Metabolomics Reveals the Impact of Overexpression of Cytosolic Fructose-1,6-Bisphosphatase on Photosynthesis and Growth in Nannochloropsis gaditana
Abstract
1. Introduction
2. Results
2.1. Sequence Analysis of the cyFBPase in N. gaditana
2.2. Generation of a New N. gaditana Transformation Vector to Express cyFBPase from the Genome
2.3. Analysis of cyFBPase Enzyme Activity in NgFBP Transformants
2.4. Increased Photosynthetic Characteristics of the NgFBP Overexpression Strains
2.5. Effect of Overexpression of NgFBP on Growth and Biomass Accumulation during Photoautotrophic Growth
2.6. Lipid Content and Composition of Overexpressing Strains
2.7. Metabolomic Analysis of NgFBP Strains
3. Discussion
3.1. The Activity of cyFBPase in Photosynthesis and Its Effects
3.2. Transforming Microalgae through Engineering to Surpass the Constraints of Photoautotrophic Efficiency
4. Materials and Methods
4.1. Strains and Culture Conditions
4.2. Cloning Full-Length Genes and Construction of Overexpression Vectors
4.3. Electrotransformation, DNA Extraction, and PCR Detection
4.4. Cell Growth and Biomass Measurements
4.5. Calculations of Light Energy Utilization
4.6. Chlorophyll Fluorescence Analysis
4.7. RNA Extraction and Quantitative Real-Time PCR
4.8. Western Blotting
4.9. Lipid Quantification
4.10. cyFBPase Enzyme Assay
4.11. Fatty Acid Composition Analysis (GC-MS)
4.12. Metabolomic Analysis
4.13. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Friedland, N.; Negi, S.; Vinogradova-Shah, T.; Wu, G.; Ma, L.; Flynn, S.; Kumssa, T.; Lee, C.H.; Sayre, R.T. Fine-tuning the photosynthetic light harvesting apparatus for improved photosynthetic efficiency and biomass yield. Sci. Rep. 2019, 9, 13028. [Google Scholar] [CrossRef] [PubMed]
 - Stirbet, A.; Lazar, D.; Guo, Y.; Govindjee, G. Photosynthesis: Basics, history and modelling. Ann. Bot. 2020, 126, 511–537. [Google Scholar] [CrossRef] [PubMed]
 - Berry, J.O.; Yerramsetty, P.; Zielinski, A.M.; Mure, C.M. Photosynthetic gene expression in higher plants. Photosynth. Res. 2013, 117, 91–120. [Google Scholar] [CrossRef] [PubMed]
 - Benedetti, M.; Vecchi, V.; Barera, S.; Dall’Osto, L. Biomass from microalgae: The potential of domestication towards sustainable biofactories. Microb. Cell Fact. 2018, 17, 173. [Google Scholar] [CrossRef] [PubMed]
 - Dolganyuk, V.; Belova, D.; Babich, O.; Prosekov, A.; Ivanova, S.; Katserov, D.; Patyukov, N.; Sukhikh, S. Microalgae: A Promising Source of Valuable Bioproducts. Biomolecules 2020, 10, 1153. [Google Scholar] [CrossRef] [PubMed]
 - Behler, J.; Vijay, D.; Hess, W.R.; Akhtar, M.K. CRISPR-Based Technologies for Metabolic Engineering in Cyanobacteria. Trends Biotechnol. 2018, 36, 996–1010. [Google Scholar] [CrossRef] [PubMed]
 - Patel, V.K.; Soni, N.; Prasad, V.; Sapre, A.; Dasgupta, S.; Bhadra, B. CRISPR-Cas9 System for Genome Engineering of Photosynthetic Microalgae. Mol. Biotechnol. 2019, 61, 541–561. [Google Scholar] [CrossRef]
 - Naduthodi, M.I.S.; Mohanraju, P.; Sudfeld, C.; D‘Adamo, S.; Barbosa, M.J.; van der Oost, J. CRISPR-Cas ribonucleoprotein mediated homology-directed repair for efficient targeted genome editing in microalgae Nannochloropsis oceanica IMET1. Biotechnol. Biofuels 2019, 12, 66. [Google Scholar] [CrossRef] [PubMed]
