Peptides with Antimicrobial Activity in the Saliva of the Malaria Vector Anopheles coluzzii
Abstract
1. Introduction
2. Results
2.1. Putative Salivary AMP Selection
2.2. Hyp15: Structural Features and Growth Inhibition Assays
2.3. Hyp6.2: Structural Features and Growth Inhibition Assays
2.4. Hyp13: Structural Features, Growth Inhibition Assays, and Electron Microscopy
3. Discussion and Conclusions
4. Materials and Methods
4.1. Sequence Retrieval and Bioinformatic Tools
4.2. Cloning Procedures for In Vitro Peptide Synthesis
4.3. Peptide Expression in the Wheat Germ Cell-Free System
4.4. Coomassie Staining and Western Blot Analysis
4.5. Chemical Synthesis of Peptides
4.6. Bacterial Strains
4.7. Bacterial Growth Inhibition Assay
4.8. Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC)
4.9. Scanning Electron Microscopy
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ribeiro, J.M.C.; Mans, B.J.; Arcà, B. An Insight into the Sialome of Blood-Feeding Nematocera. Insect Biochem. Mol. Biol. 2010, 40, 767–784. [Google Scholar] [CrossRef] [PubMed]
- Arcà, B.; Ribeiro, J.M. Saliva of Hematophagous Insects: A Multifaceted Toolkit. Curr. Opin. Insect Sci. 2018, 29, 102–109. [Google Scholar] [CrossRef] [PubMed]
- Vogt, M.B.; Lahon, A.; Arya, R.P.; Kneubehl, A.R.; Spencer Clinton, J.L.; Paust, S.; Rico-Hesse, R. Mosquito Saliva Alone Has Profound Effects on the Human Immune System. PLoS Negl. Trop. Dis. 2018, 12, e0006439. [Google Scholar] [CrossRef] [PubMed]
- Schneider, C.A.; Calvo, E.; Peterson, K.E. Arboviruses: How Saliva Impacts the Journey from Vector to Host. Int. J. Mol. Sci. 2021, 22, 9173. [Google Scholar] [CrossRef] [PubMed]
- Graumans, W.; Jacobs, E.; Bousema, T.; Sinnis, P. When Is a Plasmodium-Infected Mosquito an Infectious Mosquito? Trends Parasitol. 2020, 36, 705–716. [Google Scholar] [CrossRef] [PubMed]
- Lefteri, D.A.; Bryden, S.R.; Pingen, M.; Terry, S.; McCafferty, A.; Beswick, E.F.; Georgiev, G.; Van der Laan, M.; Mastrullo, V.; Campagnolo, P.; et al. Mosquito Saliva Enhances Virus Infection through Sialokinin-Dependent Vascular Leakage. Proc. Natl. Acad. Sci. USA 2022, 119, e2114309119. [Google Scholar] [CrossRef] [PubMed]
- Guerrero, D.; Cantaert, T.; Missé, D. Aedes Mosquito Salivary Components and Their Effect on the Immune Response to Arboviruses. Front. Cell Infect. Microbiol. 2020, 10, 407. [Google Scholar] [CrossRef]
- Arora, G.; Chuang, Y.M.; Sinnis, P.; Dimopoulos, G.; Fikrig, E. Malaria: Influence of Anopheles Mosquito Saliva on Plasmodium Infection. Trends Immunol. 2023, 44, 256–265. [Google Scholar] [CrossRef] [PubMed]
- Marín-López, A.; Raduwan, H.; Chen, T.Y.; Utrilla-Trigo, S.; Wolfhard, D.P.; Fikrig, E. Mosquito Salivary Proteins and Arbovirus Infection: From Viral Enhancers to Potential Targets for Vaccines. Pathogens 2023, 12, 371. [Google Scholar] [CrossRef]
- Accoti, A.; Damiani, C.; Nunzi, E.; Cappelli, A.; Iacomelli, G.; Monacchia, G.; Turco, A.; D’Alò, F.; Peirce, M.J.; Favia, G.; et al. Anopheline Mosquito Saliva Contains Bacteria That Are Transferred to a Mammalian Host through Blood Feeding. Front. Microbiol. 2023, 14, 1157613. [Google Scholar] [CrossRef]
