Canagliflozin Mitigates Diabetic Cardiomyopathy through Enhanced PINK1-Parkin Mitophagy
Abstract
1. Introduction
2. Results
2.1. Canagliflozin Improved Mitochondrial Quality in High-Glucose-Treated H9C2 Cells
2.2. Canagliflozin Effectively Restored Impaired PINK1-Parkin-Dependent Mitophagy in High-Glucose-Treated H9C2 Cells
2.3. Canagliflozin Improved Cardiac Dysfunction and Metabolic Abnormalities in Diabetic Mice
2.4. Cardiac Tissue Proteomics Analysis of Canagliflozin-Treated Mice
2.5. Canagliflozin Resulted in a Substantial Enhancement of Cardiac Mitochondrial Quality in Diabetic Mice
2.6. Canagliflozin Activated PINK1-Parkin-Dependent Mitophagy in Diabetic Mice
2.7. Canagliflozin Failed to Enhance Mitochondrial Function and Mitophagy in the Absence of PINK1 in High-Glucose-Treated Cells
3. Discussion
4. Materials and Methods
4.1. Animal Experimental Design and Treatment
4.2. Cell Culture and Treatment
4.3. Proteomics Analysis
4.4. Seahorse Experiments
4.5. Assessment of Cell Apoptosis
4.6. Assessment of Mitochondrial Membrane Potential (MMP)
4.7. Assessment of Autophagic Flux via mRFP-GFP-LC3
4.8. Mouse Heart Mitochondrial Respiration Measurements
4.9. Oral Glucose and Insulin Tolerance Tests
4.10. Echocardiography
4.11. Mitochondrial ROS Level
4.12. Quantitative Real-Time PCR
4.13. Western Blotting
4.14. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sun, H.; Saeedi, P.; Karuranga, S.; Pinkepank, M.; Ogurtsova, K.; Duncan, B.B.; Stein, C.; Basit, A.; Chan, J.C.N.; Mbanya, J.C.; et al. IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. Diabetes Res. Clin. Pract. 2022, 183, 109119. [Google Scholar] [CrossRef] [PubMed]
- Boudina, S.; Abel, E.D. Diabetic cardiomyopathy, causes and effects. Rev. Endocr. Metab. Disord. 2010, 11, 31–39. [Google Scholar] [CrossRef] [PubMed]
- Ni, R.; Zheng, D.; Xiong, S.; Hill, D.J.; Sun, T.; Gardiner, R.B.; Fan, G.C.; Lu, Y.; Abel, E.D.; Greer, P.A.; et al. Mitochondrial Calpain-1 Disrupts ATP Synthase and Induces Superoxide Generation in Type 1 Diabetic Hearts: A Novel Mechanism Contributing to Diabetic Cardiomyopathy. Diabetes 2016, 65, 255–268. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Alford, J.; Qiu, H. Structural and Functional Remodeling of Mitochondria in Cardiac Diseases. Int. J. Mol. Sci. 2021, 22, 4167. [Google Scholar] [CrossRef] [PubMed]
- Duncan, J.G. Mitochondrial dysfunction in diabetic cardiomyopathy. Biochim. Biophys. Acta 2011, 1813, 1351–1359. [Google Scholar] [CrossRef] [PubMed]
- Klionsky, D.J.; Emr, S.D. Autophagy as a regulated pathway of cellular degradation. Science 2000, 290, 1717–1721. [Google Scholar] [CrossRef] [PubMed]
- Pickles, S.; Vigié, P.; Youle, R.J. Mitophagy and Quality Control Mechanisms in Mitochondrial Maintenance. Curr. Biol. 2018, 28, R170–R185. [Google Scholar] [CrossRef] [PubMed]
- Ajoolabady, A.; Chiong, M.; Lavandero, S.; Klionsky, D.J.; Ren, J. Mitophagy in cardiovascular diseases: Molecular mechanisms, pathogenesis, and treatment. Trends Mol. Med. 2022, 28, 836–849. [Google Scholar] [CrossRef] [PubMed]
- Tang, C.; Cai, J.; Yin, X.M.; Weinberg, J.M.; Venkatachalam, M.A.; Dong, Z. Mitochondrial quality control in kidney injury and repair. Nat. Rev. Nephrol. 2021, 17, 299–318. [Google Scholar] [CrossRef]
- Lazarou, M.; Jin, S.M.; Kane, L.A.; Youle, R.J. Role of PINK1 binding to the TOM complex and alternate intracellular membranes in recruitment and activation of the E3 ligase Parkin. Dev. Cell 2012, 22, 320–333. [Google Scholar] [CrossRef]
