Gain-Type Aneuploidies Influence the Burden of Selective Long Non-Coding Transcripts in Colorectal Cancer
Abstract
1. Introduction
1.1. Genomic Aberrations in Colorectal Cancer
1.2. LncRNAs: Classification, Function and Involvement in Cancer
2. Results
2.1. Chromosomal Distribution of BCNAs and Somatic Broad Copy-Neutral Loss of Heterozygosities (SB-CNLOHs) in Colorectal Cancer Cell Lines
2.2. LncRNAs’ Transcriptional Effects Associated with Gain-Type BCNAs in CRC Samples and Cell Lines
2.2.1. List of UpT LncRNAs
2.2.2. List of Over-UpT LncRNAs in CRC
2.2.3. Confirmation of lincRNAs and Small Nucleolar Host Gene Transcripts as Over-UpT Using RNA-seq Data from The Cancer Genome Atlas (TGCA) Study
2.3. Expression of NORAD lncRNA in CRC Samples and Cell Lines
2.4. Expression of SNHG6 lncRNA in CRC Samples and Cell Lines
2.5. miRNAs Interacting with NORAD and SNHG6
3. Discussion
4. Materials and Methods
4.1. Human Cell Lines
4.2. Genomic DNA Extraction
4.3. Molecular Karyotyping by SNP 6.0 arrays
4.4. RNA-Seq Data
4.5. Transcriptome Analysis by Human Transcriptome Array 2.0
4.6. RNA Extraction and Quantitative q-RT PCR
4.7. Prediction of Targeting Relationship: lncRNA-miRNA-mRNA
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cancer Genome Atlas Network Comprehensive Molecular Characterization of Human Colon and Rectal Cancer. Nature 2012, 487, 330–337. [CrossRef] [Scilit] [PubMed]
- Bardhan, K.; Liu, K. Epigenetics and Colorectal Cancer Pathogenesis. Cancers 2013, 5, 676–713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heng, H.H.; Bremer, S.W.; Stevens, J.B.; Horne, S.D.; Liu, G.; Abdallah, B.Y.; Ye, K.J.; Ye, C.J. Chromosomal Instability (CIN): What It Is and Why It Is Crucial to Cancer Evolution. Cancer Metastasis Rev. 2013, 32, 325–340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barresi, V.; Castorina, S.; Musso, N.; Capizzi, C.; Luca, T.; Privitera, G.; Condorelli, D.F. Chromosomal Instability Analysis and Regional Tumor Heterogeneity in Colon Cancer. Cancer Genet. 2017, 210, 9–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taylor, A.M.; Shih, J.; Ha, G.; Gao, G.F.; Zhang, X.; Berger, A.C.; Schumacher, S.E.; Wang, C.; Hu, H.; Liu, J.; et al. Genomic and Functional Approaches to Understanding Cancer Aneuploidy. Cancer Cell 2018, 33, 676–689.e3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barresi, V.; Romano, A.; Musso, N.; Capizzi, C.; Consoli, C.; Martelli, M.P.; Palumbo, G.; Di Raimondo, F.; Condorelli, D.F. Broad Copy Neutral-Loss of Heterozygosity Regions and Rare Recurring Copy Number Abnormalities in Normal Karyotype-Acute Myeloid Leukemia Genomes. Genes. Chromosomes Cancer 2010, 49, 1014–1023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Melcher, R.; Hartmann, E.; Zopf, W.; Herterich, S.; Wilke, P.; Müller, L.; Rosler, E.; Kudlich, T.; Al-Taie, O.; Rosenwald, A.; et al. LOH and Copy Neutral LOH (cnLOH) Act as Alternative Mechanism in Sporadic Colorectal Cancers with Chromosomal and Microsatellite Instability. Carcinogenesis 2011, 32, 636–642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Condorelli, D.F.; Spampinato, G.; Valenti, G.; Musso, N.; Castorina, S.; Barresi, V. Positive Caricature Transcriptomic Effects Associated with Broad Genomic Aberrations in Colorectal Cancer. Sci. Rep. 2018, 8, 14826. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marescalco, M.S.; Capizzi, C.; Condorelli, D.F.; Barresi, V. Genome-Wide Analysis of Recurrent Copy-Number Alterations and Copy-Neutral Loss of Heterozygosity in Head and Neck Squamous Cell Carcinoma. J. Oral Pathol. Med. Off. Publ. Int. Assoc. Oral Pathol. Am. Acad. Oral Pathol. 2014, 43, 20–27. [Google Scholar] [CrossRef] [Scilit]
- Mattick, J.S.; Amaral, P.P.; Carninci, P.; Carpenter, S.; Chang, H.Y.; Chen, L.-L.; Chen, R.; Dean, C.; Dinger, M.E.; Fitzgerald, K.A.; et al. Long Non-Coding RNAs: Definitions, Functions, Challenges and Recommendations. Nat. Rev. Mol. Cell Biol. 2023, 24, 430–447. [Google Scholar] [CrossRef] [Scilit]
- Sampath, K.; Ephrussi, A. CncRNAs: RNAs with Both Coding and Non-Coding Roles in Development. Dev. Camb. Engl. 2016, 143, 1234–1241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dhamija, S.; Menon, M.B. Non-Coding Transcript Variants of Protein-Coding Genes—What Are They Good For? RNA Biol. 2018, 15, 1025–1031. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Statello, L.; Guo, C.-J.; Chen, L.-L.; Huarte, M. Gene Regulation by Long Non-Coding RNAs and Its Biological Functions. Nat. Rev. Mol. Cell Biol. 2021, 22, 96–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, G.; Xu, W.-Y.; Xiao, Y.; Jin, B.; Du, S.-D.; Mao, Y.-L.; Zhang, Z.-T. The Emerging Roles of Non-Coding Competing Endogenous RNA in Hepatocellular Carcinoma. Cancer Cell Int. 2020, 20, 496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shuwen, H.; Qing, Z.; Yan, Z.; Xi, Y. Competitive Endogenous RNA in Colorectal Cancer: A Systematic Review. Gene 2018, 645, 157–162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhan, A.; Soleimani, M.; Mandal, S.S. Long Noncoding RNA and Cancer: A New Paradigm. Cancer Res. 2017, 77, 3965–3981. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Li, L.; Bai, J.; Li, L.; Fan, J.; Fu, Z.; Liu, J. Long Noncoding RNA Plasmacytoma Variant Translocation 1 Promotes Progression of Colorectal Cancer by Sponging microRNA-152-3p and Regulating E2F3/MAPK8 Signaling. Cancer Sci. 2022, 113, 109–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Du, L.; Duan, W.; Yan, S.; Xie, Y.; Wang, C. Overexpression of Long Noncoding RNA NORAD in Colorectal Cancer Associates with Tumor Progression. OncoTargets Ther. 2018, 11, 6757–6766. [Google Scholar] [CrossRef] [Scilit]
- Liau, X.L.; Salvamani, S.; Gunasekaran, B.; Chellappan, D.K.; Rhodes, A.; Ulaganathan, V.; Tiong, Y.L. CCAT 1- A Pivotal Oncogenic Long Non-Coding RNA in Colorectal Cancer. Br. J. Biomed. Sci. 2023, 80, 11103. [Google Scholar] [CrossRef] [Scilit]