- Arcà, B.; Lombardo, F.; Francischetti, I.M.B.; Pham, V.M.; Mestres-Simon, M.; Andersen, J.F.; Ribeiro, J.M.C.; Arcà, B.; Lombardo, F.; Francischetti, I.M.B.; et al. An Insight into the Sialome of the Adult Female Mosquito Aedes Albopictus. Insect Biochem. Mol. Biol. 2007, 37, 107–127. [Google Scholar] [CrossRef]
- Ribeiro, J.M.C.; Martin-Martin, I.; Arcà, B.; Calvo, E. A Deep Insight into the Sialome of Male and Female Aedes aegypti Mosquitoes. PLoS ONE 2016, 11, e0151400. [Google Scholar] [CrossRef] [PubMed]
- Arcà, B.; Lombardo, F.; Valenzuela, J.G.; Francischetti, I.M.B.; Marinotti, O.; Coluzzi, M.; Ribeiro, J.M.C.; Arcà, B.; Lombardo, F.; Valenzuela, J.G.; et al. An Updated Catalogue of Salivary Gland Transcripts in the Adult Female Mosquito, Anopheles Gambiae. J. Exp. Biol. 2005, 208, 3971–3986. [Google Scholar] [CrossRef] [PubMed]
- Luo, E.; Matsuoka, H.; Yoshida, S.; Iwai, K.; Arai, M.; Ishii, A. Changes in Salivary Proteins during Feeding and Detection of Salivary Proteins in the Midgut after Feeding in a Malaria Vector Mosquito, Anopheles Stephensi (Diptera: Culicidae). Med. Entomol. Zool. 2000, 51, 13–20. [Google Scholar] [CrossRef]
- Pascini, T.V.; Jeong, Y.J.; Huang, W.; Pala, Z.R.; Sá, J.M.; Wells, M.B.; Kizito, C.; Sweeney, B.; Alves e Silva, T.L.; Andrew, D.J.; et al. Transgenic Anopheles Mosquitoes Expressing Human PAI-1 Impair Malaria Transmission. Nat. Commun. 2022, 13, 2949. [Google Scholar] [CrossRef] [PubMed]
- Klug, D.; Blandin, S.A. Activation of Complement-like Antiparasitic Responses in Anopheles Mosquitoes. Curr. Opin. Microbiol. 2023, 72. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, J.M.C.; Arca, B.; Lombardo, F.; Calvo, E.; Phan, V.M.; Chandra, P.K.; Wikel, S.K.; Arcà, B.; Lombardo, F.; Calvo, E.; et al. An Annotated Catalogue of Salivary Gland Transcripts in the Adult Female Mosquito, Aedes aegypti. BMC Genom. 2007, 8, 6. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, J.; Arcà, B. From Sialomes to the Sialoverse: An Insight into Salivary Potion of Blood-Feeding Insects. Adv. Insect Phys. 2009, 37, 59–118. [Google Scholar] [CrossRef]
- Fry, B.; Roelants, K. The Toxicogenomic Multiverse: Convergent Recruitment of Proteins into Animal Venoms. Annu. Rev. Genom. Hum. Genet. 2009, 10, 483–511. [Google Scholar] [CrossRef] [PubMed]
- James, A.A.; Rossignol, P.A. Mosquito Salivary Glands: Parasitological and Molecular Aspects. Parasitol. Today 1991, 7, 267–271. [Google Scholar] [CrossRef]
- Rossignol, P.A.; Lueders, A.M. Bacteriolytic Factor in the Salivary Glands of Aedes aegypti. Comp. Biochem. Physiol. B 1986, 83, 819–822. [Google Scholar] [CrossRef]
- Calvo, E.; Pham, V.M.; Lombardo, F.; Arca, B.; Ribeiro, J.M. The Sialotranscriptome of Adult Male Anopheles Gambiae Mosquitoes. Insect Biochem. Mol. Biol. 2006, 36, 570–575. [Google Scholar] [CrossRef]