- Okatsu, K.; Uno, M.; Koyano, F.; Go, E.; Kimura, M.; Oka, T.; Tanaka, K.; Matsuda, N. A dimeric PINK1-containing complex on depolarized mitochondria stimulates Parkin recruitment. J. Biol. Chem. 2013, 288, 36372–36384. [Google Scholar] [CrossRef] [PubMed]
- Okatsu, K.; Oka, T.; Iguchi, M.; Imamura, K.; Kosako, H.; Tani, N.; Kimura, M.; Go, E.; Koyano, F.; Funayama, M.; et al. PINK1 autophosphorylation upon membrane potential dissipation is essential for Parkin recruitment to damaged mitochondria. Nat. Commun. 2012, 3, 1016. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Zhao, Z.; Feng, X.; Cheng, Z.; Xiong, Z.; Wang, T.; Lin, J.; Zhang, M.; Hu, J.; Fan, Y.; et al. Melatonin activates Parkin translocation and rescues the impaired mitophagy activity of diabetic cardiomyopathy through Mst1 inhibition. J. Cell Mol. Med. 2018, 22, 5132–5144. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.M.; Dong, X.; Xue, X.D.; Xu, S.; Zhang, X.; Xu, Y.L.; Wang, Z.S.; Yang Wang, Y.; Gao, H.; Liang, Y.X.; et al. Melatonin attenuates diabetic cardiomyopathy and reduces myocardial vulnerability to ischemia-reperfusion injury by improving mitochondrial quality control: Role of SIRT6. J. Pineal Res. 2021, 70, e12698. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.P.; Lai, D.; Zhong, X.Y.; Shen, H.P.; Huang, Y.L. Efficacy and safety of canagliflozin in subjects with type 2 diabetes: Systematic review and meta-analysis. Eur. J. Clin. Pharmacol. 2014, 70, 1149–1158. [Google Scholar] [CrossRef]
- Neal, B.; Perkovic, V.; Mahaffey, K.W.; Zeeuw, D.D.; Fulcher, G.; Erondu, N.; Shaw, W.; Law, G.; Desai, M.; Matthews, D.R.; et al. Canagliflozin and Cardiovascular and Renal Events in Type 2 Diabetes. N. Engl. J. Med. 2017, 377, 644–657. [Google Scholar] [CrossRef] [PubMed]
- Rådholm, K.; Figtree, G.; Perkovic, V.; Solomon, S.D.; Mahaffey, K.W.; Zeeuw, D.D.; Fulcher, G.; Barrett, T.D.; Shaw, W.; Desai, M.; et al. Canagliflozin and Heart Failure in Type 2 Diabetes Mellitus: Results from the CANVAS Program. Circulation 2018, 138, 458–468. [Google Scholar] [CrossRef] [PubMed]
- Kosiborod, M.; Cavender, M.A.; Fu, A.Z.; Wilding, J.P.; Khunti, K.; Holl, R.W.; Norhammar, A.; Birkeland, K.I.; Jørgensen, M.E.; Thuresson, M.; et al. Lower Risk of Heart Failure and Death in Patients Initiated on Sodium-Glucose Cotransporter-2 Inhibitors Versus Other Glucose-Lowering Drugs: The CVD-REAL Study (Comparative Effectiveness of Cardiovascular Outcomes in New Users of Sodium-Glucose Cotransporter-2 Inhibitors). Circulation 2017, 136, 249–259. [Google Scholar] [PubMed]
- Cai, C.; Guo, Z.; Chang, X.; Li, Z.; Wu, F.; He, J.; Cao, T.; Wang, K.; Shi, N.; Zhou, H.; et al. Empagliflozin attenuates cardiac microvascular ischemia/reperfusion through activating the AMPKα1/ULK1/FUNDC1/mitophagy pathway. Redox Biol. 2022, 52, 102288. [Google Scholar] [CrossRef]
- Mizuno, M.; Kuno, A.; Yano, T.; Miki, T.; Oshima, H.; Sato, T.; Nakata, K.; Kimura, Y.; Tanno, M.; Miura, T. Empagliflozin normalizes the size and number of mitochondria and prevents reduction in mitochondrial size after myocardial infarction in diabetic hearts. Physiol. Rep. 2018, 6, e13741. [Google Scholar] [CrossRef]