- Chen, B.; Dragomir, M.P.; Fabris, L.; Bayraktar, R.; Knutsen, E.; Liu, X.; Tang, C.; Li, Y.; Shimura, T.; Ivkovic, T.C.; et al. The Long Noncoding RNA CCAT2 Induces Chromosomal Instability Through BOP1-AURKB Signaling. Gastroenterology 2020, 159, 2146–2162.e33. [Google Scholar] [CrossRef] [Scilit]
- Ding, J.; Li, J.; Wang, H.; Tian, Y.; Xie, M.; He, X.; Ji, H.; Ma, Z.; Hui, B.; Wang, K.; et al. Long Noncoding RNA CRNDE Promotes Colorectal Cancer Cell Proliferation via Epigenetically Silencing DUSP5/CDKN1A Expression. Cell Death Dis. 2017, 8, e2997. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, L.; Sun, J.; Liu, J.; Xu, F.; Zhu, Q.; Shi, X. Long Non-Coding RNA CASC2 Functions as A Tumor Suppressor in Colorectal Cancer via Modulating The miR-18a-5p/BTG3 Pathway. Cell J. 2022, 24, 665–672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, P.; Pan, Y.; Sun, J.; Pan, G. Aberrant Expression of LncRNA CASC2 Mediated the Cell Viability, Apoptosis and Autophagy of Colon Cancer Cells by Sponging miR19a via NFB Signaling Pathway. Int. J. Exp. Pathol. 2021, 102, 163–171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, K.; Zhao, Z.; Wang, G.; Wang, J.; Zhu, W. lncRNA GAS5 Inhibits Colorectal Cancer Cell Proliferation via the miR-182-5p/FOXO3a Axis. Oncol. Rep. 2018, 40, 2371–2380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, X.; Xie, Z.; Lei, X.; Gan, R. Long Non-Coding RNA GAS5 in Human Cancer. Oncol. Lett. 2020, 20, 2587–2594. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bach, D.-H.; Lee, S.K. Long Noncoding RNAs in Cancer Cells. Cancer Lett. 2018, 419, 152–166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weinstein, J.N.; Collisson, E.A.; Mills, G.B.; Shaw, K.R.; Ozenberger, B.A.; Ellrott, K.; Shmulevich, I.; Sander, C.; Stuart, J.M. Cancer Genome Atlas Research Network. The Cancer Genome Atlas Pan-Cancer analysis project. Nat. Genet. 2013, 45, 1113–1120. [Google Scholar] [CrossRef] [Scilit]
- Tomczak, K.; Czerwińska, P.; Wiznerowicz, M. The Cancer Genome Atlas (TCGA): An Immeasurable Source of Knowledge. Contemp. Oncol. Pozn. Pol. 2015, 19, A68–A77. [Google Scholar] [CrossRef] [Scilit]
- Condorelli, D.F.; Privitera, A.P.; Barresi, V. Chromosomal Density of Cancer Up-Regulated Genes, Aberrant Enhancer Activity and Cancer Fitness Genes Are Associated with Transcriptional Cis-Effects of Broad Copy Number Gains in Colorectal Cancer. Int. J. Mol. Sci. 2019, 20, 4652. [Google Scholar] [CrossRef] [Scilit]
- Fehrmann, R.S.N.; Karjalainen, J.M.; Krajewska, M.; Westra, H.-J.; Maloney, D.; Simeonov, A.; Pers, T.H.; Hirschhorn, J.N.; Jansen, R.C.; Schultes, E.A.; et al. Gene Expression Analysis Identifies Global Gene Dosage Sensitivity in Cancer. Nat. Genet. 2015, 47, 115–125. [Google Scholar] [CrossRef] [Scilit]
- Tsafrir, D.; Bacolod, M.; Selvanayagam, Z.; Tsafrir, I.; Shia, J.; Zeng, Z.; Liu, H.; Krier, C.; Stengel, R.; Barany, F.; et al. Relationship of Gene Expression and Chromosomal Abnormalities in Colorectal Cancer. Cancer Res. 2006, 66, 2129–2137. [Google Scholar] [CrossRef] [Scilit]