- Rosinski-Chupin, I.; Briolay, J.; Brouilly, P.; Perrot, S.; Gomez, S.M.; Chertemps, T.; Roth, C.W.; Keime, C.; Gandrillon, O.; Couble, P.; et al. SAGE Analysis of Mosquito Salivary Gland Transcriptomes during Plasmodium Invasion. Cell Microbiol. 2007, 9, 708–724. [Google Scholar] [CrossRef] [PubMed]
- Rosinski-Chupin, I.; Chertemps, T.; Boisson, B.; Perrot, S.; Bischoff, E.; Briolay, J.; Couble, P.; Ménard, R.; Brey, P.; Baldacci, P. Serial Analysis of Gene Expression in Plasmodium berghei Salivary Gland Sporozoites. BMC Genom. 2007, 8, 466. [Google Scholar] [CrossRef] [PubMed]
- Pinheiro-Silva, R.; Borges, L.; Coelho, L.P.; Cabezas-Cruz, A.; Valdés, J.J.; do Rosário, V.; de la Fuente, J.; Domingos, A. Gene Expression Changes in the Salivary Glands of Anopheles Coluzzii Elicited by Plasmodium berghei Infection. Parasit. Vectors 2015, 8, 485. [Google Scholar] [CrossRef] [PubMed]
- Chowdhury, A.; Modahl, C.M.; Tan, S.T.; Wei Xiang, B.W.; Missé, D.; Vial, T.; Kini, R.M.; Pompon, J.F. JNK Pathway Restricts DENV2, ZIKV and CHIKV Infection by Activating Complement and Apoptosis in Mosquito Salivary Glands. PLoS Pathog. 2020, 16, e1008754. [Google Scholar] [CrossRef]
- Bevivino, G.; Arcà, B.; Lombardo, F. Effects of Local and Systemic Immune Challenges on the Expression of Selected Salivary Genes in the Malaria Mosquito Anopheles Coluzzii. Pathogens 2021, 10, 1300. [Google Scholar] [CrossRef]
- Das De, T.; Sharma, P.; Thomas, T.; Singla, D.; Tevatiya, S.; Kumari, S.; Chauhan, C.; Rani, J.; Srivastava, V.; Kaur, R.; et al. Interorgan Molecular Communication Strategies of “Local” and “Systemic” Innate Immune Responses in Mosquito Anopheles Stephensi. Front. Immunol. 2018, 9, 148. [Google Scholar] [CrossRef]
- Clayton, A.M.; Dong, Y.; Dimopoulos, G. The Anopheles Innate Immune System in the Defense against Malaria Infection. J. Innate Immun. 2014, 6, 169–181. [Google Scholar] [CrossRef]
- Osta, M.A.; Christophides, G.K.; Kafatos, F.C. Effects of Mosquito Genes on Plasmodium Development. Science 2004, 303, 2030–2032. [Google Scholar] [CrossRef]
- Saraiva, R.G.; Kang, S.; Simões, M.L.; Angleró-Rodríguez, Y.I.; Dimopoulos, G. Mosquito Gut Antiparasitic and Antiviral Immunity. Dev. Comp. Immunol. 2016, 64, 53–64. [Google Scholar] [CrossRef] [PubMed]
- Tikhe, C.V.; Dimopoulos, G. Mosquito Antiviral Immune Pathways. Dev. Comp. Immunol. 2021, 116, 103964. [Google Scholar] [CrossRef] [PubMed]
- Baltzer, S.A.; Brown, M.H. Antimicrobial Peptides-Promising Alternatives to Conventional Antibiotics. J. Mol. Microbiol. Biotechnol. 2011, 20, 228–235. [Google Scholar] [CrossRef] [PubMed]
- Manniello, M.D.; Moretta, A.; Salvia, R.; Scieuzo, C.; Lucchetti, D.; Vogel, H.; Sgambato, A.; Falabella, P. Insect Antimicrobial Peptides: Potential Weapons to Counteract the Antibiotic Resistance. Cell. Mol. Life Sci. 2021, 78, 4259–4282. [Google Scholar] [CrossRef] [PubMed]
- Hancock, R.E.W.; Sahl, H.G. Antimicrobial and Host-Defense Peptides as New Anti-Infective Therapeutic Strategies. Nat. Biotechnol. 2006, 24, 1551–1557. [Google Scholar] [CrossRef]
