1. Introduction
The hallmark feature of cancer is the increased energy demand, which plays a pivotal role in tumor growth and metastasis [
1]. Tumor cells undergo metabolic reprogramming, utilizing both oxidative phosphorylation (OXPHOS) and aerobic glycolysis to generate high levels of energy [
2]. Targeting abnormal metabolism has been considered an attractive therapeutic strategy for HCC.
Krüppel-like Factor 4 (KLF4) is a member of the evolutionarily conserved family of zinc finger transcription factors [
3]. It was first discovered by Garrett-Sinha and Shields in 1996 in the differentiated epithelium, colon, and small intestine of newborn mice [
4]. KLF4 has been extensively studied for its diverse roles in cellular physiology and pathology, including proliferation, differentiation, apoptosis [
5], inflammation, and tumorigenesis [
6,
7]. In the context of HCC, KLF4 has been identified as a tumor suppressor [
8]. It regulates multiple signaling pathways, such as the KLF4-pcadherin-GSK-β and KLF4-CD9/CD81-JNK axis [
9,
10], and suppresses migration and invasion through the KLF4-VDR pathway [
11].
Despite extensive research on KLF4’s functions in various cellular processes and its role in HCC, our understanding of its role in metabolism remains limited. The underlying molecular mechanisms by which KLF4 affects metabolism require further investigation to comprehensively understand its functions in this context.
The mammalian target of rapamycin (mTOR) is the catalytic subunit of two protein complexes, mTOR complex 1 (mTORC1) and mTOR complex 2 (mTORC2) [
12,
13]. These complexes play crucial roles in regulating cell growth, proliferation, and metabolism [
14]. RICTOR, a core component of mTORC2, functions as a hub at the mitochondria-associated endoplasmic reticulum (ER) membranes (MAM), regulating mitochondrial function and metabolism [
15,
16]. Deficiency of mTORC2 disrupts MAM, leading to mitochondrial defects such as increased mitochondrial membrane potential, ATP production, and calcium uptake [
17]. In a study by Moloughney et al. (2016), it was revealed that mTORC2 responds to decreasing levels of glucose and glutamine catabolites by promoting glutaminolysis and preserving the tricarboxylic acid (TCA) cycle and hexosamine biosynthesis [
18]. However, it remains unclear whether RICTOR is involved in the KLF4-mediated metabolic reprogramming in HCC.
MicroRNAs (miRNAs), small non-coding RNAs approximately 20–25 nucleotides in length, play crucial roles by directly binding to the 3′ untranslated regions (UTRs) of target mRNAs [
19]. These molecules have gained significant attention due to their involvement in various biological processes and diseases, including cancer [
20]. One specific miRNA, miR-206, has been studied for its dual roles as an oncogene or a tumor suppressor in different conditions [
21]. Previous studies have shown that miR-206 exhibits anti-HCC effects by inhibiting the Cyclin-Dependent Kinase 9 (CDK9) signaling pathway [
22]. Additionally, miR-206 acts as a sponge for Linc1749808, impacting Yes-associated protein 1 (YAP1) and epithelial-mesenchymal transition (EMT) in HCC cells [
23]. The precise mechanism by which miR-206 regulates tumor energy metabolism in HCC remains unknown.
In this study, we demonstrate that KLF4 functions as a tumor suppressor in HCC. It is downregulated in tumor tissues, and low expression correlates with poor overall survival (OS) and recurrence-free survival (RFS) in HCC patients. Overexpression of KLF4 suppresses HCC cell proliferation both in vitro and in vivo. Interestingly, we find that KLF4 inhibits ATP synthesis. Specifically, KLF4 promotes the transcription of miR-206, which subsequently suppresses the expression of RICTOR. This suppression leads to a decrease in ATP synthesis, highlighting the novel role of KLF4 in regulating energy metabolism. Our results provide valuable insights into the molecular mechanisms of the KLF4/miR-206/RICTOR axis in cellular energetics. Furthermore, our findings suggest that. KLF4 may serve as a potential biomarker and therapeutic target for HCC.