 - Li, S.; Li, X.; Ho, S.-H. How to enhance carbon capture by evolution of microalgal photosynthesis? Sep. Purif. Technol. 2022, 291, 120951. [Google Scholar] [CrossRef]
 - Gee, C.W.; Niyogi, K.K. The carbonic anhydrase CAH1 is an essential component of the carbon-concentrating mechanism in Nannochloropsis oceanica. Proc. Natl. Acad. Sci. USA 2017, 114, 4537–4542. [Google Scholar] [CrossRef]
 - Ajjawi, I.; Verruto, J.; Aqui, M.; Soriaga, L.B.; Coppersmith, J.; Kwok, K.; Peach, L.; Orchard, E.; Kalb, R.; Xu, W.; et al. Lipid production in Nannochloropsis gaditana is doubled by decreasing expression of a single transcriptional regulator. Nat. Biotechnol. 2017, 35, 647–652. [Google Scholar] [CrossRef] [PubMed]
 - Liu, J.; Song, Y.; Qiu, W. Oleaginous microalgae Nannochloropsis as a new model for biofuel production: Review & analysis. Renew. Sustain. Energy Rev. 2017, 72, 154–162. [Google Scholar]
 - Chen, Y.; Hu, H. High efficiency transformation by electroporation of the freshwater alga Nannochloropsis limnetica. World J. Microbiol. Biotechnol. 2019, 35, 119. [Google Scholar] [CrossRef]
 - Kilian, O.; Benemann, C.S.; Niyogi, K.K.; Vick, B. High-efficiency homologous recombination in the oil-producing alga Nannochloropsis sp. Proc. Natl. Acad. Sci. USA 2011, 108, 21265–21269. [Google Scholar] [CrossRef] [PubMed]
 - Guo, L.; Liang, S.; Zhang, Z.; Liu, H.; Wang, S.; Pan, K.; Xu, J.; Ren, X.; Pei, S.; Yang, G. Genome assembly of Nannochloropsis oceanica provides evidence of host nucleus overthrow by the symbiont nucleus during speciation. Commun. Biol. 2019, 2, 249. [Google Scholar] [CrossRef]
 - Vecchi, V.; Barera, S.; Bassi, R.; Dall’Osto, L. Potential and Challenges of Improving Photosynthesis in Algae. Plants 2020, 9, 67. [Google Scholar] [CrossRef] [PubMed]
 - Ooms, M.D.; Dinh, C.T.; Sargent, E.H.; Sinton, D. Photon management for augmented photosynthesis. Nat. Commun. 2016, 7, 12699. [Google Scholar] [CrossRef] [PubMed]
 - Mussgnug, J.H.; Thomas-Hall, S.; Rupprecht, J.; Foo, A.; Klassen, V.; McDowall, A.; Schenk, P.M.; Kruse, O.; Hankamer, B. Engineering photosynthetic light capture: Impacts on improved solar energy to biomass conversion. Plant Biotechnol. J. 2007, 5, 802–814. [Google Scholar] [CrossRef] [PubMed]
 - Abu-Ghosh, S.; Fixler, D.; Dubinsky, Z.; Iluz, D. Flashing light in microalgae biotechnology. Bioresour. Technol. 2016, 203, 357–363. [Google Scholar] [CrossRef] [PubMed]
 - Jeong, J.; Baek, K.; Yu, J.; Kirst, H.; Betterle, N.; Shin, W.; Bae, S.; Melis, A.; Jin, E. Deletion of the chloroplast LTD protein impedes LHCI import and PSI-LHCI assembly in Chlamydomonas reinhardtii. J. Exp. Bot. 2018, 69, 1147–1158. [Google Scholar] [CrossRef]
 - de Carvalho Silvello, M.A.; Severo Goncalves, I.; Patricia Held Azambuja, S.; Silva Costa, S.; Garcia Pereira Silva, P.; Oliveira Santos, L.; Goldbeck, R. Microalgae-based carbohydrates: A green innovative source of bioenergy. Bioresour. Technol. 2022, 344 Pt B, 126304. [Google Scholar] [CrossRef]
 - Ljubic, A.; Jacobsen, C.; Holdt, S.L.; Jakobsen, J. Microalgae Nannochloropsis oceanica as a future new natural source of vitamin D(3). Food Chem. 2020, 320, 126627. [Google Scholar] [CrossRef] [PubMed]