- Tonk, M.; Vilcinskas, A. The Medical Potential of Antimicrobial Peptides from Insects. Curr. Top. Med. Chem. 2017, 17, 554–575. [Google Scholar] [CrossRef] [PubMed]
- Jin, G.; Weinberg, A. Human Antimicrobial Peptides and Cancer. Semin. Cell Dev. Biol. 2019, 88, 156–162. [Google Scholar] [CrossRef]
- Stuart, B.A.R.; Franitza, A.L.; E, L. Regulatory Roles of Antimicrobial Peptides in the Nervous System: Implications for Neuronal Aging. Front. Cell Neurosci. 2022, 16, 843790. [Google Scholar] [CrossRef]
- Yi, H.Y.; Chowdhury, M.; Huang, Y.D.; Yu, X.Q. Insect Antimicrobial Peptides and Their Applications. Appl. Microbiol. Biotechnol. 2014, 98, 5807–5822. [Google Scholar] [CrossRef]
- Mahlapuu, M.; Björn, C.; Ekblom, J. Antimicrobial Peptides as Therapeutic Agents: Opportunities and Challenges. Crit. Rev. Biotechnol. 2020, 40, 978–992. [Google Scholar] [CrossRef]
- Lai, Y.; Gallo, R.L. AMPed up Immunity: How Antimicrobial Peptides Have Multiple Roles in Immune Defense. Trends Immunol. 2009, 30, 131–141. [Google Scholar] [CrossRef]
- Kumar, A.; Srivastava, P.; Sirisena, P.D.N.N.; Dubey, S.K.; Kumar, R.; Shrinet, J.; Sunil, S. Mosquito Innate Immunity. Insects 2018, 9, 95. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Zhu, Y.; Pang, X.; Xiao, X.; Zhang, R.; Cheng, G. Regulation of Antimicrobial Peptides in Aedes aegypti Aag2 Cells. Front. Cell Infect. Microbiol. 2017, 7, 22. [Google Scholar] [CrossRef]
- Gendrin, M.; Christophides, G.K. The Anopheles Mosquito Microbiota and Their Impact on Pathogen Transmission. In Anopheles Mosquitoes—New Insights into Malaria Vectors; IntechOpen: Rijeka, Croatia, 2013; book chapter 2. [Google Scholar] [CrossRef]
- Hultmark, D.; Steiner, H.; Rasmuson, T.; Boman, H.G. Insect Immunity. Purification and Properties of Three Inducible Bactericidal Proteins from Hemolymph of Immunized Pupae of Hyalophora Cecropia. Eur. J. Biochem. 1980, 106, 7–16. [Google Scholar] [CrossRef] [PubMed]
- Steiner, H.; Hultmark, D.; Engström, Å.; Bennich, H.; Boman, H.G. Sequence and Specificity of Two Antibacterial Proteins Involved in Insect Immunity. Nature 1981, 292, 246–248. [Google Scholar] [CrossRef]
- Wang, X.; Wang, G. Insights into Antimicrobial Peptides from Spiders and Scorpions. Protein Pept. Lett. 2016, 23, 707–721. [Google Scholar] [CrossRef] [PubMed]
- Mylonakis, E.; Podsiadlowski, L.; Muhammed, M.; Vilcinskas, A. Diversity, Evolution and Medical Applications of Insect Antimicrobial Peptides. Philos. Trans. R. Soc. B Biol. Sci. 2016, 371, 20150290. [Google Scholar] [CrossRef]
- Erdem Büyükkiraz, M.; Kesmen, Z. Antimicrobial Peptides (AMPs): A Promising Class of Antimicrobial Compounds. J. Appl. Microbiol. 2022, 132, 1573–1596. [Google Scholar] [CrossRef] [PubMed]
- Lazzaro, B.P.; Zasloff, M.; Rolff, J. Antimicrobial Peptides: Application Informed by Evolution. Science 2020, 368, eaau5480. [Google Scholar] [CrossRef]
- Rima, M.; Rima, M.; Fajloun, Z.; Sabatier, J.M.; Bechinger, B.; Naas, T. Antimicrobial Peptides: A Potent Alternative to Antibiotics. Antibiotics 2021, 10, 1095. [Google Scholar] [CrossRef]