- Dürrbaum, M.; Storchová, Z. Effects of Aneuploidy on Gene Expression: Implications for Cancer. FEBS J. 2016, 283, 791–802. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.; Kopp, F.; Chang, T.-C.; Sataluri, A.; Chen, B.; Sivakumar, S.; Yu, H.; Xie, Y.; Mendell, J.T. Noncoding RNA NORAD Regulates Genomic Stability by Sequestering PUMILIO Proteins. Cell 2016, 164, 69–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Z.; Zhao, Y.; Lin, G.; Zhou, X.; Jiang, X.; Zhao, H. Noncoding RNA Activated by DNA Damage (NORAD): Biologic Function and Mechanisms in Human Cancers. Clin. Chim. Acta Int. J. Clin. Chem. 2019, 489, 5–9. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Wu, H.; Zhang, Y.; Xiao, X.; Chu, F.; Zhang, L. Induction of lncRNA NORAD Accounts for Hypoxia-Induced Chemoresistance and Vasculogenic Mimicry in Colorectal Cancer by Sponging the miR-495-3p/ Hypoxia-Inducible Factor-1α (HIF-1α). Bioengineered 2022, 13, 950–962. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Li, X.-Y.; Hu, P.; Ding, Y.-S. lncRNA NORAD Contributes to Colorectal Cancer Progression by Inhibition of miR-202-5p. Oncol. Res. Featur. Preclin. Clin. Cancer Ther. 2018, 26, 1411–1418. [Google Scholar] [CrossRef] [Scilit]
- Huang, Q.; Xing, S.; Peng, A.; Yu, Z. NORAD Accelerates Chemo-Resistance of Non-Small-Cell Lung Cancer via Targeting at miR-129-1-3p/SOX4 Axis. Biosci. Rep. 2020, 40, BSR20193489. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.-S.; Zhang, W.; Zhu, H.-L.; Li, Q.-P.; Miao, L. Long Noncoding RNA SNHG6 Mainly Functions as a Competing Endogenous RNA in Human Tumors. Cancer Cell Int. 2020, 20, 219. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Lai, Q.; He, J.; Li, Q.; Ding, J.; Lan, Z.; Gu, C.; Yan, Q.; Fang, Y.; Zhao, X.; et al. LncRNA SNHG6 Promotes Proliferation, Invasion and Migration in Colorectal Cancer Cells by Activating TGF-β/Smad Signaling Pathway via Targeting UPF1 and Inducing EMT via Regulation of ZEB1. Int. J. Med. Sci. 2019, 16, 51–59. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Bian, Z.; Yao, S.; Zhang, J.; Jin, G.; Wang, X.; Yin, Y.; Huang, Z. Up-Regulated Expression of SNHG6 Predicts Poor Prognosis in Colorectal Cancer. Pathol. Res. Pract. 2018, 214, 784–789. [Google Scholar] [CrossRef] [Scilit]
- Guo, T.; Wang, H.; Liu, P.; Xiao, Y.; Wu, P.; Wang, Y.; Chen, B.; Zhao, Q.; Liu, Z.; Liu, Q. SNHG6 Acts as a Genome-Wide Hypomethylation Trigger via Coupling of miR-1297-Mediated S-Adenosylmethionine-Dependent Positive Feedback Loops. Cancer Res. 2018, 78, 3849–3864. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barresi, V.; Palumbo, G.A.; Musso, N.; Consoli, C.; Capizzi, C.; Meli, C.R.; Romano, A.; Di Raimondo, F.; Condorelli, D.F. Clonal Selection of 11q CN-LOH and CBL Gene Mutation in a Serially Studied Patient during MDS Progression to AML. Leuk. Res. 2010, 34, 1539–1542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cerami, E.; Gao, J.; Dogrusoz, U.; Gross, B.E.; Sumer, S.O.; Aksoy, B.A.; Jacobsen, A.; Byrne, C.J.; Heuer, M.L.; Larsson, E.; et al. The cBio Cancer Genomics Portal: An Open Platform for Exploring Multidimensional Cancer Genomics Data. Cancer Discov. 