In Arabidopsis thaliana, AtPRE1 altered germination, the elongation of the hypocotyl/petiole, floral induction, and fruit development by regulating gibberellin (GA) [26]. In Gossypium hirsutum, PRE genes such as GhA09G0192 (GhPRE1), GhD09G0182, GhA07G1964, and GhD07G2183 exhibited abundant expression in floral tissues and GhPRE1 was a positive regulator of fiber elongation [25]. In rice, the PRE gene OsILI6 was mainly expressed in the root, and could also be detected in the pistil, lemma, palea, and young panicle, while it was almost absent in leaves and pistils [27]. Besides cereal crops, PRE genes play similar roles in horticulture plants. In strawberries (Fragaria ananassa), FaPRE1 was predominantly expressed in ripe receptacles rather than in vegetative tissues [28]. In tomatoes (Solanum lycopersicum Mill. cv. Ailsa Craig), the PRE genes expression profiles were different. For example, SlPRE1 was specific to flowers, the peak of SlPRE2 expression was at the 10th day after aphid inoculation, SlPRE3 showed low abundance, SlPRE4 was highly expressed in hypocotyl and vegetative tissues, and SlPRE5 displayed expression across multiple tissues [29]. These varying tissue-specific expression patterns of PREs in different plant species imply their involvement in diverse biological processes, suggestive of intricate and multifaceted functions.
Previous studies showed that PREs are involved in hormonal signaling. AtPRE2 and AtPRE6 in Arabidopsis play a significant role in ABA-mediated salt response. The expression levels of six AtPRE genes were decreased upon ABA treatment but elevated when exposed to salt stress [17]. In addition, AtPRE6 was negatively modulated in the Auxin signaling pathway, while it was positively regulated in the ABA and salt signaling pathways [30]. In strawberries (Fragaria ananassa), FaPRE1 could be repressed by IAA and activated by ABA, but the expression was almost unaffected by GA [28]. Moreover, MdPRE4.3 owned the potential to enhance apple response to NaCl, ABA, and IAA, as well as enhance BR tolerance, while it almost does not affect the GA response [19]. In this study, the analysis of the SbPRE promoter indicated the presence of diverse cis-elements, including phytohormones and abiotic stress responsive elements (Figure 5). Additionally, various abiotic stresses (e.g., NaCl, drought, and heat) could influence SbPRE expression, suggesting its involvement in abiotic stresses in sorghum (Figure 6). However, the regulation mechanism of PREs in biotic stress remains unclear. We cloned SbPRE4 and overexpressed it in transgenic Arabidopsis for further experiments. The results showed that SbPRE4 enhanced Col-0 aphid resistance by accumulating JAs (Figure 7). As a reconfirmation, exogenous JA reduced aphid numbers on Arabidopsis and sorghum plants after aphid infestation for 7 days (Figure 8), suggesting that SbPRE4 may be a positive regulator of JA regulating aphid resistance.
In summary, this study comprehensively investigated the PRE family genes in sorghum. The expression of the SbPRE genes in various sorghum tissues and under diverse stress conditions was thoroughly examined using RNA-seq data; moreover, the function of the SbPRE4 gene, which was related to aphid resistance, was analyzed and confirmed through transgenic Arabidopsis. These findings substantially advance our comprehension of the SbPRE genes and will provide better resources for the future study and exploration of the PRE family genes in sorghum and other plant species.

4. Materials and Methods

4.1. Identification of the PRE Genes in Sorghum

In this study, the updated version of the Sorghum bicolor v3.1.1 genome was obtained from phytozome v13 (https://phytozome-next.jgi.doe.gov/ (accessed on 21 May 2024)) [31]. Blastp was used to identify all members of the SbPRE gene family. Protein homology alignment was conducted using Arabidopsis thaliana PRE protein sequences downloaded from the TAIR database (https://www.arabidopsis.org/ (accessed on 21 May 2024)) as the query sequence [32], including AtPRE1 (At5g39860), AtPRE2 (At5g15160), AtPRE3 (At1g74500), AtPRE4 (At3g47710), AtPRE5 (At3g28857), and AtPRE6 (At1g26945). The identified sorghum sequences were validated for conserved domains via submission to SMART (http://smart.embl-heidelberg.de/ (accessed on 21 May 2024)) [33], confirming them as candidate SbPREs. The gene length of SbPREs was extracted from the GFF3 annotation file of the reference genome. Additionally, predictions of the SbPRE protein sequences length, molecular weight, and isoelectric point (pI) were generated by ExPasy (https://www.expasy.org/ (accessed on 21 May 2024)). Furthermore, the bHLH structural domain localization within SbPREs was determined utilizing the Pfam database.