- Rovira-Llopis, S.; Bañuls, C.; Diaz-Morales, N.; Hernandez-Mijares, A.; Rocha, M.; Victor, V.M. Mitochondrial dynamics in type 2 diabetes: Pathophysiological implications. Redox Biol. 2017, 11, 637–645. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Xin, Y.; Cheng, Y.; Liu, X. Mitochondria-Endoplasmic Reticulum Contacts: The Promising Regulators in Diabetic Cardiomyopathy. Oxid. Med. Cell. Longev. 2022, 2022, 2531458. [Google Scholar] [CrossRef] [PubMed]
- Ma, T.; Huang, X.; Zheng, H.; Huang, G.; Li, W.; Liu, X.; Liang, J.; Cao, Y.; Hu, Y.; Huang, Y. SFRP2 Improves Mitochondrial Dynamics and Mitochondrial Biogenesis, Oxidative Stress, and Apoptosis in Diabetic Cardiomyopathy. Oxid. Med. Cell. Longev. 2021, 2021, 9265016. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Lu, Q.; Ding, Y.; Wu, Y.; Qiu, Y.; Wang, P.; Mao, X.; Huang, K.; Xie, Z.; Zou, M.-H. Hyperglycemia-Driven Inhibition of AMP-Activated Protein Kinase α2 Induces Diabetic Cardiomyopathy by Promoting Mitochondria-Associated Endoplasmic Reticulum Membranes In Vivo. Circulation 2019, 139, 1913–1936. [Google Scholar] [CrossRef] [PubMed]
- Peng, X.; Chen, S.; Wang, Y.; Jin, M.; Mei, F.; Bao, Y.; Liao, X.; Chen, Y.; Gong, W. SGLT2i reduces renal injury by improving mitochondrial metabolism and biogenesis. Mol. Metab. 2022, 101613. [Google Scholar] [CrossRef] [PubMed]
- Yu, W.; Gao, B.; Li, N.; Wang, J.; Qiu, C.; Zhang, G.; Liu, M.; Zhang, R.; Li, C.; Ji, G.; et al. Sirt3 deficiency exacerbates diabetic cardiac dysfunction: Role of Foxo3A-Parkin-mediated mitophagy. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 1973–1983. [Google Scholar] [CrossRef]
- Shao, D.; Kolwicz, S.C.; Wang, P.; Roe, N.D.; Villet, O.; Nishi, K.; Hsu, Y.-W.A.; Flint, G.V.; Caudal, A.; Wang, W.; et al. Increasing Fatty Acid Oxidation Prevents High-Fat Diet-Induced Cardiomyopathy Through Regulating Parkin-Mediated Mitophagy. Circulation 2020, 142, 983–997. [Google Scholar] [CrossRef]
- Mu, J.; Zhang, D.; Tian, Y.; Xie, Z.; Zou, M.-H. BRD4 inhibition by JQ1 prevents high-fat diet-induced diabetic cardiomyopathy by activating PINK1/Parkin-mediated mitophagy in vivo. J. Mol. Cell. Cardiol. 2020, 149, 1–14. [Google Scholar] [CrossRef]
- Sciarretta, S.; Zhai, P.; Shao, D.; Maejima, Y.; Robbins, J.; Volpe, M.; Condorelli, G.; Sadoshima, J. Rheb is a critical regulator of autophagy during myocardial ischemia: Pathophysiological implications in obesity and metabolic syndrome. Circulation 2012, 125, 1134–1146. [Google Scholar] [CrossRef]
- Belosludtseva, N.V.; Starinets, V.S.; Mikheeva, I.B.; Serov, D.A.; Astashev, M.E.; Belosludtsev, M.N.; Dubinin, M.V.; Belosludtsev, K.N. Effect of the MPT Pore Inhibitor Alisporivir on the Development of Mitochondrial Dysfunction in the Heart Tissue of Diabetic Mice. Biology 2021, 10, 839. [Google Scholar] [CrossRef]
- Sun, Y.; Lu, F.; Yu, X.; Wang, B.; Chen, J.; Lu, F.; Peng, S.; Sun, X.; Yu, M.; Chen, H.; et al. Exogenous H(2)S Promoted USP8 Sulfhydration to Regulate Mitophagy in the Hearts of db/db Mice. Aging Dis. 2020, 11, 269–285. [Google Scholar] [CrossRef] [PubMed]
- Park, C.H.; Lee, B.; Han, M.; Rhee, W.J.; Kwak, M.S.; Yoo, T.-H.; Shin, J.-S. Canagliflozin protects against cisplatin-induced acute kidney injury by AMPK-mediated autophagy in renal proximal tubular cells. Cell Death Discov. 2022, 8, 12. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Teng, D.; Xu, B.; Wang, C.; Wang, H.; Jia, W.; Gong, L.; Dong, H.; Zhong, L.; Yang, J. The SGLT2 Inhibitor Canagliflozin Reduces Atherosclerosis by Enhancing Macrophage Autophagy. J. Cardiovasc. Transl. Res. 2023, 16, 999–1009. [Google Scholar] [CrossRef] [PubMed]