- Arcà, B.; Lombardo, F.; Struchiner, C.J.; Ribeiro, J.M.C. Anopheline Salivary Protein Genes and Gene Families: An Evolutionary Overview after the Whole Genome Sequence of Sixteen Anopheles Species. BMC Genom. 2017, 18, 153. [Google Scholar] [CrossRef] [PubMed]
- Moreira-Ferro, C.K.; Daffre, S.; James, A.A.; Marinotti, O. A Lysozyme in the Salivary Glands of the Malaria Vector Anopheles Darlingi. Insect Mol. Biol. 1998, 7, 257–264. [Google Scholar] [CrossRef] [PubMed]
- Wong, E.S.W.; Hardy, M.C.; Wood, D.; Bailey, T.; King, G.F. SVM-Based Prediction of Propeptide Cleavage Sites in Spider Toxins Identifies Toxin Innovation in an Australian Tarantula. PLoS ONE 2013, 8, e66279. [Google Scholar] [CrossRef] [PubMed]
- Pineda, S.S.; Chaumeil, P.A.; Kunert, A.; Kaas, Q.; Thang, M.W.C.; Le, L.; Nuhn, M.; Herzig, V.; Saez, N.J.; Cristofori-Armstrong, B.; et al. ArachnoServer 3.0: An Online Resource for Automated Discovery, Analysis and Annotation of Spider Toxins. Bioinformatics 2018, 34, 1074–1076. [Google Scholar] [CrossRef] [PubMed]
- Duckert, P.; Brunak, S.; Blom, N. Prediction of Proprotein Convertase Cleavage Sites. Protein Eng. Des. Sel. 2004, 17, 107–112. [Google Scholar] [CrossRef] [PubMed]
- Maharaj, P.D.; Widen, S.G.; Huang, J.; Wood, T.G.; Thangamani, S. Discovery of Mosquito Saliva MicroRNAs during CHIKV Infection. PLoS Negl. Trop. Dis. 2015, 9, 18–24. [Google Scholar] [CrossRef] [PubMed]
- Arcà, B.; Colantoni, A.; Fiorillo, C.; Severini, F.; Benes, V.; Di Luca, M.; Calogero, R.A.; Lombardo, F. MicroRNAs from Saliva of Anopheline Mosquitoes Mimic Human Endogenous MiRNAs and May Contribute to Vector-Host-Pathogen Interactions. Sci. Rep. 2019, 9, 2955. [Google Scholar] [CrossRef] [PubMed]
- Fiorillo, C.; Yen, P.S.; Colantoni, A.; Mariconti, M.; Azevedo, N.; Lombardo, F.; Failloux, A.B.; Arcà, B. MicroRNAs and Other Small RNAs in Aedes aegypti Saliva and Salivary Glands Following Chikungunya Virus Infection. Sci. Rep. 2022, 12, 9536. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, J.M. Vector Salivation and Parasite Transmission. Mem. Inst. Oswaldo Cruz 1987, 82 (Suppl. S3), 1–3. [Google Scholar] [CrossRef]
- Pimenta, P.F.; Touray, M.; Miller, L. The Journey of Malaria Sporozoites in the Mosquito Salivary Gland. J. Eukaryot. Microbiol. 1994, 41, 608–624. [Google Scholar] [CrossRef]
- Ghosh, A.K.; Jacobs-Lorena, M. Plasmodium Sporozoite Invasion of the Mosquito Salivary Gland. Curr. Opin. Microbiol. 2009, 12, 394–400. [Google Scholar] [CrossRef] [PubMed]
- Klug, D.; Gautier, A.; Calvo, E.; Marois, E.; Blandin, S.A. The Salivary Protein Saglin Facilitates Efficient Midgut Colonization of Anopheles Mosquitoes by Malaria Parasites. PLoS Pathog. 2023, 19, e1010538. [Google Scholar] [CrossRef] [PubMed]
- Chaerkady, R.; Kelkar, D.S.; Muthusamy, B.; Kandasamy, K.; Dwivedi, S.B.; Sahasrabuddhe, N.A.; Kim, M.S.; Renuse, S.; Pinto, S.M.; Sharma, R.; et al. A Proteogenomic Analysis of Anopheles Gambiae Using High-Resolution Fourier Transform Mass Spectrometry. Genome Res. 2011, 21, 1872–1881. [Google Scholar] [CrossRef] [PubMed]