4.2. SbPRE Chromosomal Localizations and Gene Structures

To extract and visualize the chromosomal locations of the putative SbPREs, we utilized the Gtf/Gff3 sequence extraction tool and Gene Location Visualization function provided by TBtools [34]. By cross-referencing the sorghum gff3 file annotation, we were able to identify and visually represent the UTR regions, exon positions, and intron positions of the SbPRE genes using TBtools.

4.3. Structural Domains, Phylogenetic Analysis, and Promoters Analysis of SbPREs

The Arabidopsis thaliana PRE sequences were sourced from the investigation conducted by Petroni et al. [35]. According to the existing literature, a collective 24 PRE genes were identified, seven for sorghum (S. bicolor), three for rice (O. sativa), eight for cotton (G. hirsutum), and six for Arabidopsis (A. thaliana). Sequence alignment was carried out using MUSCLE, which is available at www.ebi.ac.uk/Tools/msa/muscle/ (accessed on 21 May 2024). The phylogenetic tree was constructed utilizing the maximum likelihood approach in the MEGA 7.0 software, and its robustness was evaluated through bootstrap analysis comprising 1000 iterations. The resulting tree was visualized by the online tool Evolview v3 [36]. The entirety of the sorghum genome sequence was acquired from the Phytozome v13 database. The 2000 bp sequences preceding the transcription initiation site of the seven SbPRE genes were isolated as potential promoter sequences. The promoters were subjected to analysis for cis-acting elements associated with stress responsiveness and plant hormones using the PlantCARE software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/ (accessed on 21 May 2024)). The results were visualized by TBtools.

4.4. Expression Analysis of SbPREs by RNA-Seq Data or qRT-PCR

The raw transcriptome data of sorghum tissues were retrieved from the EBI database under the accession number ERP024458 [22]. Additionally, gene expression profiles in response to salinity, drought, heat, and aphid stresses were acquired from publicly available RNA-seq datasets [23]. The HISAT2 software (v2.2.0) was employed for aligning reads to the S. bicolor genome with default settings, and reads quantification was performed using StringTie software (v2.2.1), both of which were facilitated by TBtools. The normalization of gene expression levels was carried out utilizing the TPM (transcripts per kilobase million) method. The visualization of gene expression patterns was achieved through the utilization of the Super Heatmap browser tool within TBtools.
For qRT-PCR, the RNA was isolated as described [37]. AT1G32200 (Actin1) was used as the Arabidopsis internal gene. AT3G25760 (AOC1), AT5G42650 (AOS), AT1G72520 (LOX4), AT2G06050 (OPR3), JA biosynthesis genes, were detected. All primer sequences can be found in the research of Huang et al. [38].

4.5. Plant Materials and Aphid Treatments

The Columbia-0 (Col-0) wild-type Arabidopsis was employed for plant transformation. Both wild-type and transgenic Arabidopsis plants were germinated and cultivated in soil-filled pots. The growth conditions included a temperature of 22 °C, a photon flux density of approximately 125 μmol m−2 s−1, and photoperiods of 16 h light/8 h dark for long-day conditions and 8 h light/16 h dark for short-day conditions within a growth chamber. The aphids used for Arabidopsis were M. persicae; for detailed information refer to Moran and Thompson [39]. The 28-day-old Col-0 and OE SbPRE4 transgenic Arabidopsis were inoculated with one wingless adult aphids. Plants were individually caged and aphids were counted 7 days later.
The sorghum aphid-susceptible line 7B was used. The seeds were planted in plastic containers filled with a soil mixture composed of vermiculite/organic substrate/loam (1:1:1 v/v/v). After germination, plants were grown in a greenhouse set at a constant temperature (28 ± 2 °C) with a 14/10 (light/dark) photoperiod and 60% relative humidity. Plants at the three-leaf stage were inoculated with aphids (M. sacchari); for detailed information refer to Pant et al. [40]. The experiments were carried out in Shijiazhuang (Hebei Province, China) in 2023.