3. Materials and Methods
3.1. Human Tissue Specimens
A total of 130 patients with HCC who underwent curative surgery at the Sun Yat-sen Cancer Center (SYSUCC; Guangzhou, China) between January 2010 and June 2012 were enrolled in the study. None of the patients received any local or systemic anticancer therapies before surgical resection, and no postoperative anticancer treatments were administered before any identified relapse. The diagnosis of all cases was confirmed pathologically based on the terminology criteria established by the International Working Party. Matched tumor and adjacent normal tissue samples were collected from these 130 enrolled patients for the construction of the tissue microarray. Overall survival (OS) was defined as the time interval between the last followup or death and surgery, while disease-free survival (DFS) was defined as the time interval between surgery and tumor recurrence or last follow-up. All samples were obtained with the informed consent of the patients.
3.2. Immunohistochemistry (IHC)
HCC specimens were selected and re-embedded into new paraffin blocks for tissue microarray (TMA) construction. The TMA blocks were cut into 4 μm sections and underwent IHC staining. The rabbit polyclonal antibody used was anti-KLF4 (1:100; Hpa002926, MERCK, St. Louis, MO, USA). Based on IHC, positive staining was quantified and classified into four categories: ≤25% for 1; 26 to 50% for 2; 51 to 75% for 3; and ≥76% for 4. Staining intensity was graded as negative (scored as 0), weak (1), moderate (2), or strong (3). Two pathologists independently reviewed all scores, and expression levels were defined by the sum of the grades for the percentage of positive staining and intensity. The median of the IHC score was chosen as the cut-off value for the high (>6) and low (≤6) KLF4 groups.
3.3. Cell Culture and Treatments
HCC cell lines (Huh7, Hep3B, MHCC-97H, and MHCC-97L) and human embryonic kidney cells (HEK293T) were purchased from Guangzhou Jenniobio Biotechnology (Guangzhou, China) with STR (short tandem repeat) appraisal certificates. Cells were maintained in Dulbecco’s Modified Eagle medium (DMEM; Thermo Fisher, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Auckland, New Zealand) at 37 °C in 5% CO2.
3.4. Cell Proliferation Assays
Three experiments were performed to analyze cell proliferation ability. In the Cell Counting Kit-8 (CCK-8; DojinDo, Kumamoto, Japan) assay, 1000 cells were seeded in 96-well plates with six repeated wells for each experimental condition. Two hours after replacing the supernatant with fresh medium containing CCK-8 reagent in a 10:1 ratio, the absorbance was measured by the Biotek Epoch 2 machine (BioTek, Winooski, VT, USA) at 450 nm.
EdU cell proliferation staining was performed using an EdU kit (C0071S; Beyotime Biotechnology, China). Briefly, indicated cells were incubated with the EdU buffer for 3 h, fixed by 4% polyformaldehyde, and stained the nucleus with Hoechst. The results were observed and captured using a fluorescence microscope (Olympus Corporation, Tokyo, Japan). Cell proliferation staining was performed using an EdU kit (C0071S; Beyotime Biotechnology, Shanghai, China). Briefly, the indicated cells were incubated with the EdU buffer for 3 h, fixed with 4% paraformaldehyde, and then the nuclei were stained with Hoechst. The results were observed and captured using a fluorescence microscope (Olympus Corporation, Tokyo, Japan).
For the colony formation assay, 500–800 indicated stable cells were plated per well in 6-well plates. Fourteen days later, the cells were fixed in methanol and stained with 0.1% crystal violet. Colony images were photographed and counted for contrast.
3.5. Animal Experiments
All animal research procedures were performed in accordance with the detailed rules of the Animal Care and Use Ethics Committee of SYSUCC, with efforts made to minimize animal suffering. Male nude mice (Guangdong Medical Lab Animal Center) were purchased at 3–4 weeks of age and kept under specific pathogen-free (SPF) conditions.
To evaluate the inhibitory effect of KLF4 on tumor growth in vivo, mice were randomly divided into designated groups (n = 5 per group) before injection without the use of a blinding method. Hep3B and MHCC-97H stable cells were then subcutaneously injected into the right side of the posterior flank of the same male BALB/c athymic nude mice (1.0 × 107 cells/mouse) to establish the subcutaneous model. Body weight and tumor size were monitored every three days. Eleven or thirteen days after inoculation, all mice (n = 5 per group) were euthanized for further analysis. Tumor volume (V) was measured using the formula: V = (L × W2)/2 (where L = length; W = width).