- Alshehri, M.M.; Danazumi, A.U.; Alshammari, M.K.; Bello, R.O.; Alghazwni, M.K.; Alshehri, A.M.; Alshlali, O.M.; Umar, H.I. Repurposing the inhibitors of MMP-9 and SGLT-2 against ubiquitin specific protease 30 in Parkinson’s disease: Computational modelling studies. J. Biomol. Struct. Dyn. 2023, 42, 1307–1318. [Google Scholar] [CrossRef] [PubMed]
- Fang, W.-J.; Wang, C.-J.; He, Y.; Zhou, Y.-L.; Peng, X.-D.; Liu, S.-K. Resveratrol alleviates diabetic cardiomyopathy in rats by improving mitochondrial function through PGC-1α deacetylation. Acta Pharmacol. Sin. 2018, 39, 59–73. [Google Scholar] [CrossRef]
- Mekala, N.; Kurdys, J.; Vicenzi, A.P.; Weiler, L.R.; Avramut, C.; Vazquez, E.J.; Ragina, N.; Rosca, M.G. MiR 208a Regulates Mitochondrial Biogenesis in Metabolically Challenged Cardiomyocytes. Cells 2021, 10, 3152. [Google Scholar] [CrossRef] [PubMed]
- Chang, X.; Li, Y.; Cai, C.; Wu, F.; He, J.; Zhang, Y.; Zhong, J.; Tan, Y.; Liu, R.; Zhu, H.; et al. Mitochondrial quality control mechanisms as molecular targets in diabetic heart. Metabolism 2022, 137, 155313. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Liu, Q.; Li, Y.; Tang, Q.; Wu, T.; Chen, L.; Pu, S.; Zhao, Y.; Zhang, G.; Huang, C.; et al. The diabetes medication canagliflozin promotes mitochondrial remodelling of adipocyte via the AMPK-Sirt1-Pgc-1α signalling pathway. Adipocyte 2020, 9, 484–494. [Google Scholar] [CrossRef]
- Wei, D.; Liao, L.; Wang, H.; Zhang, W.; Wang, T.; Xu, Z. Canagliflozin ameliorates obesity by improving mitochondrial function and fatty acid oxidation via PPARα in vivo and in vitro. Life Sci. 2020, 247, 117414. [Google Scholar] [CrossRef]
Gene | Forward | Reverse |
---|---|---|
Mouse β-actin | GCAGGAGTACGATGAGTCCG | ACGCAGCTCAGTAACAGTCC |
Mouse Cytochrome B | GCCACCTTGACCCGATTCTTCGC | TGAACGATTGCTAGGGCCGCG |
Rat β-actin | TCAGGTCATCACTATCGGCAAT | TCAGGTCATCACTATCGGCAAT |
Rat Cytochrome B | GCCTCCGATTCATGTTAAGACTA | TACGCTATTCTACGCTCCATTC |
Rat TFAM | TTCCAGGAGGCTAAGGATGAGTCAG | GCTTCACACTGCGACGGATGAG |
Rat PINK1 | ACTACCTATGCCCATCCATCTA | CTCGGTGACAGCTAAGTCATC |
Rat Bnip3 | CCCAGACACCACAAGATACCAACAG | GTCAGACGCCTTCCAATGTAGATCC |
Rat FUNDC1 | GAGAGCGATGACGAGTCTTACGAAG | CACTGTGACTGGCAACCTGTAGAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, C.; Xiao, C.; Ding, Z.; Zhai, X.; Liu, J.; Yu, M. Canagliflozin Mitigates Diabetic Cardiomyopathy through Enhanced PINK1-Parkin Mitophagy. Int. J. Mol. Sci. 2024, 25, 7008. https://doi.org/10.3390/ijms25137008
Yang C, Xiao C, Ding Z, Zhai X, Liu J, Yu M. Canagliflozin Mitigates Diabetic Cardiomyopathy through Enhanced PINK1-Parkin Mitophagy. International Journal of Molecular Sciences. 2024; 25(13):7008. https://doi.org/10.3390/ijms25137008
Chicago/Turabian StyleYang, Chunru, Cheng Xiao, Zerui Ding, Xiaojun Zhai, Jieying Liu, and Miao Yu. 2024. "Canagliflozin Mitigates Diabetic Cardiomyopathy through Enhanced PINK1-Parkin Mitophagy" International Journal of Molecular Sciences 25, no. 13: 7008. https://doi.org/10.3390/ijms25137008
APA StyleYang, C., Xiao, C., Ding, Z., Zhai, X., Liu, J., & Yu, M. (2024). Canagliflozin Mitigates Diabetic Cardiomyopathy through Enhanced PINK1-Parkin Mitophagy. International Journal of Molecular Sciences, 25(13), 7008. https://doi.org/10.3390/ijms25137008