4.6. Construction of the SbPRE4 Expression Vector and Arabidopsis Transformation

The construction of the 35S:SbPRE4 vector involved ligating the polymerase chain reaction (PCR) product into the BamHI restriction site of the pRok2 vector driven by the cauliflower mosaic virus 35S promoter. Subsequently, this vector was transformed into the Agrobacterium tumefaciens strain GV3101. The full-length fragments of SbPRE4 were amplified from Btx623 sorghum using the polymerase chain reaction (PCR). The cloning primers used were SbPRE4-F 5′ATCGAGGTGCTGTAGCTTCG3′ and SbPRE4-R 5′TGTCGTCGTCGTCTTCAGTG3′; qRT-PCR primers were SbPRE4-F1 5′ACGAGCTCATCTCCAAGCTG3′ and SbPRE4-R1 GCAGTTCCCAGATCAGTGCC.
The 35S:SbPRE4 vector was transformed into Arabidopsis thaliana (Col-0) using the floral dip method as described by Clough and Bent [41]. Transgenic plants were identified by their resistance to 25 mg/L kanamycin on MS medium and allowed to grow to maturity.

4.7. Quantification of Phytohormones and JA Treatment

Following aphid treatment, plant samples of Col-0 and OE SbPRE4 (approximately 0.1 g each) were immediately frozen in liquid nitrogen and subsequently ground into powder. These ground samples were then subjected to extraction using a mixture of methanol, water, and formic acid (15:4:1, v:v:v). The resulting extracts were filtered through a 0.22 μm PTFE filter (Anpel, Shanghai, China) and subsequently analyzed using an LC-ESI-MS/MS system. This system consisted of an HPLC Shim-pack UFLC SHI-MADZU CBM30A (Shimadzu, Shanghai, China) system in conjunction with an Applied Biosystems 6500 Triple Quadrupole MS instrument (ThermoFisher, Shanghai, China). The AB6500 QTRAP LC/MS/MS system, equipped with an ESI turbo ion-spray interface and controlled by Analyst 1.6 software by AB Sciex (Framingham, MA, USA), was operated in both positive and negative ion modes for analysis [42]. The analytical conditions were as follows: LC, column, Waters ACQUITY UPLC HSS T3 C18 (100 mm × 2.1 mm i.d., 1.8 µm); solvent system, water with 0.04% acetic acid (A) and acetonitrile with 0.04% acetic acid (B); gradient program, started at 5% B (0–1 min), increased to 95% B (1–8 min), then to 95% B (8–9 min), and finally returned to 5% B (9.1–12 min); flow rate, 0.35 mL/min; temperature, 40 °C; and injection volume: 2 μL. The ESI source operation parameters were as follows: ion source, ESI+/−; source temperature 550 °C; ion spray voltage (IS) 5500 V (Positive), −4500 V (Negative); and curtain gas (CUR) was set at 35 psi. The Metware phytohormone database (MetWare, Wuhan, China) was constructed based on a standard set of phytohormones.
For JA treatment, 28-day-old Col-0 and the sorghum susceptible line 7B at the three-leaf stage were sprayed with 0.1 μM JA along with aphid infestation. Arabidopsis and sorghum were treated for every two days and three days, respectively. Three biological replicates were conducted.

4.8. Statistical Analysis

Each experiment was conducted with three biological replicates, and within each biological replicate, three technical replicates were performed. The data are presented as means ± SD. Different lowercase letters in the comparison between multiple groups indicate a significant difference at p < 0.05 based on a one-way analysis of variance (ANOVA). The mean grouping test used in the ANOVA was Tukey HSD. Student’s t-test: (* p < 0.05 and ** p < 0.01) was used to analyze the statistical significance of the two groups. Error bars represent the standard deviation.

5. Conclusions

In this study, seven SbPRE genes were identified in sorghum and were distributed on chromosome 1, 4, 5 and 6. Phylogenetic evolution, cis-acting elements, and expression analysis suggested that SbPRE genes might play crucial roles in sorghum adaption to environmental stresses. The expression level of SbPRE4 was up-regulated by aphid treatment. Moreover, overexpressing SbPRE4 enhanced Arabidopsis aphid resistance by improving JAs. Furthermore, exogenous JA can decrease the aphid population in Arabidopsis and sorghum significantly. These findings implied that SbPREs, especially SbPRE4, play pivotal roles in the response to aphid stress.