For the liver orthotopic xenograft mouse model, 1 × 106 shCtrl, shKLF4#1, or shKLF4#2 MHCC-97H cells, and control or KLF4-OE stable Hep3B cells were resuspended in 100% Matrigel (BD Biocoat, Corning, NY, USA) and injected into the left lobes of the livers in 5- to 6-week-old male NOD/SCID mice. The incision was then closed using surgical suture threads with a needle and medical adhesive bandage. At six weeks post-inoculation, tumor-bearing mice were sacrificed, and livers were harvested for histological analysis.
3.6. Seahorse
The mitochondrial oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were determined using an XF-24 Extracellular Flux Analyzer (Seahorse Bioscience, Agilent Technologies, Santa Clara, CA, USA). Cells were seeded in a 24-well Seahorse XF Cell Culture Microplate (200,000 cells per well). After 24 h, the DMEM was changed to a pre-warmed assay medium, and the cell culture microplate was placed in a 37 °C non-CO2 incubator for 45 min. The OCR was measured in the XF Analyzer according to the manual of the Seahorse XF Cell Mito Stress Test Assay (Seahorse Bioscience, Agilent Technologies, Santa Clara, CA, USA). The ECAR was measured in the XF Analyzer according to the manual of the Seahorse XF Cell Glycolysis Stress Test Assay (Seahorse Bioscience, Agilent Technologies, Santa Clara, CA, USA).
3.7. Chromatin Immunoprecipitation (ChIP) Assay
ChIP assay was performed using the Simple ChIP Enzymatic Chromatin IP kit (Cell Signaling Technology, Boston, MA, USA). HCC cells were crosslinked with formaldehyde, lysed with SDS buffer, and then subjected to ultrasonication. Subsequently, the cells were incubated with specific antibodies (1:100; #12173, Cell Signaling Technology, Boston, MA, USA) or normal rabbit IgG. After washing with high salt and low salt, the DNA was eluted and de-crosslinked, and enrichment was examined using qRTPCR.
For the ChIP assay, a ChIP kit (Cell Signaling Technology, Boston, MA, USA) was used according to the manufacturer’s instructions. Samples were crosslinked with 1% formaldehyde (Sigma-Aldrich, St. Louis, MO, USA) solution, followed by quenching the reaction with glycine solution. The cells were then lysed, and the nucleoprotein complexes were sonicated for 10 cycles of 10 s power-on and 20 s intervals with an intensity of 200 W using the sonicate conductor (Qsonica, Newtown, CT, USA). Subsequently, an anti-KLF4 antibody or IgG was added and incubated with the complexes overnight at 4 °C. The next day, Protein A/G magnetic beads were added to precipitate the indicated fragments for 4 h at 4 °C. After extraction and purification of the DNA, qRT-PCR was performed to identify the region interacting with the miR-206-specific primers. The primers used are listed in
Supplementary Table S3. The experiments were performed in triplicate, and the amount of immunoprecipitated DNA was normalized to the input.
3.8. Luciferase Reporter Assay
To investigate the effect of miR-206 on the Rictor 3′-UTR, HEK293T cells in a 6-well plate were co-transfected with 10 nM of miR-206 or NC duplex, 1 µg pEZX-RICTOR-3′-UTR-WT or pEZX-RICTOR-3′-UTR-MUT and cultured for 24 h. The cells were then trypsinized and transferred to a 96-well plate. After 24 h, a luciferase reporter assay was performed following the manufacturer’s instructions. Renilla luciferase activity was normalized to firefly luciferase activity. Cell lysates were collected 48 h after transfection and subjected to luciferase activity assays using the luciferase reporter system (Genecopoeia, Guangzhou, China). The data are presented as the mean ± standard error of the mean (SEM) from at least three independent experiments.
3.9. Quantitative RT Real-Time PCR (qRT-PCR)
Total RNA was extracted from the HCC tissues and cell lines using the Trizol reagent kit (Life Technologies, Carlsbad, CA, USA). After treatment with DNase I (TaKaRa, Dalian, China), 2 µg of total RNA was used for cDNA synthesis with random hexamers and Superscript III (Invitrogen, Grand Island, NY, USA). The cDNA templates were then subjected to qRT-PCR amplification using the SYBR Green qRT-PCR kit (Invitrogen, Carlsbad, CA, USA). The sequence of the primers used can be found in
Supplementary Table S3.