- Vlachou, D.; Schlegelmilch, T.; Christophides, G.K.; Kafatos, F.C. Functional Genomic Analysis of Midgut Epithelial Responses in Anopheles during Plasmodium Invasion. Curr. Biol. 2005, 15, 1185–1195. [Google Scholar] [CrossRef] [PubMed]
- Byrd, A.L.; Belkaid, Y.; Segre, J.A. The Human Skin Microbiome. Nat. Rev. Microbiol. 2018, 16, 143–155. [Google Scholar] [CrossRef] [PubMed]
- Burian, M.; Plange, J.; Schmitt, L.; Kaschke, A.; Marquardt, Y.; Huth, L.; Baron, J.M.; Hornef, M.W.; Wolz, C.; Yazdi, A.S. Adaptation of Staphylococcus Aureus to the Human Skin Environment Identified Using an Ex Vivo Tissue Model. Front. Microbiol. 2021, 12, 728989. [Google Scholar] [CrossRef] [PubMed]
- Blount, Z.D. The Unexhausted Potential of E. coli. eLife 2015, 4, e05826. [Google Scholar] [CrossRef] [PubMed]
- Lombardo, F.; Ronca, R.; Rizzo, C.; Mestres-Simon, M.; Lanfrancotti, A.; Curra, C.; Fiorentino, G.; Bourgouin, C.; Ribeiro, J.M.C.; Petrarca, V.; et al. The Anopheles Gambiae Salivary Protein GSG6: An Anopheline-Specific Protein with a Blood-Feeding Role. Insect Biochem. Mol. Biol. 2009, 39, 457–466. [Google Scholar] [CrossRef] [PubMed]
- Francischetti, I. Toward a Catalog for the Transcripts and Proteins (Sialome) from the Salivary Gland of the Malaria Vector Anopheles Gambiae. J. Exp. Biol. 2002, 2451, 2429–2451. [Google Scholar] [CrossRef] [PubMed]
- Calvo, E.; Mans, B.J.; Andersen, J.F.; Ribeiro, J.M. Function and Evolution of a Mosquito Salivary Protein Family. J. Biol. Chem. 2006, 281, 1935–1942. [Google Scholar] [CrossRef]
- Marinotti, O.; James, A.A.; Ribeiro, J. Diet and Salivation in Female Aedes aegypti Mosquitoes. J. Insect Physiol. 1990, 36, 545–548. [Google Scholar] [CrossRef]
- Novak, M.G.; Ribeiro, J.M.C.; Hildebrand, J.G. 5-Hydroxytryptamine in the Salivary Glands of Adult Female Aedes aegypti and Its Role in Regulation of Salivation. J. Exp. Biol. 1995, 198, 167–174. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Soohoo-Hui, A.; O’Hara, F.M.; Swale, D.R. ATP-Sensitive Inward Rectifier Potassium Channels Reveal Functional Linkage between Salivary Gland Function and Blood Feeding in the Mosquito, Aedes aegypti. Commun. Biol. 2022, 5, 278. [Google Scholar] [CrossRef] [PubMed]
- Gómez-Díaz, E.; Rivero, A.; Chandre, F.; Corces, V.G. Insights into the Epigenomic Landscape of the Human Malaria Vector Anopheles Gambiae. Front. Genet. 2014, 5, 277. [Google Scholar] [CrossRef]
- Ruiz, J.L.; Ranford-Cartwright, L.C.; Gómez-Díaz, E. The Regulatory Genome of the Malaria Vector Anopheles Gambiae: Integrating Chromatin Accessibility and Gene Expression. NAR Genom. Bioinform. 2021, 3, lqaa113. [Google Scholar] [CrossRef]
- Jeffery, G.M. Blood Meal Volume in Anopheles Quadrimaculatus, A. Albimanus and Aedes aegypti. Exp. Parasitol. 1956, 5, 371–375. [Google Scholar] [CrossRef] [PubMed]