Author Contributions

Conceptualization, Y.G. and Z.W.; methodology, Z.J., G.Y. and L.C.; software, P.D. and J.N.; writing—review and editing, Y.S., P.L. and J.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Hebei Natural Science Foundation for youths (No. C2022301063), the China Agriculture Research System (CARS-06-14.5-B5), and the HAAFS Basic Science and Technology Contract Project (HBNKY-BGZ-02).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data, tables, and figures in this manuscript are original, and are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Tao, Y.; Luo, H.; Xu, J.; Cruickshank, A.; Zhao, X.; Teng, F.; Hathorn, A.; Wu, X.; Liu, Y.; Shatte, T.; et al. Extensive variation within the pan-genome of cultivated and wild sorghum. Nat. Plants 2021, 7, 766–773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Dahlberg, J. The Role of Sorghum in Renewables and Biofuels. Methods Mol. Biol. 2019, 1931, 269–277. [Google Scholar] [PubMed]
  3. Chadalavada, K.; Kumari, B.D.R.; Kumar, T.S. Sorghum mitigates climate variability and change on crop yield and quality. Planta 2021, 253, 113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Singh, B.U.; Padmaja, P.G.; Seetharama, N. Biology and management of the sugarcane aphid, Melanaphis sacchari (Zehntner) (Homoptera: Aphididae), in sorghum: A review. Crop Prot. 2004, 23, 739–755. [Google Scholar] [CrossRef] [Scilit]
  5. Berg, J.V.D. Status of resistance of sorghum hybrids to the aphid, Melanaphis sacchari (Zehntner) (Homoptera: Aphididae). S. Afr. J. Plant Soil 2002, 19, 151–155. [Google Scholar] [CrossRef] [Scilit]
  6. Feller, A.; Machemer, K.; Braun, E.L.; Grotewold, E. Evolutionary and comparative analysis of MYB and bHLH plant transcription factors. Plant J. 2011, 66, 94–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Carretero-Paulet, L.; Galstyan, A.; Roig-Villanova, I.; Martinez-Garcia, J.F.; Bilbao-Castro, J.R.; Robertson, D.L. Genome-wide classification and evolutionary analysis of the bHLH family of transcription factors in Arabidopsis, poplar, rice, moss, and algae. Plant Physiol. 2010, 153, 1398–1412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Han, Z.; Yi, P.; Li, X.; Olson, E.N. Hand, an evolutionarily conserved bHLH transcription factor required for Drosophila cardiogenesis and hematopoiesis. Development 2006, 133, 1175–1182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Hyun, Y.; Lee, I. KIDARI, encoding a non-DNA Binding bHLH protein, represses light signal transduction in Arabidopsis thaliana. Plant Mol. Biol. 2006, 61, 283–296. [Google Scholar] [CrossRef] [Scilit]
  10. Mara, C.D.; Huang, T.; Irish, V.F. The Arabidopsis floral homeotic proteins APETALA3 and PISTILLATA negatively regulate the BANQUO genes implicated in light signaling. Plant Cell 2010, 22, 690–702. [Google Scholar] [CrossRef] [Scilit]
  11. Bai, M.Y.; Fan, M.; Oh, E.; Wang, Z.Y. A triple helix-loop-helix/basic helix-loop-helix cascade controls cell elongation downstream of multiple hormonal and environmental signaling pathways in Arabidopsis. Plant Cell 2012, 24, 4917–4929. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Castelain, M.; Le Hir, R.; Bellini, C. The non-DNA-binding bHLH transcription factor PRE3/bHLH135/ATBS1/TMO7 is involved in the regulation of light signaling pathway in Arabidopsis. Physiol. Plant 2012, 145, 450–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Wang, H.; Zhu, Y.; Fujioka, S.; Asami, T.; Li, J.; Li, J. Regulation of Arabidopsis brassinosteroid signaling by atypical basic helix-loop-helix proteins. Plant Cell 2009, 21, 3781–3791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Zhang, L.Y.; Bai, M.Y.; Wu, J.; Zhu, J.Y.; Wang, H.; Zhang, Z.; Wang, W.; Sun, Y.; Zhao, J.; Sun, X.; et al. Antagonistic HLH/bHLH transcription factors mediate brassinosteroid regulation of cell elongation and plant development in rice and Arabidopsis. Plant Cell 2009, 21, 3767–3780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Hao, Y.; Oh, E.; Choi, G.; Liang, Z.; Wang, Z.Y. Interactions between HLH and bHLH factors modulate light-regulated plant development. Mol. Plant 2012, 5, 688–697. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Oh, E.; Zhu, J.Y.; Wang, Z.Y. Interaction between BZR1 and PIF4 integrates brassinosteroid and environmental responses. Nat. Cell Biol. 2012, 14, 802–809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Zheng, K.; Wang, Y.; Wang, S. The non-DNA binding bHLH transcription factor Paclobutrazol Resistances are involved in the regulation of ABA and salt responses in Arabidopsis. Plant Physiol. Biochem. 