 - Vadiveloo, A.; Moheimani, N.R.; Cosgrove, J.J.; Parlevliet, D.; Bahri, P.A. Effects of different light spectra on the growth, productivity and photosynthesis of two acclimated strains of Nannochloropsis sp. J. Appl. Phycol. 2017, 29, 1765–1774. [Google Scholar] [CrossRef]
 - Boyle, N.R.; Morgan, J.A. Flux balance analysis of primary metabolism in Chlamydomonas reinhardtii. BMC Syst. Biol. 2009, 3, 4. [Google Scholar] [CrossRef] [PubMed]
 - Strand, A.; Zrenner, R.; Trevanion, S.; Stitt, M.; Gustafsson, P.; Gardestrom, P. Decreased expression of two key enzymes in the sucrose biosynthesis pathway, cytosolic fructose-1,6-bisphosphatase and sucrose phosphate synthase, has remarkably different consequences for photosynthetic carbon metabolism in transgenic Arabidopsis thaliana. Plant J. 2000, 23, 759–770. [Google Scholar] [CrossRef] [PubMed]
 - Serrato, A.J.; Yubero-Serrano, E.M.; Sandalio, L.M.; Munoz-Blanco, J.; Chueca, A.; Caballero, J.L.; Sahrawy, M. cpFBPaseII, a novel redox-independent chloroplastic isoform of fructose-1,6-bisphosphatase. Plant Cell Environ. 2009, 32, 811–827. [Google Scholar] [CrossRef] [PubMed]
 - Ladror, U.S.; Latshaw, S.P.; Marcus, F. Spinach cytosolic fructose-1,6-bisphosphatase. Purification, enzyme properties and structural comparisons. Eur. J. Biochem. 1990, 189, 89–94. [Google Scholar] [CrossRef] [PubMed]
 - Qiu, Z.; Bai, M.; Kuang, H.; Wang, X.; Yu, X.; Zhong, X.; Guan, Y. Cytosolic Fructose-1,6-bisphosphate Aldolases Modulate Primary Metabolism and Phytohormone Homeostasis in Soybean. Agronomy 2023, 13, 1383. [Google Scholar] [CrossRef]
 - Rojas-Gonzalez, J.A.; Soto-Suarez, M.; Garcia-Diaz, A.; Romero-Puertas, M.C.; Sandalio, L.M.; Merida, A.; Thormahlen, I.; Geigenberger, P.; Serrato, A.J.; Sahrawy, M. Disruption of both chloroplastic and cytosolic FBPase genes results in a dwarf phenotype and important starch and metabolite changes in Arabidopsis thaliana. J. Exp. Bot. 2015, 66, 2673–2689. [Google Scholar] [CrossRef]
 - Dejtisakdi, W.; Miller, S.M. Overexpression of Calvin cycle enzyme fructose 1,6-bisphosphatase in Chlamydomonas reinhardtii has a detrimental effect on growth. Algal Res. 2016, 14, 116–126. [Google Scholar] [CrossRef]
 - Li, Y.-y.; Guo, L.-n.; Liang, C.-z.; Meng, Z.-g.; Tahira, S.; Guo, S.-d.; Zhang, R. Overexpression of Brassica napus cytosolic fructose-1,6-bisphosphatase and sedoheptulose-1,7-bisphosphatase genes significantly enhanced tobacco growth and biomass. J. Integr. Agric. 2022, 21, 49–59. [Google Scholar] [CrossRef]
 - Serrato, A.J.; de Dios Barajas-Lopez, J.; Chueca, A.; Sahrawy, M. Changing sugar partitioning in FBPase-manipulated plants. J. Exp. Bot. 2009, 60, 2923–2931. [Google Scholar] [CrossRef]
 - Ogawa, T.; Tamoi, M.; Kimura, A.; Mine, A.; Sakuyama, H.; Yoshida, E.; Maruta, T.; Suzuki, K.; Ishikawa, T.; Shigeoka, S. Enhancement of photosynthetic capacity in Euglena gracilis by expression of cyanobacterial fructose-1,6-/sedoheptulose-1,7-bisphosphatase leads to increases in biomass and wax ester production. Biotechnol. Biofuels 2015, 8, 80. [Google Scholar] [CrossRef] [PubMed]