2012, 2, 401–404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, J.; Aksoy, B.A.; Dogrusoz, U.; Dresdner, G.; Gross, B.; Sumer, S.O.; Sun, Y.; Jacobsen, A.; Sinha, R.; Larsson, E.; et al. Integrative Analysis of Complex Cancer Genomics and Clinical Profiles Using the cBioPortal. Sci. Signal. 2013, 6, pl1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor Package for Differential Expression Analysis of Digital Gene Expression Data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McCarthy, D.J.; Chen, Y.S.; Smyth, G.K. Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic. Acids Res. 2012, 40, 4288–4297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soneson, C. compcodeR—An R package for benchmarking di_erential expression methods for RNA-seq data. Bioinformatics 2014, 30, 2517–2518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef] [Scilit]
- Barresi, V.; Cinnirella, G.; Valenti, G.; Spampinato, G.; Musso, N.; Castorina, S.; Condorelli, D.F. Gene Expression Profiles in Genome Instability-Based Classes of Colorectal Cancer. BMC Cancer 2018, 18, 1265. [Google Scholar] [CrossRef] [Scilit]
- Barresi, V.; Trovato-Salinaro, A.; Spampinato, G.; Musso, N.; Castorina, S.; Rizzarelli, E.; Condorelli, D.F. Transcriptome Analysis of Copper Homeostasis Genes Reveals Coordinated Upregulation of SLC31A1,SCO1, and COX11 in Colorectal Cancer. FEBS Open Bio 2016, 6, 794–806. [Google Scholar] [CrossRef] [Scilit]
- Barresi, V.; Valenti, G.; Spampinato, G.; Musso, N.; Castorina, S.; Rizzarelli, E.; Condorelli, D.F. Transcriptome Analysis Reveals an Altered Expression Profile of Zinc Transporters in Colorectal Cancer. J. Cell. Biochem. 2018, 119, 9707–9719. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, K.R.; Huang, J.H.; Liu, S.; Li, B.; Liu, S.R.; Zheng, W.J.; Cai, L. An Encyclopedia of RNA Interactomes in ENCORI 2023. Available online: https://rnasysu.com/encori/ (accessed on 15 June 2023).
- Li, J.-H.; Liu, S.; Zhou, H.; Qu, L.-H.; Yang, J.-H. starBase v2.0: Decoding miRNA-ceRNA, miRNA-ncRNA and Protein-RNA Interaction Networks from Large-Scale CLIP-Seq Data. Nucleic Acids Res. 2014, 42, D92–D97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lennox, K.A.; Behlke, M.A. Cellular Localization of Long Non-Coding RNAs Affects Silencing by RNAi More than by Antisense Oligonucleotides. Nucleic Acids Res. 2016, 44, 863–877. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barresi, V.; Musmeci, C.; Rinaldi, A.; Condorelli, D.F. Transcript-Targeted Therapy Based on RNA Interference and Antisense Oligonucleotides: Current Applications and Novel Molecular Targets. Int. J. Mol. Sci. 2022, 23, 8875. [Google Scholar] [CrossRef] [Scilit]
- Vitiello, M.; Tuccoli, A.; Poliseno, L. Long Non-Coding RNAs in Cancer: Implications for Personalized Therapy. Cell. Oncol. Dordr. 2015, 38, 17–28. [Google Scholar] [CrossRef] [Scilit]










| UpT LncRNAs in CRC | |||
|---|---|---|---|