2019, 139, 239–245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Fan, Y.; Lai, D.; Yang, H.; Xue, G.; He, A.; Chen, L.; Feng, L.; Ruan, J.; Xiang, D.; Yan, J.; et al. Genome-wide identification and expression analysis of the bHLH transcription factor family and its response to abiotic stress in foxtail millet (Setaria italica L.). BMC Genom. 2021, 22, 778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Li, T.; Shi, Y.; Zhu, B.; Zhang, T.; Feng, Z.; Wang, X.; Li, X.; You, C. Genome-Wide Identification of Apple Atypical bHLH Subfamily PRE Members and Functional Characterization of MdPRE4.3 in Response to Abiotic Stress. Front. Genet. 2022, 13, 846559. [Google Scholar] [CrossRef] [Scilit]
  20. Wang, B.; Regulski, M.; Tseng, E.; Olson, A.; Goodwin, S.; McCombie, W.R.; Ware, D. A comparative transcriptional landscape of maize and sorghum obtained by single-molecule sequencing. Genome. Res. 2018, 28, 921–932. [Google Scholar] [CrossRef] [Scilit]
  21. Lescot, M.; Dehais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouze, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Chakrabarti, M.; de Lorenzo, L.; Abdel-Ghany, S.E.; Reddy, A.S.N.; Hunt, A.G. Wide-ranging transcriptome remodelling mediated by alternative polyadenylation in response to abiotic stresses in Sorghum. Plant J. 2020, 102, 916–930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Tetreault, H.M.; Grover, S.; Scully, E.D.; Gries, T.; Palmer, N.A.; Sarath, G.; Louis, J.; Sattler, S.E. Global Responses of Resistant and Susceptible Sorghum (Sorghum bicolor) to Sugarcane Aphid (Melanaphis sacchari). Front. Plant Sci. 2019, 10, 145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Chapman, K.M.; Marchi-Werle, L.; Hunt, T.E.; Heng-Moss, T.M.; Louis, J. Abscisic and Jasmonic Acids Contribute to Soybean Tolerance to the Soybean Aphid (Aphis glycines Matsumura). Sci. Rep. 2018, 8, 15148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Zhao, B.; Cao, J.F.; Hu, G.J.; Chen, Z.W.; Wang, L.Y.; Shangguan, X.X.; Wang, L.J.; Mao, Y.B.; Zhang, T.Z.; Wendel, J.F.; et al. Core cis-element variation confers subgenome-biased expression of a transcription factor that functions in cotton fiber elongation. New Phytol. 2018, 218, 1061–1075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Lee, S.; Lee, S.; Yang, K.Y.; Kim, Y.M.; Park, S.Y.; Kim, S.Y.; Soh, M.S. Overexpression of PRE1 and its homologous genes activates Gibberellin-dependent responses in Arabidopsis thaliana. Plant Cell Physiol. 2006, 47, 591–600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Heang, D.; Sassa, H. An atypical bHLH protein encoded by positive regulator of grain length 2 is involved in controlling grain length and weight of rice through interaction with a typical bHLH protein APG. Breed Sci. 2012, 62, 133–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Medina-Puche, L.; Martinez-Rivas, F.J.; Molina-Hidalgo, F.J.; Mercado, J.A.; Moyano, E.; Rodriguez-Franco, A.; Caballero, J.L.; Munoz-Blanco, J.; Blanco-Portales, R. An atypical HLH transcriptional regulator plays a novel and important role in strawberry ripened receptacle. BMC Plant Biol. 2019, 19, 586. [Google Scholar] [CrossRef] [Scilit]
  29. Zhu, Z.; Chen, G.; Guo, X.; Yin, W.; Yu, X.; Hu, J.; Hu, Z. Overexpression of SlPRE2, an atypical bHLH transcription factor, affects plant morphology and fruit pigment accumulation in tomato. Sci. Rep. 2017, 7, 5786. [Google Scholar] [CrossRef] [Scilit]
  30. Zheng, K.; Wang, Y.; Zhang, N.; Jia, Q.; Wang, X.; Hou, C.; Chen, J.G.; Wang, S. Involvement of paclobutrazol resistance6/kidari, an Atypical bHLH Transcription Factor, in Auxin Responses in Arabidopsis. Front. Plant Sci. 2017, 8, 1813. [Google Scholar] [CrossRef] [Scilit]