- Graumans, W.; Heutink, R.; Van Gemert, G.J.; Van De Vegte-Bolmer, M.; Bousema, T.; Collins, K.A. A Mosquito Feeding Assay to Examine Plasmodium Transmission to Mosquitoes Using Small Blood Volumes in 3D Printed Nano-Feeders. Parasites Vectors 2020, 13, 401. [Google Scholar] [CrossRef]
- Jové, V.; Gong, Z.; Hol, F.J.H.; Zhao, Z.; Sorrells, T.R.; Carroll, T.S.; Prakash, M.; McBride, C.S.; Vosshall, L.B. Sensory Discrimination of Blood and Floral Nectar by Aedes aegypti Mosquitoes. Neuron 2020, 108, 1163–1180.e12. [Google Scholar] [CrossRef]
- Hajam, I.A.; Dar, P.A.; Won, G.; Lee, J.H. Bacterial Ghosts as Adjuvants: Mechanisms and Potential. Vet. Res. 2017, 48, 37. [Google Scholar] [CrossRef]
- Ma, Y.; Zhu, W.; Zhu, G.; Xu, Y.; Li, S.; Chen, R.; Chen, L.; Wang, J. Efficient Robust Yield Method for Preparing Bacterial Ghosts by Escherichia Coli Phage ID52 Lysis Protein E. Bioengineering 2022, 9, 300. [Google Scholar] [CrossRef]
- Chen, R.-B.; Zhang, K.; Zhang, H.; Gao, C.-Y.; Li, C.-L. Analysis of the Antimicrobial Mechanism of Porcine Beta Defensin 2 against E. coli by Electron Microscopy and Differentially Expressed Genes. Sci. Rep. 2018, 8, 14711. [Google Scholar] [CrossRef] [PubMed]
- Huan, Y.; Kong, Q.; Mou, H.; Yi, H. Antimicrobial Peptides: Classification, Design, Application and Research Progress in Multiple Fields. Front. Microbiol. 2020, 11, 582779. [Google Scholar] [CrossRef] [PubMed]
- Roversi, D.; Luca, V.; Aureli, S.; Park, Y.; Mangoni, M.L.; Stella, L. How Many Antimicrobial Peptide Molecules Kill a Bacterium? The Case of PMAP-23. ACS Chem. Biol. 2014, 9, 2003–2007. [Google Scholar] [CrossRef] [PubMed]
- Chongsiriwatana, N.P.; Lin, J.S.; Kapoor, R.; Wetzler, M.; Rea, J.A.C.; Didwania, M.K.; Contag, C.H.; Barron, A.E. Intracellular Biomass Flocculation as a Key Mechanism of Rapid Bacterial Killing by Cationic, Amphipathic Antimicrobial Peptides and Peptoids. Sci. Rep. 2017, 7, 16718. [Google Scholar] [CrossRef]
- Varadi, M.; Anyango, S.; Deshpande, M.; Nair, S.; Natassia, C.; Yordanova, G.; Yuan, D.; Stroe, O.; Wood, G.; Laydon, A.; et al. AlphaFold Protein Structure Database: Massively Expanding the Structural Coverage of Protein-Sequence Space with High-Accuracy Models. Nucleic Acids Res. 2022, 50, D439–D444. [Google Scholar] [CrossRef]







| Genes | AGAP ID | Transcriptional Profile | Precursor | Putative Propeptide | Putative Mature | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SG+ | SG F/M | U | AA | kDa | SP | AA | kDa | pI | AA | kDa | pI | ||
| hyp13 | AGAP003474 | X | 56 | 6.2 | 22 | 34 | 3.8 | 4.75 | 19 | 2.0 | 3.77 | ||
| hyp15 | AGAP000152 | X | 78 | 9.9 | 30 | 48 | 4.9 | 10.55 | |||||
| hyp6.2 | AGAP006495 | X | 85 | 9.3 | 27 | 58 | 6.3 | 10.41 | 35 | 4.0 | 11.57 | ||
| hyp6.3 | AGAP007195 | X | 83 | 8.8 | 21 | 62 | 6.5 | 6.29 | |||||
| hyp10 | AGAP008307 | X | 90 | 10.0 | 19 | 67 | 7.5 | 5.42 | 63 | 7.0 | 5.77 | ||
| hyp12 | AGAP008306 | X | 92 | 10.0 | 21 | 71 | 7.9 | 4.47 | |||||
| hyp8.2 | AGAP006494 | X | 91 | 9.8 | 18 | 73 | 7.9 | 4.19 | |||||
| sg2 | AGAP006506 | X | 114 | 11.8 | 20 | 94 | 9.7 | 3.49 | |||||