The qRT-PCR analysis of miR-206 was performed on an ABI PRISM 7900 Sequence Detector using the SYBR Green qRT-PCR Kit (Applied Biosystems, Carlsbad, CA, USA). The following primers were used for detection: HmiRQP0159 for miR-130b-3p and HmiRQP9001 for U6 (Genecopoeia, Guangzhou, China). All reactions were run in triplicate, and the cycle threshold (Ct) values should not differ by more than 0.5 among triplicates. The miR-206 level was normalized to RNU6B, which yielded a 2-ΔΔCt value.
3.10. Immunoblotting (IB)
Cells and tissues were lysed with RIPA lysis buffer. Proteins were extracted, loaded onto SDS-PAGE, and transferred onto the PVDF membrane (Millipore, Billerica, MA, USA). After blocking with 5% skimmed milk (Beyotime, Shanghai, China) and sequential incubation with primary and secondary antibodies (anti-RICTOR, 6867-2-IG, 1:1000; anti-GAPDH, 60004-1-Ig, 1:2000; Proteintech, Wuhan, China); (anti-KLF4, 12173S, 1:1000; anti-rabbit IgG, 7074S, 1:3000; anti-mouse IgG, 7076S, 1:3000. Cell Signaling Technology, Boston, MA, USA) the blots were detected using the ECL detection kit (Millipore; Boston, MA, USA).
3.11. Plasmids for Overexpression and Knockdown
Plasmids for expressing or knocking down human KLF4 were purchased from Kidan Biosciences Co., Ltd. (Guangzhou, China). Transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Briefly, cells were seeded at 1.0 × 106 cells per well in a 6-well tissue culture dish or at 3 × 106 cells per 10 cm tissue culture dish and transfected with 2 μg or 12 μg plasmid DNA for 24 h, respectively. The sequence of shKLF4-1#: CCGGCTGACCAGGCACTACCGTAAACTCGAGTTTACGGTAGTGCCTGGTCAGTTTTTG. The sequence of shKLF4-2#: CCGGCGCCACCCACACTTGTGATTACTCGAGTAATCACAAGTGTGGGTGGCGTTTTTG.
3.12. Small Interfering RNA
Small interfering RNA for RICTOR was purchased from Genepharma (Shanghai, China). Transfection of small interfering RNA was performed with Lipofectamine-RNAiMAX (Invitrogen, Carlsbad, CA, USA). After 6-8 h, the supernatant was replaced with fresh medium, and the efficiency was identified by qRT-PCR and western blotting 72 h after transfection. The sequence of siRICTOR is CGAGGACCUAAGCCUUAUATT, with its anti-sense sequence being UAUAAGGCUUAGGUCCUCGTT.
3.13. Data Availability
The human cancer KLF4 and RICTOR expression data were derived from the TCGA Research Network (
http://cancergenome.nih.gov/ (accessed on 21 October 2023)). The bulk RNA-seq data supporting the findings of this study have been deposited in the Gene Expression Omnibus under accession numbers GSE14520.
3.14. Statistical Analysis
The experiments were repeated at least three times independently, and the measured data were represented as the mean ± SD. Binary variables were compared using the Chi-squared test. The Student’s t-test or the Mann-Whitney U test was used to compare values between subgroups. Survival curves were constructed using the Kaplan-Meier method and analyzed by the log-rank test. Significant prognostic factors identified by univariate analysis were entered into a multivariate analysis using the Cox proportional hazards model. All analyses were two-sided, and p-values of less than 0.05 were considered significant. Statistical analyses were performed using the Statistical Package for Social Sciences version 25 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism 7.0 software (GraphPad, Inc., La Jolla, CA, USA).
4. Discussion
As tumor cells continuously proliferate, they face the challenge of meeting their increasing energy demands [
1]. Understanding the fundamental mechanism of energy metabolism in HCC is crucial for developing new therapeutic strategies. In our study, we discovered that KLF4 functions as a novel metabolic regulator that is commonly downregulated in HCC tissues. The reduced expression of KLF4 is associated with overall survival (OS) and recurrence-free survival (RFS) in HCC patients. Moreover, the downregulation of KLF4 expression promotes ATP synthesis and enhances the growth of HCC cells both in vitro and in vivo. Mechanistically, KLF4 suppresses HCC growth by regulating RICTOR, which is modulated by the KLF4/miR-206/mTOR axis, thereby inhibiting ATP synthesis in HCC.