  31. McCormick, R.F.; Truong, S.K.; Sreedasyam, A.; Jenkins, J.; Shu, S.; Sims, D.; Kennedy, M.; Amirebrahimi, M.; Weers, B.D.; McKinley, B.; et al. The Sorghum bicolor reference genome: Improved assembly, gene annotations, a transcriptome atlas, and signatures of genome organization. Plant J. 2018, 93, 338–354. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Siefers, N.; Dang, K.K.; Kumimoto, R.W.; Bynum, W.E.t.; Tayrose, G.; Holt, B.F., 3rd. Tissue-specific expression patterns of Arabidopsis NF-Y transcription factors suggest potential for extensive combinatorial complexity. Plant Physiol. 2009, 149, 625–641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Letunic, I.; Bork, P. 20 years of the SMART protein domain annotation resource. Nucleic Acids Res. 2018, 46, D493–D496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Petroni, K.; Kumimoto, R.W.; Gnesutta, N.; Calvenzani, V.; Fornari, M.; Tonelli, C.; Holt, B.F., 3rd; Mantovani, R. The promiscuous life of plant NUCLEAR FACTOR Y transcription factors. Plant Cell 2012, 24, 4777–4792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Subramanian, B.; Gao, S.; Lercher, M.J.; Hu, S.; Chen, W.H. Evolview v3: A webserver for visualization, annotation, and management of phylogenetic trees. Nucleic Acids Res. 2019, 47, W270–W275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Cao, J.F.; Zhao, B.; Huang, C.C.; Chen, Z.W.; Zhao, T.; Liu, H.R.; Hu, G.J.; Shangguan, X.X.; Shan, C.M.; Wang, L.J.; et al. The miR319-Targeted GhTCP4 Promotes the Transition from Cell Elongation to Wall Thickening in Cotton Fiber. Mol. Plant 2020, 13, 1063–1077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Huang, Y.; Wang, S.; Wang, C.; Ding, G.; Cai, H.; Shi, L.; Xu, F. Induction of jasmonic acid biosynthetic genes inhibits Arabidopsis growth in response to low boron. J. Integr. Plant Biol. 2021, 63, 937–948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Moran, P.J.; Thompson, G.A. Molecular responses to aphid feeding in Arabidopsis in relation to plant defense pathways. Plant Physiol. 2001, 125, 1074–1085. [Google Scholar] [CrossRef] [Scilit]
  40. Pant, S.; Huang, Y. Genome-wide studies of PAL genes in sorghum and their responses to aphid infestation. Sci. Rep. 2022, 12, 22537. [Google Scholar] [CrossRef] [Scilit]
  41. Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Shen, D.D.; Hua, Y.P.; Huang, J.Y.; Yu, S.T.; Wu, T.B.; Zhang, Y.; Chen, H.L.; Yue, C.P. Multiomic Analysis Reveals Core Regulatory Mechanisms underlying Steroidal Glycoalkaloid Metabolism in Potato Tubers. J. Agric. Food Chem. 2022, 70, 415–426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. The amino acid sequence alignment of the SbPRE and AtPRE proteins. The helix–loop–helix conserved motif is indicated. The colors background indicated identical amino acids.
Figure 1. The amino acid sequence alignment of the SbPRE and AtPRE proteins. The helix–loop–helix conserved motif is indicated. The colors background indicated identical amino acids.
Ijms 25 07257 g001
Figure 2. The location of SbPRE genes on chromosomes and gene structures (introns/exons). (A) Chromosomal location of seven SbPREs on chromosomes. Colors represent gene density, with blue indicating low density and yellow indicating high density. (B) Gene structures (introns/exons) of the SbPRE genes.
Figure 2. The location of SbPRE genes on chromosomes and gene structures (introns/exons). (A) Chromosomal location of seven SbPREs on chromosomes. Colors represent gene density, with blue indicating low density and yellow indicating high density. (B) Gene structures (introns/exons) of the SbPRE genes.
Ijms 25 07257 g002
Figure 3. Phylogenetic analysis of PRE proteins in sorghum, Arabidopsis, rice, and cotton. Triangle represents SbPRE protein, star represents OsPRE protein, rect represents AtPRE protein, and circle represents GhPRE protein.
Figure 3. Phylogenetic analysis of PRE proteins in sorghum, Arabidopsis, rice, and cotton. Triangle represents SbPRE protein, star represents OsPRE protein, rect represents AtPRE protein, and circle represents GhPRE protein.
Ijms 25 07257 g003
Figure 4. The relative expression analysis of PRE genes in sorghum tissues. The RNA-seq data of different sorghum tissues were obtained from Wang et al. [20]; the study accession in EBI database (https://www.ebi.ac.uk/ena/browser/view/ (accessed on 21 May 2024)) is ERP024458. Relative expression of the SbPREs was measured in sorghum root, shoot, leaf, seedling, 1–2 cm inflorescence, pollen, embryo, endosperm, and pericarp. Different lowercase letters indicate a significant difference at p < 0.05 based on one-way analysis of variance (ANOVA).
Figure 4. The relative expression analysis of PRE genes in sorghum tissues. The RNA-seq data of different sorghum tissues were obtained from Wang et al. [20]; the study accession in EBI database (https://www.ebi.ac.uk/ena/browser/view/ (accessed on 21 May 2024)) is ERP024458. Relative expression of the SbPREs was measured in sorghum root, shoot, leaf, seedling, 1–2 cm inflorescence, pollen, embryo, endosperm, and pericarp. Different lowercase letters indicate a significant difference at p < 0.05 based on one-way analysis of variance (ANOVA).