| Ag_sal_Lyzo1 | AGAP007347 | X | 140 | 15.3 | 20 | 120 | 13.3 | 8.91 | |||||
| hyp14.5 | AGAP004883 | X | 180 | 19.7 | 26 | 154 | 16.8 | 8.07 | |||||
| gSG9 | AGAP013423 | X | 393 | 42.7 | 23 | 370 | 40.1 | 5.78 | 148 | 15.6 | 5.76 | ||
| hyp55.3 | AGAP005822 | X | 513 | 55.2 | 21 | 492 | 52.9 | 8.73 | 276 | 29.8 | 8.77 | ||
| Gene | AGAP ID | ID pr. For | Primer for Sequence | ID pr. Rev | Primer Rev Sequence | Length |
|---|---|---|---|---|---|---|
| hyp13 | AGAP003474 | 03474_F | GTCACCATGGGGAACGAAATCATACAAAA | 03474_R | GTCACCCGGGTTGCGATCCGGAGTCACTGT | 105 |
| hyp15 | AGAP000152 | 00152_F | GTCACCATGGATCCACTGCCGGGCAGAGA | 00152_R | GTCACCCGGGCATGTTTGTTAATACACCGC | 147 |
| hyp6.2 | AGAP006495 | 06495_F | GTCACCATGGCTCCACAAGTGACTGAGGC | 06495_R | GTCACCCGGGCTTTTTCACTCGCAAAAAAT | 177 |
| hyp6.3 | AGAP007195 | 07195_F | GTCACCATGGTGCCTCAACCTGAGCAGGCC | 07195_R | GTCACCCGGGGCAATCAATCAGATCGCAAC | 189 |
| hyp10 | AGAP008307 | 08307_F | GTCACCATGGAAGACCCCCGTACCGAGCT | 08307_R | GTCACCCGGGGCGAATATCCTTTGTACAGT | 204 |
| hyp12 | AGAP008306 | 08306_F | GTCACCATGGGAAACGATCCAGTCGATGCACT | 08306_R | GTCACCCGGGTTGTATATTCTTAGTACAGT | 216 |
| hyp8.2 | AGAP006494 | 06494_F | GTCACCATGGAAGAAGCTAGTACCGCAGC | 06494_R | GTCACCCGGGGCCTGAAAACGAGAAGGGCA | 222 |
| sg2 | AGAP006506 | 06506_F | GTCACCATGGTTCCGACCAGCTTCAACTAC | 06506_R | GTCACCCGGGTCCGAAGAACGGAAAACCTC | 285 |
| Ag_sal_Lyzo1 | AGAP007347 | 07347_F | GTCACCATGGGTAAAACGTTCGGCAAATGTG | 07347_R | GTCACCCGGGAAAACAGGAGCTAACATTCG | 363 |
| hyp14.5 | AGAP004883 | 04883_F | GTCACCATGGTGCAATGTCGCAACTGTCTA | 04883_R | GTCACCCGGGTCGTGCTGCTAGAAGAAGAA | 465 |
| gSG9 | AGAP013423 | 13423_F | GTCACCATGGGTAGTCCATTCTTTTTCCAATA | 13423_R | GTCACCCGGGCGAACCAAATACTTGACAAA | 1113 |
| hyp55.3 | AGAP005822 | 05822_F | GTCACCATGGTGCCCGACTTTGCGGTACCG | 05822_R | GTCACCCGGGACTCAAACAGTTGGCAATCG | 1479 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bevivino, G.; Maurizi, L.; Ammendolia, M.G.; Longhi, C.; Arcà, B.; Lombardo, F. Peptides with Antimicrobial Activity in the Saliva of the Malaria Vector Anopheles coluzzii. Int. J. Mol. Sci. 2024, 25, 5529. https://doi.org/10.3390/ijms25105529
Bevivino G, Maurizi L, Ammendolia MG, Longhi C, Arcà B, Lombardo F. Peptides with Antimicrobial Activity in the Saliva of the Malaria Vector Anopheles coluzzii. International Journal of Molecular Sciences. 2024; 25(10):5529. https://doi.org/10.3390/ijms25105529
Chicago/Turabian StyleBevivino, Giulia, Linda Maurizi, Maria Grazia Ammendolia, Catia Longhi, Bruno Arcà, and Fabrizio Lombardo. 2024. "Peptides with Antimicrobial Activity in the Saliva of the Malaria Vector Anopheles coluzzii" International Journal of Molecular Sciences 25, no. 10: 5529. https://doi.org/10.3390/ijms25105529
APA StyleBevivino, G., Maurizi, L., Ammendolia, M. G., Longhi, C., Arcà, B., & Lombardo, F. (2024). Peptides with Antimicrobial Activity in the Saliva of the Malaria Vector Anopheles coluzzii. International Journal of Molecular Sciences, 25(10), 5529. https://doi.org/10.3390/ijms25105529