KLF4, a member of the evolutionarily conserved family of zinc finger transcription factors, has been extensively studied for its regulatory roles in various cellular physiological processes, including proliferation, differentiation, and apoptosis [
5,
26]. Furthermore, KLF4 has been implicated in inflammation and tumorigenesis [
6,
7] and has been identified as a tumor suppressor in HCC [
8]. Mechanistically, KLF4 has been shown to inhibit HCC progression through the regulation of signaling pathways such as KLF4-pcadherin-GSK-3β and KLF4-CD9/CD81-JNK [
9,
10]. Additionally, KLF4 inhibits the migration and invasion of tumor cells by suppressing biological enzymes like TIMP-1 and TIMP-2 [
27]. Despite being characterized as a tumor suppressor gene in HCC, the biological function of KLF4 in metabolism remains poorly understood. Moreover, the underlying molecular mechanism remains largely unknown. In this study, we aimed to investigate the biological function and molecular mechanism of KLF4 in HCC metabolism. We demonstrated a significant inhibitory effect of KLF4 on HCC proliferation both in vitro and in vivo, highlighting its potential tumor-suppressive role in HCC development. Abnormal energy metabolism is a critical aspect of HCC tumorigenesis. Based on our research, we discovered that the downregulation of KLF4 promotes ATP synthesis. However, the signaling pathways and target genes involved in the inhibition of ATP synthesis by KLF4 are still unclear. To explore the potential molecular mechanism, we conducted untargeted metabolome profiling, which revealed the involvement of KLF4 in the mTOR signaling pathway. We confirmed RICTOR as a target gene of KLF4. RICTOR, a component of mTORC2, plays a crucial role in cell proliferation and metabolism [
15,
16], particularly in the tricarboxylic acid (TCA) cycle and hexosamine biosynthesis [
24]. In this study, we demonstrated that KLF4-mediated downregulation of RICTOR suppresses cell proliferation in HCC cells, involving the regulation of the mTORC2 signaling pathway.
Transcription factors typically promote gene/miRNA transcription, and it has been reported that RICTOR is regulated at the transcriptional level by miRNA in various tumors. Through in silico target prediction algorithms, a complementary binding sequence for miR-206 was identified in the 3′-UTR of RICTOR mRNA. Previous studies have demonstrated that miR-206 is downregulated in liver CSCs and exerts its inhibitory effect on CSC growth by directly targeting the Epidermal Growth Factor Receptor (EGFR) [
28]. MiR-206 also exerts an anti-HCC effect by inhibiting the CDK9 signaling pathway, suggesting that the miR206-CDK9 pathway could be a potential therapeutic target for HCC [
22]. In this study, we provide evidence that KLF4 regulates HCC progression through the transcriptional activation of miR-206. Knockdown of KLF4 resulted in a significant decrease in cellular miR-206 expression. Additionally, ChIP assays demonstrated the interaction between KLF4 and the miR-206 promoter sequence. Our study revealed that miR-206 directly targets RICTOR and inhibits ATP synthesis in HCC. Taking into account previous findings from other research groups and the results of our study, it can be concluded that KLF4 is regulated by the miR206/RICTOR axis, leading to the inhibition of ATP synthesis in HCC through the mTOR signaling pathway.
The mTOR pathway is commonly activated in human cancers and plays a crucial role in tumor progression, emphasizing the need for further investigation into the molecular mechanism of abnormal metabolism in HCC. While our study has revealed that down-regulation of KLF4 activates the mTOR pathway, the specific mechanism by which KLF4 regulates this pathway requires further elucidation.
In summary, this study provides mechanistic evidence supporting the role of KLF4 in regulating RICTOR expression through miR-206. Moreover, the KLF4/miR-206/RICTOR axis is shown to have a critical function in ATP synthesis in HCC cells. Our study not only identifies a novel molecular mechanism underlying ATP synthesis but also highlights the aberrant KLF4/miR-206/RICTOR signaling pathway as a promising molecular target for the development of novel therapeutic strategies to control the development and progression of HCC.