Ijms 25 07257 g004
Figure 5. The cis-elements analysis of SbPRE promoters. 2 kb sequences upstream of the start codon were used for analysis.
Figure 5. The cis-elements analysis of SbPRE promoters. 2 kb sequences upstream of the start codon were used for analysis.
Ijms 25 07257 g005
Figure 6. SbPRE genes expression analysis under different stresses by public RNA-seq data [22,23]. (A) The relative expression levels under heat, salt, and drought stress. (B) Expression levels (TPM) of SbPRE genes responsive to aphid stress. Data are mean ± SD (n = 3). Different lowercase letters indicate a significant difference at p < 0.05 based on one-way analysis of variance (ANOVA).
Figure 6. SbPRE genes expression analysis under different stresses by public RNA-seq data [22,23]. (A) The relative expression levels under heat, salt, and drought stress. (B) Expression levels (TPM) of SbPRE genes responsive to aphid stress. Data are mean ± SD (n = 3). Different lowercase letters indicate a significant difference at p < 0.05 based on one-way analysis of variance (ANOVA).
Ijms 25 07257 g006
Figure 7. SbPRE4 improves aphid resistance of Arabidopsis by JAs. (A) Phenotypic comparison of 28-day-old Col-0 and OE SbPRE4 transgenic Arabidopsis after 7-day aphid infestation. (B) Expression analysis of SbPRE4 in Col-0 and OE SbPRE4 transgenic Arabidopsis. (C) Number of aphids on Col-0 and OE SbPRE4 transgenic Arabidopsis after 7-day infestation. (D) JA, OPDA, JA-Ile, and H2JA content in 28-day-old Col-0 and OE SbPRE4 transgenic Arabidopsis. (E) Expression analysis of JA biosynthesis-related genes in Col-0 and OE SbPRE4 transgenic Arabidopsis. (B,C) values represent means ± SD, n = 3 plants. Different lowercase letters indicate a significant difference at p < 0.05 based on one-way analysis of variance (ANOVA). Student’s t-test (* p < 0.05 and ** p < 0.01) was used to analyze statistical significance of (D,E).
Figure 7. SbPRE4 improves aphid resistance of Arabidopsis by JAs. (A) Phenotypic comparison of 28-day-old Col-0 and OE SbPRE4 transgenic Arabidopsis after 7-day aphid infestation. (B) Expression analysis of SbPRE4 in Col-0 and OE SbPRE4 transgenic Arabidopsis. (C) Number of aphids on Col-0 and OE SbPRE4 transgenic Arabidopsis after 7-day infestation. (D) JA, OPDA, JA-Ile, and H2JA content in 28-day-old Col-0 and OE SbPRE4 transgenic Arabidopsis. (E) Expression analysis of JA biosynthesis-related genes in Col-0 and OE SbPRE4 transgenic Arabidopsis. (B,C) values represent means ± SD, n = 3 plants. Different lowercase letters indicate a significant difference at p < 0.05 based on one-way analysis of variance (ANOVA). Student’s t-test (* p < 0.05 and ** p < 0.01) was used to analyze statistical significance of (D,E).
Ijms 25 07257 g007
Figure 8. Number of aphids on JA-treated Col-0 (A) and 7B (B) after aphid infestation. Values represent means ± SD, n = 21 (Arabidopsis) and 6 (sorghum) plants. Student’s t-test: ** p < 0.01.
Figure 8. Number of aphids on JA-treated Col-0 (A) and 7B (B) after aphid infestation. Values represent means ± SD, n = 21 (Arabidopsis) and 6 (sorghum) plants. Student’s t-test: ** p < 0.01.
Ijms 25 07257 g008
Table 1. The information on PREs in sorghum.
Table 1. The information on PREs in sorghum.
GeneGene IDChromosome LocationCDS Length (bp)Protein Length (aa)bHLH DomainMolecular Weight (Da)pI
SbPRE1Sobic.006G236600Chr06:57805968–578074173151052–10411,180.388
SbPRE2Sobic.006G131900Chr06:49616617–4962180348316139–10917,385.789.48
SbPRE3Sobic.004G267400Chr04:61174563–611774051080360153–23737,275.276.35
SbPRE4Sobic.001G488600Chr01:75864770–75871892279931–9210,304.596.57
SbPRE5Sobic.001G488400Chr01:75826747–75828379261871–869690.979.03
SbPRE6Sobic.001G254100Chr01:28215024–28215913288961–9510,442.797.98
SbPRE7Sobic.005G178400Chr05:66069136–660700564051354–11413,862.516.73
CDS: coding sequence; bHLH: basic helix–loop–helix; pI: isoelectric point; aa: amino acid; Da: dalton.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guo, Y.; Wang, Z.; Jiao, Z.; Yuan, G.; Cui, L.; Duan, P.; Niu, J.; Lv, P.; Wang, J.; Shi, Y. Genome-Wide Identification of Sorghum Paclobutrazol-Resistance Gene Family and Functional Characterization of SbPRE4 in Response to Aphid Stress. Int. J. Mol. Sci. 2024, 25, 7257. https://doi.org/10.3390/ijms25137257