 - Yabuta, Y.; Tamoi, M.; Yamamoto, K.; Tomizawa, K.; Yokota, A.; Shigeoka, S. Molecular design of photosynthesis-elevated chloroplasts for mass accumulation of a foreign protein. Plant Cell Physiol. 2008, 49, 375–385. [Google Scholar] [CrossRef] [PubMed]
 - Fang, L.; Lin, H.X.; Low, C.S.; Wu, M.H.; Chow, Y.; Lee, Y.K. Expression of the Chlamydomonas reinhardtii sedoheptulose-1,7-bisphosphatase in Dunaliella bardawil leads to enhanced photosynthesis and increased glycerol production. Plant Biotechnol. J. 2012, 10, 1129–1135. [Google Scholar] [CrossRef] [PubMed]
 - Vargas, W.A.; Pontis, H.G.; Salerno, G.L. New insights on sucrose metabolism: Evidence for an active A/N-Inv in chloroplasts uncovers a novel component of the intracellular carbon trafficking. Planta 2008, 227, 795–807. [Google Scholar] [CrossRef] [PubMed]
 - Tamoi, M.; Nagaoka, M.; Miyagawa, Y.; Shigeoka, S. Contribution of fructose-1,6-bisphosphatase and sedoheptulose-1,7-bisphosphatase to the photosynthetic rate and carbon flow in the Calvin cycle in transgenic plants. Plant Cell Physiol. 2006, 47, 380–390. [Google Scholar] [CrossRef] [PubMed]
 - Leonardos, E.D.; Micallef, B.J.; Micallef, M.C.; Grodzinski, B. Diel patterns of leaf C export and of main shoot growth for Flaveria linearis with altered leaf sucrose-starch partitioning. J. Exp. Bot. 2006, 57, 801–814. [Google Scholar] [CrossRef]
 - Turan, S.; Tripathy, B.C. Salt-stress induced modulation of chlorophyll biosynthesis during de-etiolation of rice seedlings. Physiol. Plant 2015, 153, 477–491. [Google Scholar] [CrossRef]
 - Dalal, V.K.; Tripathy, B.C. Modulation of chlorophyll biosynthesis by water stress in rice seedlings during chloroplast biogenesis. Plant Cell Environ. 2012, 35, 1685–1703. [Google Scholar] [CrossRef]
 - Wan, H.; Wu, L.; Yang, Y.; Zhou, G.; Ruan, Y.L. Evolution of Sucrose Metabolism: The Dichotomy of Invertases and Beyond. Trends Plant Sci. 2018, 23, 163–177. [Google Scholar] [CrossRef] [PubMed]
 - Eva, C.; Oszvald, M.; Tamas, L. Current and possible approaches for improving photosynthetic efficiency. Plant Sci. 2019, 280, 433–440. [Google Scholar] [CrossRef] [PubMed]
 - Driever, S.M.; Simkin, A.J.; Alotaibi, S.; Fisk, S.J.; Madgwick, P.J.; Sparks, C.A.; Jones, H.D.; Lawson, T.; Parry, M.A.J.; Raines, C.A. Increased SBPase activity improves photosynthesis and grain yield in wheat grown in greenhouse conditions. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2017, 372, 20160384. [Google Scholar] [CrossRef] [PubMed]
 - Lu, H.; Cheng, J.; Wang, Z.; Zhang, X.; Chen, S.; Zhou, J. Enhancing Photosynthetic Characterization and Biomass Productivity of Nannochloropsis oceanica by Nuclear Radiation. Front. Energy Res. 2020, 8, 143. [Google Scholar] [CrossRef]
 - Wang, D.; Ning, K.; Li, J.; Hu, J.; Han, D.; Wang, H.; Zeng, X.; Jing, X.; Zhou, Q.; Su, X.; et al. Nannochloropsis genomes reveal evolution of microalgal oleaginous traits. PLoS Genet. 2014, 10, e1004094. [Google Scholar] [CrossRef] [PubMed]
 - Uchida, H.; Kato, K.; Suzuki, K.; Yokota, A.; Kawano, S.; Matsunaga, S.; Okada, S. Algal Genes Encoding Enzymes for Photosynthesis and Hydrocarbon Biosynthesis as Candidates for Genetic Engineering. Cytologia 2018, 83, 7–17. [Google Scholar] [CrossRef]
 - Li, F.; Gao, D.; Hu, H. High-efficiency nuclear transformation of the oleaginous marine Nannochloropsis species using PCR product. Biosci. Biotechnol. Biochem. 2014, 78, 812–817. [Google Scholar] [CrossRef]
 - Chini Zittelli, G.; Rodolfi, L.; Biondi, N.; Tredici, M.R. Productivity and photosynthetic efficiency of outdoor cultures of Tetraselmis suecica in annular columns. Aquaculture 2006, 261, 932–943. [Google Scholar] [CrossRef]
 - Jassby, A.D.; Platt, T. Mathematical formulation of the relationship between photosynthesis and light for phytoplankton. Limnol. Oceanogr. 2003, 21, 540–547. [Google Scholar] [CrossRef]
 - Eilers, P.H.; Peeters, J.C. A model for the relationship between light intensity and the rate of photosynthesis in phytoplankton. Ecol. Model. 1988, 42, 199–215. [Google Scholar] [CrossRef]
 - Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
 - Tennessen, J.M.; Li, H. Preparation of Drosophila Larval Samples for Gas Chromatography-Mass Spectrometry (GC-MS)-based Metabolomics. J. Vis. Exp. 2018, 136, e57847. [Google Scholar]
 - Garcia, A.; Barbas, C. Gas chromatography-mass spectrometry (GC-MS)-based metabolomics. Methods Mol. Biol. 2011, 2011, 191–204. [Google Scholar]
 - Wang, J.; Zhang, T.; Shen, X.; Liu, J.; Zhao, D.; Sun, Y.; Wang, L.; Liu, Y.; Gong, X.; Liu, Y.; et al. Serum metabolomics for early diagnosis of esophageal squamous cell carcinoma by UHPLC-QTOF/MS. Metabolomics 2016, 12, 116. [Google Scholar] [CrossRef]
 







| Primer Name | Primer Sequences | 
|---|---|
| PcyFBP-1F | GGCTGGCAATGTTCTGTTTG | 
| PcyFBP-1R zeo-1F zeo-1R  | CTGGTTGAGTTCGATAGCAC ATGGCCAAGTTGACCAGTGC GGTTCAGTCCTGCTCCTCGG  | 
| Primer Name | Primer Sequences | 
|---|---|
| qFBP-F | GCGGTGCTTGTGTCTGAGGAA | 
| qFBP-R Actin-F Actin-R  | GCTCGTAGATGGCGAAGATGGT AGCTGCCGGATGGTAACGTG GCTCGCCTCCTTGCCGATAA  | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Z.; Li, Y.; Wen, S.; Yang, S.; Zhu, H.; Zhou, H. Metabolomics Reveals the Impact of Overexpression of Cytosolic Fructose-1,6-Bisphosphatase on Photosynthesis and Growth in Nannochloropsis gaditana. Int. J. Mol. Sci. 2024, 25, 6800. https://doi.org/10.3390/ijms25126800
Zhang Z, Li Y, Wen S, Yang S, Zhu H, Zhou H. Metabolomics Reveals the Impact of Overexpression of Cytosolic Fructose-1,6-Bisphosphatase on Photosynthesis and Growth in Nannochloropsis gaditana. International Journal of Molecular Sciences. 2024; 25(12):6800. https://doi.org/10.3390/ijms25126800
Chicago/Turabian StyleZhang, Zhengying, Yanyan Li, Shuting Wen, Shu Yang, Hongmei Zhu, and Hantao Zhou. 2024. "Metabolomics Reveals the Impact of Overexpression of Cytosolic Fructose-1,6-Bisphosphatase on Photosynthesis and Growth in Nannochloropsis gaditana" International Journal of Molecular Sciences 25, no. 12: 6800. https://doi.org/10.3390/ijms25126800
APA StyleZhang, Z., Li, Y., Wen, S., Yang, S., Zhu, H., & Zhou, H. (2024). Metabolomics Reveals the Impact of Overexpression of Cytosolic Fructose-1,6-Bisphosphatase on Photosynthesis and Growth in Nannochloropsis gaditana. International Journal of Molecular Sciences, 25(12), 6800. https://doi.org/10.3390/ijms25126800
        