| Chr7 (n = 22) | Chr8q (n = 9) | Chr13 (n = 7) | Chr20 (n = 17) |
| Gene Symbol | Gene Symbol | Gene Symbol | Gene Symbol |
| RNF216P1 (NR_023385) | SNHG6 (NR_002599) | PSPC1 (NR_044998) | NSFL1C (NR_038164) |
| PHF14 (NR_033435) | TMEM70 (NR_033334) | RPL21P28 (NR_026911) | NOP56 (NR_027700) |
| RPS2P32 (NR_026676) | ZFAND1 (NR_033193) | COG6 (NR_026745) | MAVS (NR_037921) |
| GGCT (NR_037669) | NACA4P (NR_002182) | ST13P4 (NR_002183) | NDUFAF5 (NR_029377) |
| HUS1 (NR_037917) | ENY2 (NR_036471) | ALG11 (NR_036571) | EDEM2 (NR_026728) |
| FKBP9P1 (NR_027339) | TATDN1 (NR_027427) | UBAC2 (NR_026644) | CPNE1 (NR_037188) |
| CRCP (NR_024548) | PVT1 (NR_003367) | TFDP1 (NR_026580) | NFS1 (NR_037570) |
| GTF2IP4 (NR_003580) | SHARPIN (NR_038270) | RBM39 (NR_040722) | |
| BCL7B (NR_036682) | ZNF252P (NR_023392) | NORAD (NR_027451) | |
| BUD23 (NR_037776) | RAB5IF (NR_026562) | ||
| NSUN5P1 (NR_033322) | NDRG3 (NR_038370) | ||
| PMS2P3 (NR_028059) | SRSF6 (NR_034009) | ||
| SLC25A13 (NR_027662) | ZFAS1 (NR_003604) | ||
| TAF6 (NR_033792) | PEDS1 (NR_027889) | ||
| PMS2P1 (NR_003613) | VAPB (NR_036633) | ||
| LOC100630923 (NR_038967) | SLMO2-ATP5E (NR_037930) | ||
| FAM185A (NR_026879) | TPD52L2 (NR_045090) | ||
| BCAP29 (NR_027830) | |||
| CBLL1 (NR_024199) | |||
| POT1 (NR_003102) | |||
| LINC01000 (NR_024368) | |||
| TNPO3 (NR_034053) | |||
| Targets | Forward Primer | Reverse Primer | Annealing Temperature | Fragment Size |
|---|---|---|---|---|
| ACTB NM_001101.5 | AGAGAGGCATCCTCACCCTG | ATAGCACAGCCTGGATAGCAA | 59/57 | 240 bp |
| SNHG6 NR_002599.2 | GTTAGTCATGCCGGTGTGGT | AATACATGCCGCGTGATCCT | 57/55 | 171 bp |
| NORAD NR_002599.2 | CAGACTTTGCTGTCGGAAGA | ACACAGGCCTTCCATAAACG | 55/55 | 113 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Scuderi, C.; Di Bella, V.; Privitera, A.P.; Giustolisi, F.M.; Barresi, V.; Condorelli, D.F. Gain-Type Aneuploidies Influence the Burden of Selective Long Non-Coding Transcripts in Colorectal Cancer. Int. J. Mol. Sci. 2024, 25, 5538. https://doi.org/10.3390/ijms25105538
Scuderi C, Di Bella V, Privitera AP, Giustolisi FM, Barresi V, Condorelli DF. Gain-Type Aneuploidies Influence the Burden of Selective Long Non-Coding Transcripts in Colorectal Cancer. International Journal of Molecular Sciences. 2024; 25(10):5538. https://doi.org/10.3390/ijms25105538
Chicago/Turabian StyleScuderi, Chiara, Virginia Di Bella, Anna Provvidenza Privitera, Francesca Maria Giustolisi, Vincenza Barresi, and Daniele Filippo Condorelli. 2024. "Gain-Type Aneuploidies Influence the Burden of Selective Long Non-Coding Transcripts in Colorectal Cancer" International Journal of Molecular Sciences 25, no. 10: 5538. https://doi.org/10.3390/ijms25105538
APA StyleScuderi, C., Di Bella, V., Privitera, A. P., Giustolisi, F. M., Barresi, V., & Condorelli, D. F. (2024). Gain-Type Aneuploidies Influence the Burden of Selective Long Non-Coding Transcripts in Colorectal Cancer. International Journal of Molecular Sciences, 25(10), 5538. https://doi.org/10.3390/ijms25105538