AMA Style

Guo Y, Wang Z, Jiao Z, Yuan G, Cui L, Duan P, Niu J, Lv P, Wang J, Shi Y. Genome-Wide Identification of Sorghum Paclobutrazol-Resistance Gene Family and Functional Characterization of SbPRE4 in Response to Aphid Stress. International Journal of Molecular Sciences. 2024; 25(13):7257. https://doi.org/10.3390/ijms25137257

Chicago/Turabian Style

Guo, Yongchao, Zhifang Wang, Zhiyin Jiao, Guang Yuan, Li Cui, Pengwei Duan, Jingtian Niu, Peng Lv, Jinping Wang, and Yannan Shi. 2024. "Genome-Wide Identification of Sorghum Paclobutrazol-Resistance Gene Family and Functional Characterization of SbPRE4 in Response to Aphid Stress" International Journal of Molecular Sciences 25, no. 13: 7257. https://doi.org/10.3390/ijms25137257

APA Style

Guo, Y., Wang, Z., Jiao, Z., Yuan, G., Cui, L., Duan, P., Niu, J., Lv, P., Wang, J., & Shi, Y. (2024). Genome-Wide Identification of Sorghum Paclobutrazol-Resistance Gene Family and Functional Characterization of SbPRE4 in Response to Aphid Stress. International Journal of Molecular Sciences, 25(13), 7257. https://doi.org/10.3390/ijms25137257

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop